ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal2p15
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nit... 220 4e-54
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 208 1e-50
3dbj|AP005659.2| Oryza sativa (japonica cultivar-group) genomic D... 208 1e-50
4gb|AY104853.1| Zea mays PCO142365 mRNA sequence 167 5e-38
5gb|AF045033.1|AF045033 Zea mays nitrate-induced NOI protein mRNA... 147 4e-32
6gb|AF030385.1|AF030385 Zea mays nitrate-induced NOI protein gene... 137 4e-29
7emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n2... 88 3e-14
8emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i2... 88 3e-14
9gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete ... 80 8e-12
10dbj|AK059360.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
11ref|XM_467563.1| Oryza sativa (japonica cultivar-group), mRNA 66 1e-07
12dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
13dbj|AP004179.3| Oryza sativa (japonica cultivar-group) genomic D... 66 1e-07
14ref|NM_124967.2| Arabidopsis thaliana NOI AT5G55850 (NOI) mRNA, ... 62 2e-06
15gb|AY096671.1| Arabidopsis thaliana putative nitrate-induced NOI... 62 2e-06
16gb|AY065260.1| Arabidopsis thaliana putative NOI protein, nitrat... 62 2e-06
17emb|BX833781.1|CNS09Z02 Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
18dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 62 2e-06
19gb|AY105745.1| Zea mays PCO136119 mRNA sequence 62 2e-06
20gb|AF030386.1|AF030386 Arabidopsis thaliana NOI protein mRNA, co... 62 2e-06
21gb|DQ160112.1| Taraxacum officinale TO72-1rc (To72-1rc) mRNA, pa... 60 8e-06
22gb|AY140529.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-11 unkno... 58 3e-05
23gb|AY140528.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-4 unknow... 58 3e-05
24gb|AY140527.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-3 unknow... 58 3e-05
25emb|BX833526.1|CNS09ZA1 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
26gb|AY140526.1| Arabidopsis thaliana clone P3WB2-A11-6094 unknown... 56 1e-04
27gb|AY140525.1| Arabidopsis thaliana clone P3WB2-A11-6092 unknown... 56 1e-04
28gb|AY140524.1| Arabidopsis thaliana clone P3WB2-A11-6054 unknown... 56 1e-04
29gb|AY140522.1| Arabidopsis thaliana clone P3WB2-A11-1220 unknown... 56 1e-04
30gb|AY140521.1| Arabidopsis thaliana clone P3WB2-A11-1202 unknown... 56 1e-04
31gb|AY140520.1| Arabidopsis thaliana clone P3WB2-A11-1084 unknown... 56 1e-04
32gb|AY140519.1| Arabidopsis thaliana clone P3WB2-A11-1074 unknown... 56 1e-04
33gb|AY140518.1| Arabidopsis thaliana clone P3WB2-A11-1006 unknown... 56 1e-04
34gb|AY140517.1| Arabidopsis thaliana clone P3WB2-A11-996 unknown ... 56 1e-04
35gb|AY140516.1| Arabidopsis thaliana clone P3WB2-A11-970 unknown ... 56 1e-04
36gb|AY140515.1| Arabidopsis thaliana clone P3WB2-A11-903 unknown ... 56 1e-04
37gb|AY140531.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-15 unkno... 50 0.007
38gb|AY140530.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-14 unkno... 50 0.007
39ref|NM_126474.1| Arabidopsis thaliana unknown protein AT2G04410 ... 48 0.029
40gb|AC006951.6| Arabidopsis thaliana chromosome 2 clone T1O3 map ... 48 0.029
41gb|AY058877.1| Arabidopsis thaliana At2g04410/T1O3.18 mRNA, comp... 48 0.029
42gb|AY140523.1| Arabidopsis thaliana clone P3WB2-A11-1248 unknown... 48 0.029
43ref|NM_123429.2| Arabidopsis thaliana unknown protein AT5G40645 ... 42 1.8
44gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome... 42 1.8
45gb|AC150788.1| Oryza sativa (japonica cultivar-group) chromosome... 42 1.8
46gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.8
47gb|DQ447022.1| Arabidopsis thaliana clone pENTR221-At5g40645 nit... 42 1.8
48emb|AL138899.23| Human DNA sequence from clone RP11-404O13 on ch... 42 1.8
49emb|AL138649.1|ATT14D3 Arabidopsis thaliana DNA chromosome 3, BA... 42 1.8
50dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.8
51dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.8
52gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.8
53dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 1.8
54emb|AL135818.3|CNS01DVH Human chromosome 14 DNA sequence BAC C-2... 42 1.8
55emb|AL133153.3|CNS01DU3 Human chromosome 14 DNA sequence BAC R-8... 42 1.8
56gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, co... 40 7.1
57gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, com... 40 7.1
58gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's H... 40 7.1
59gb|AC006028.3| Homo sapiens BAC clone GS1-165O14 from 7, complet... 40 7.1
60gb|AC112150.4| Mus musculus BAC clone RP24-84I17 from chromosome... 40 7.1
61gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosom... 40 7.1
62gb|BC014806.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA c... 40 7.1
63gb|AC099668.2| Homo sapiens chromosome 3 clone RP11-901L6, compl... 40 7.1
64gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, comple... 40 7.1
65gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, com... 40 7.1
66gb|BC039766.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA c... 40 7.1
67emb|BX511035.7| Human DNA sequence from clone RP11-435J19 on chr... 40 7.1
68gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, co... 40 7.1
69emb|AL355310.20| Human DNA sequence from clone RP5-1160K1 on chr... 40 7.1
70ref|NM_003458.2| Homo sapiens bassoon (presynaptic cytomatrix pr... 40 7.1
71emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J... 40 7.1
72gb|AC118290.7| Rattus norvegicus 2 BAC CH230-366D18 (Children's ... 40 7.1
73gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, comp... 40 7.1
74emb|AL031883.1|DMC11F6 Drosophila melanogaster cosmid clone 11F6 40 7.1
75emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 m... 40 7.1
76emb|AL844182.10| Mouse DNA sequence from clone RP23-399H17 on ch... 40 7.1
77emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chr... 40 7.1
78gb|AC105774.8| Drosophila melanogaster X BAC RP98-8O5 (Roswell P... 40 7.1
79gb|AC092859.26| Pan troglodytes clone rp43-111m15, complete sequ... 40 7.1
80gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 40 7.1
81gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell ... 40 7.1
82emb|BX465229.7| Zebrafish DNA sequence from clone CH211-174D2 in... 40 7.1
83gb|AC105061.16| Mus musculus chromosome 19, clone RP23-117I10, c... 40 7.1
84gb|AC121099.8| Mus musculus chromosome 3, clone RP24-501F21, com... 40 7.1
85gb|AC022267.8|AC022267 Homo sapiens BAC clone RP11-407H18 from 4... 40 7.1
86emb|BX324002.8| Zebrafish DNA sequence from clone CH211-129H21 i... 40 7.1
87gb|AC141000.7| Homo sapiens 3 BAC RP11-480C15 (Roswell Park Canc... 40 7.1
88gb|AC007614.7| Homo sapiens chromosome 16 clone RP11-491F9, comp... 40 7.1
89gb|AC138374.2| Homo sapiens chromosome 11, clone CTD-2647G13, co... 40 7.1
90gb|AY230143.1| Leishmania major clone B2015 phosphoglycan beta 1... 40 7.1
91dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 7.1
92gb|AC131934.13| Homo sapiens chromosome 11, clone RP11-754B17, c... 40 7.1
93gb|AF434264.1| Salmo trutta clone 64 internal transcribed spacer... 40 7.1
94gb|AF434263.1| Salmo trutta clone 76 internal transcribed spacer... 40 7.1
95gb|AF434262.1| Salmo trutta clone 75 internal transcribed spacer... 40 7.1
96gb|AF434261.1| Salmo trutta clone 74 internal transcribed spacer... 40 7.1
97gb|AF434260.1| Salmo trutta clone 53 internal transcribed spacer... 40 7.1
98gb|AF434259.1| Salmo trutta clone 68 internal transcribed spacer... 40 7.1
99gb|AF434258.1| Salmo trutta clone 52 internal transcribed spacer... 40 7.1
100gb|AF434257.1| Salmo trutta clone 55 internal transcribed spacer... 40 7.1
101gb|AF434256.1| Salmo trutta clone 51 internal transcribed spacer... 40 7.1
102gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, com... 40 7.1
103gb|BC087948.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA c... 40 7.1
104emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 40 7.1
105emb|CR937049.3| CH230-323M7, complete sequence 40 7.1
106dbj|AP006284.2| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.1
107gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 o... 40 7.1
108gb|AF052224.1|AF052224 Homo sapiens neuronal double zinc finger ... 40 7.1
109emb|BX322562.1|HSQ21A11 Homo sapiens chromosome 21 from cosmid L... 40 7.1
110emb|CT010517.11| Mouse DNA sequence from clone RP23-357P12 on ch... 40 7.1
111emb|CR962122.2| Medicago truncatula chromosome 5 clone mte1-46l2... 40 7.1
112emb|CT010439.6| Mouse DNA sequence from clone RP23-26E8 on chrom... 40 7.1
113dbj|AP006701.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 7.1
114emb|AL929506.8| Mouse DNA sequence from clone RP23-223I8 on chro... 40 7.1 
>gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nitrate-induced NOI
             protein (75-1-127BAC12.1), putative NBS-LRR disease
             resistance protein (Nbs1-Pi9), putative NBS-LRR disease
             resistance protein (Nbs3-Pi9), and NBS-LRR disease
             resistance protein (Pi9) genes, complete cds; putative
             NBS-LRR disease resistance protein (Nbs4-Pi9) pseudogene,
             complete sequence; putative NBS-LRR disease resistance
             protein (Nbs5-Pi9) gene, complete cds; putative NBS-LRR
             disease resistance protein (Nbs6-Pi9) gene, partial cds;
             and solo-long terminal repeat retrotransposon, complete
             sequence
          Length = 76272

 Score =  220 bits (111), Expect = 4e-54
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                         
Query: 239   ttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatct 298
             |||| |||||| |||||||||||||||||||| |  |||||||| || || |||||||||
Sbjct: 12561 ttgggggcatatgattccaccctctcagtcctagtctctttgcagggtgaatcagtatct 12502

                                                                         
Query: 299   tgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaatccatca 358
             || ||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 12501 tgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaatccatca 12442

                                                                         
Query: 359   gcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcc 418
             |||||||||||||||||||| |||||||| |||||||||||||| || ||||| | ||||
Sbjct: 12441 gcagaagctgggtcgttgacatcccattcaccaaacttgggcaagggtcgacctgcttcc 12382

                
Query: 419   tcc 421
             |||
Sbjct: 12381 tcc 12379



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                     
Query: 94    tacaaggtcttatggatagtatgtatatagcaaaattaaa 133
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 12827 tacaaggtcttatggatagtatgtatatagcaaaattaaa 12788



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 44/49 (89%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                              
Query: 14    aaccctcacaccatacatacaaacacttcagagttttacgagataccca 62
             ||||||||||| ||||||||| |||| ||||||||||| ||||| ||||
Sbjct: 12906 aaccctcacac-atacatacacacacctcagagttttaagagatgccca 12859



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 184   tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
             |||||||||||||||||| |  ||||| ||||||||||| |||||
Sbjct: 12751 tcaagattgtgtaggactggatgtcacacagcaaaaccatttctt 12707
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  208 bits (105), Expect = 1e-50
 Identities = 168/189 (88%)
 Strand = Plus / Minus

                                                                            
Query: 233      tttgccttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattca 292
                |||| ||||| |||||| |||||||||||||||||||| |  |||||||| || || |||
Sbjct: 10218097 tttgtcttgggggcatatgattccaccctctcagtcctagtttctttgcagggtgaatca 10218038

                                                                            
Query: 293      gtatcttgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaat 352
                |||||||| ||||||||| ||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 10218037 gtatcttgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaat 10217978

                                                                            
Query: 353      ccatcagcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgacca 412
                |||||||| || |||||||||||||| |||||||| |||||||||||||| || ||||| 
Sbjct: 10217977 ccatcagcggacgctgggtcgttgacatcccattcaccaaacttgggcaagggacgacct 10217918

                         
Query: 413      gattcctcc 421
                | |||||||
Sbjct: 10217917 gcttcctcc 10217909



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                     
Query: 97       aaggtcttatggatagtatgtatatagcaaaattaaa 133
                |||||||||||||||||||||||||||||||||||||
Sbjct: 10218354 aaggtcttatggatagtatgtatatagcaaaattaaa 10218318



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                             
Query: 184      tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
                |||||||||||||||||| |  ||||||||||||||||| |||||
Sbjct: 10218281 tcaagattgtgtaggactggatgtcacgcagcaaaaccatttctt 10218237
to top
>dbj|AP005659.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0649C11
          Length = 138870

 Score =  208 bits (105), Expect = 1e-50
 Identities = 168/189 (88%)
 Strand = Plus / Minus

                                                                         
Query: 233   tttgccttggtggcataagattccaccctctcagtcctggcgtctttgcaaggggattca 292
             |||| ||||| |||||| |||||||||||||||||||| |  |||||||| || || |||
Sbjct: 22324 tttgtcttgggggcatatgattccaccctctcagtcctagtttctttgcagggtgaatca 22265

                                                                         
Query: 293   gtatcttgtccattcccagcctttttctcatccctggctttgttgaatataactgtgaat 352
             |||||||| ||||||||| ||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 22264 gtatcttgcccattcccaccctttttctcatctctggctttgttgaatatcactgtgaat 22205

                                                                         
Query: 353   ccatcagcagaagctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgacca 412
             |||||||| || |||||||||||||| |||||||| |||||||||||||| || ||||| 
Sbjct: 22204 ccatcagcggacgctgggtcgttgacatcccattcaccaaacttgggcaagggacgacct 22145

                      
Query: 413   gattcctcc 421
             | |||||||
Sbjct: 22144 gcttcctcc 22136



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                  
Query: 97    aaggtcttatggatagtatgtatatagcaaaattaaa 133
             |||||||||||||||||||||||||||||||||||||
Sbjct: 22581 aaggtcttatggatagtatgtatatagcaaaattaaa 22545



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 184   tcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
             |||||||||||||||||| |  ||||||||||||||||| |||||
Sbjct: 22508 tcaagattgtgtaggactggatgtcacgcagcaaaaccatttctt 22464
to top
>gb|AY104853.1| Zea mays PCO142365 mRNA sequence
          Length = 1031

 Score =  167 bits (84), Expect = 5e-38
 Identities = 159/184 (86%)
 Strand = Plus / Minus

                                                                       
Query: 245 gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 304
           |||||||||||||||||||||||||||| ||| ||| |||| || ||||| |||||||| 
Sbjct: 538 gcataagattccaccctctcagtcctggtgtccttggaaggtgactcagtgtcttgtccg 479

                                                                       
Query: 305 ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 364
           |||||| |||| ||||| || ||||||||||||||||| || |||||||| || ||||||
Sbjct: 478 ttcccacccttcttctcgtctctggctttgttgaatatgacagtgaatccgtctgcagaa 419

                                                                       
Query: 365 gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctccgac 424
           ||||| || || || ||||| ||||||||||| ||||| ||||| || |||||||||| |
Sbjct: 418 gctggatcattaacatcccaatcgccaaactttggcaaggggcggcctgattcctccgcc 359

               
Query: 425 atgg 428
           ||||
Sbjct: 358 atgg 355



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                       
Query: 175 ttgtcctcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctttgaatt 234
           ||||| |||||| ||||| ||||| || |  ||||| || |||||||| |||||||   |
Sbjct: 203 ttgtcttcctcaggattgcgtagggctggctgtcacacaacaaaaccatttctttgtgct 262

                                         
Query: 235 tgccttggtggcataagattccaccctctc 264
           || ||| |  ||||||||||||||||||||
Sbjct: 263 tggctttgcagcataagattccaccctctc 292



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 18  ctcacaccatacatacaaacacttcagagttttacgagata 58
           |||||||||||||||||  |||   ||||||||||||||||
Sbjct: 748 ctcacaccatacatacacgcacgcaagagttttacgagata 708



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 gtcttatggatagtatgtata 120
           |||||||||||||||||||||
Sbjct: 666 gtcttatggatagtatgtata 646



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 100 gtcttatggatagtatgtata 120
           |||||||||||||||||||||
Sbjct: 145 gtcttatggatagtatgtata 165



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 18  ctcacaccatacatacaaacacttcagagttttacgagata 58
           |||||||||||||||||  |||   ||||||||||||||||
Sbjct: 75  ctcacaccatacatacacgcacgcaagagttttacgagata 115
to top
>gb|AF045033.1|AF045033 Zea mays nitrate-induced NOI protein mRNA, complete cds
          Length = 612

 Score =  147 bits (74), Expect = 4e-32
 Identities = 158/186 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245 gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 304
           |||||||| ||||||||||||||||||| ||| ||| |||| || || || ||||| |||
Sbjct: 335 gcataagactccaccctctcagtcctggggtccttggaaggtgagtctgtgtcttgacca 276

                                                                       
Query: 305 ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 364
           |||||| |||| |||||||| ||||||||||||||||| || || ||||| || || |||
Sbjct: 275 ttcccacccttcttctcatctctggctttgttgaatatgacagtaaatccgtctgcggaa 216

                                                                       
Query: 365 gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctccgac 424
           || || |||||||| |||||||| |||||||| ||||| || || || |||||||||| |
Sbjct: 215 gccggatcgttgacatcccattcaccaaactttggcaagggacggcctgattcctccgcc 156

                 
Query: 425 atggat 430
           ||||||
Sbjct: 155 atggat 150



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 35/38 (92%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                 
Query: 83  tgggtacctcttacaaggtcttatggatagtatgtata 120
           ||||||||||| |||  |||||||||||||||||||||
Sbjct: 477 tgggtacctct-acagtgtcttatggatagtatgtata 441
to top
>gb|AF030385.1|AF030385 Zea mays nitrate-induced NOI protein gene, complete cds
          Length = 5278

 Score =  137 bits (69), Expect = 4e-29
 Identities = 150/177 (84%)
 Strand = Plus / Minus

                                                                        
Query: 245  gcataagattccaccctctcagtcctggcgtctttgcaaggggattcagtatcttgtcca 304
            |||||||| ||||||||||||||||||| ||| ||| |||| || || || ||||| |||
Sbjct: 4352 gcataagactccaccctctcagtcctggggtccttggaaggtgagtctgtgtcttgacca 4293

                                                                        
Query: 305  ttcccagcctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaa 364
            |||||| |||| |||||||| ||||||||||||||||| || || ||||| || || |||
Sbjct: 4292 ttcccacccttcttctcatctctggctttgttgaatatgacagtaaatccgtctgcggaa 4233

                                                                     
Query: 365  gctgggtcgttgacgtcccattcgccaaacttgggcaaagggcgaccagattcctcc 421
            || || |||||||| |||||||| |||||||| ||||| || || || |||||||||
Sbjct: 4232 gccggatcgttgacatcccattcaccaaactttggcaagggacggcctgattcctcc 4176



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 35/38 (92%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 83   tgggtacctcttacaaggtcttatggatagtatgtata 120
            ||||||||||| |||  |||||||||||||||||||||
Sbjct: 4719 tgggtacctct-acagtgtcttatggatagtatgtata 4683
to top
>emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n22, COMPLETE SEQUENCE
          Length = 87738

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                         
Query: 313   ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
             ||||||||||||||| |||||||| || || |||||| | || ||||| |||||||| ||
Sbjct: 58114 ctttttctcatccctagctttgttaaaaatcactgtgtaaccttcagctgaagctggatc 58173

                                     
Query: 373   gttgacgtcccattcgccaaactt 396
             |||||| |||||||||||||||||
Sbjct: 58174 gttgacatcccattcgccaaactt 58197
to top
>emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i20, COMPLETE SEQUENCE
          Length = 115743

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                         
Query: 313   ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
             ||||||||||||||| |||||||| || || |||||| | || ||||| |||||||| ||
Sbjct: 22643 ctttttctcatccctagctttgttaaaaatcactgtgtaaccttcagctgaagctggatc 22702

                                     
Query: 373   gttgacgtcccattcgccaaactt 396
             |||||| |||||||||||||||||
Sbjct: 22703 gttgacatcccattcgccaaactt 22726
to top
>gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete sequence
          Length = 94766

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                         
Query: 314   tttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtcg 373
             ||||||||||| ||||| |||||||||||||| |||||||| ||||| || || || || 
Sbjct: 82223 tttttctcatctctggccttgttgaatataacagtgaatccttcagctgatgcaggatca 82164

                                             
Query: 374   ttgacgtcccattcgccaaacttgggcaaagg 405
             || || |||||||| ||||||||||| |||||
Sbjct: 82163 ttcacatcccattccccaaacttgggtaaagg 82132
to top
>dbj|AK059360.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-D12, full
           insert sequence
          Length = 303

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 37/37 (100%)
 Strand = Plus / Minus

                                                
Query: 97  aaggtcttatggatagtatgtatatagcaaaattaaa 133
           |||||||||||||||||||||||||||||||||||||
Sbjct: 107 aaggtcttatggatagtatgtatatagcaaaattaaa 71



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 tcaagattgtgtaggacttggcgtcacgcagcaa 217
           |||||||||||||||||| |  ||||||||||||
Sbjct: 34  tcaagattgtgtaggactggatgtcacgcagcaa 1
to top
>ref|XM_467563.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 213

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                       
Query: 312 cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
           |||| |||||||||||||||||| |||| || || ||||| || || ||||| || ||||
Sbjct: 115 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 56

                                    
Query: 372 cgttgacgtcccattcgccaaactt 396
            ||||||||||||| |||| |||||
Sbjct: 55  tgttgacgtcccatgcgccgaactt 31



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 181 tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
           |||||||| ||| || || || |||| ||| |||||||||||||||||
Sbjct: 191 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 144
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                            
Query: 312      cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
                |||| |||||||||||||||||| |||| || || ||||| || || ||||| || ||||
Sbjct: 30174034 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 30174093

                                         
Query: 372      cgttgacgtcccattcgccaaactt 396
                 ||||||||||||| |||| |||||
Sbjct: 30174094 tgttgacgtcccatgcgccgaactt 30174118



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                                
Query: 181      tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
                |||||||| ||| || || || |||| ||| |||||||||||||||||
Sbjct: 30173730 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 30173777
to top
>dbj|AP004179.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1124_G07
          Length = 93240

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                         
Query: 312   cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
             |||| |||||||||||||||||| |||| || || ||||| || || ||||| || ||||
Sbjct: 46738 ccttcttctcatccctggctttgctgaagatcaccgtgaaaccgtcggcagaggccgggt 46797

                                      
Query: 372   cgttgacgtcccattcgccaaactt 396
              ||||||||||||| |||| |||||
Sbjct: 46798 tgttgacgtcccatgcgccgaactt 46822



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                             
Query: 181   tcctcaagattgtgtaggacttggcgtcacgcagcaaaaccacttctt 228
             |||||||| ||| || || || |||| ||| |||||||||||||||||
Sbjct: 46434 tcctcaaggttgggtggggctgggcgacacacagcaaaaccacttctt 46481
to top
>ref|NM_124967.2| Arabidopsis thaliana NOI AT5G55850 (NOI) mRNA, complete cds
          Length = 866

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 351 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 292

                                                  
Query: 373 gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
            || || |||||||| ||||| || ||||| || |||||
Sbjct: 291 attcacatcccattcaccaaattttggcaagggacgacc 253
to top
>gb|AY096671.1| Arabidopsis thaliana putative nitrate-induced NOI protein
           (At5g55850) mRNA, complete cds
          Length = 271

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 111 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 52

                                                  
Query: 373 gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
            || || |||||||| ||||| || ||||| || |||||
Sbjct: 51  attcacatcccattcaccaaattttggcaagggacgacc 13
to top
>gb|AY065260.1| Arabidopsis thaliana putative NOI protein, nitrate-induced
           (At5g55850) mRNA, complete cds
          Length = 797

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 357 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 298

                                                  
Query: 373 gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
            || || |||||||| ||||| || ||||| || |||||
Sbjct: 297 attcacatcccattcaccaaattttggcaagggacgacc 259
to top
>emb|BX833781.1|CNS09Z02 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL76ZG05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 624

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 302 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 243

                                                  
Query: 373 gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
            || || |||||||| ||||| || ||||| || |||||
Sbjct: 242 attcacatcccattcaccaaattttggcaagggacgacc 204
to top
>dbj|AB018120.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWJ3
          Length = 42356

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                        
Query: 313  ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
            ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 9530 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 9471

                                                   
Query: 373  gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
             || || |||||||| ||||| || ||||| || |||||
Sbjct: 9470 attcacatcccattcaccaaattttggcaagggacgacc 9432
to top
>gb|AY105745.1| Zea mays PCO136119 mRNA sequence
          Length = 677

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 317 ttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtcgttg 376
           |||||||||||||| ||| |||| || || ||||| || || ||||| || |||| ||| 
Sbjct: 250 ttctcatccctggccttgctgaagatcaccgtgaacccgtcggcagaggccgggttgttc 191

                                  
Query: 377 acgtcccattcgccaaacttggg 399
           |||||||||||||| ||||||||
Sbjct: 190 acgtcccattcgccgaacttggg 168
to top
>gb|AF030386.1|AF030386 Arabidopsis thaliana NOI protein mRNA, complete cds
          Length = 632

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||||||| |||||||||||||| ||||| || || || || || ||||| ||
Sbjct: 311 ctttttctcatccctagctttgttgaatatcactgtaaaaccttctgctgatgctggatc 252

                                                  
Query: 373 gttgacgtcccattcgccaaacttgggcaaagggcgacc 411
            || || |||||||| ||||| || ||||| || |||||
Sbjct: 251 attcacatcccattcaccaaattttggcaagggacgacc 213
to top
>gb|DQ160112.1| Taraxacum officinale TO72-1rc (To72-1rc) mRNA, partial cds
          Length = 350

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 75/90 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 ctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggtc 372
           ||||||||||| ||| || |||||||||||||| ||||| || ||||| || || |||||
Sbjct: 153 ctttttctcattcctcgccttgttgaatataaccgtgaacccctcagctgatgcagggtc 94

                                         
Query: 373 gttgacgtcccattcgccaaacttgggcaa 402
            || || ||||| || |||||||| |||||
Sbjct: 93  attcacatcccagtcaccaaactttggcaa 64
to top
>gb|AY140529.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-11 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                        
Query: 312  cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
            |||||||||| |  || ||||||||||| ||||| || ||||| ||||| || |  ||||
Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945

                                                 
Query: 372  cgttgacgtcccattcgccaaacttgggcaaagggcg 408
            | || || ||||||||||||||||| ||||| |||||
Sbjct: 944  cattcacatcccattcgccaaactttggcaacgggcg 908
to top
>gb|AY140528.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-4 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                        
Query: 312  cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
            |||||||||| |  || ||||||||||| ||||| || ||||| ||||| || |  ||||
Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945

                                                 
Query: 372  cgttgacgtcccattcgccaaacttgggcaaagggcg 408
            | || || ||||||||||||||||| ||||| |||||
Sbjct: 944  cattcacatcccattcgccaaactttggcaacgggcg 908
to top
>gb|AY140527.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-3 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1105

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                        
Query: 312  cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
            |||||||||| |  || ||||||||||| ||||| || ||||| ||||| || |  ||||
Sbjct: 1004 cctttttctcgtttctagctttgttgaagataacagtaaatccctcagctgatgaagggt 945

                                                 
Query: 372  cgttgacgtcccattcgccaaacttgggcaaagggcg 408
            | || || ||||||||||||||||| ||||| |||||
Sbjct: 944  cattcacatcccattcgccaaactttggcaacgggcg 908
to top
>emb|BX833526.1|CNS09ZA1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZB12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 673

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 313 ctttttctcatccctggctttgttgaatataactgt 348
           ||||||||||||||| |||||||||||||| |||||
Sbjct: 231 ctttttctcatccctagctttgttgaatattactgt 196
to top
>gb|AY140526.1| Arabidopsis thaliana clone P3WB2-A11-6094 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcatttacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140525.1| Arabidopsis thaliana clone P3WB2-A11-6092 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcatttacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140524.1| Arabidopsis thaliana clone P3WB2-A11-6054 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140522.1| Arabidopsis thaliana clone P3WB2-A11-1220 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 883 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 824

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 823 ccaaacttcggcaacgggcg 804
to top
>gb|AY140521.1| Arabidopsis thaliana clone P3WB2-A11-1202 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 883 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 824

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 823 ccaaacttcggcaacgggcg 804
to top
>gb|AY140520.1| Arabidopsis thaliana clone P3WB2-A11-1084 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1011

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140519.1| Arabidopsis thaliana clone P3WB2-A11-1074 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140518.1| Arabidopsis thaliana clone P3WB2-A11-1006 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140517.1| Arabidopsis thaliana clone P3WB2-A11-996 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140516.1| Arabidopsis thaliana clone P3WB2-A11-970 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140515.1| Arabidopsis thaliana clone P3WB2-A11-903 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1017

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || ||||| ||||| || |  ||||| || || |||||||||
Sbjct: 882 gctttgttgaagataacagtaaatccctcagctgatgaagggtcattaacatcccattcg 823

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 822 ccaaacttcggcaacgggcg 803
to top
>gb|AY140531.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-15 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1136

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 79/97 (81%)
 Strand = Plus / Minus

                                                                        
Query: 312  cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
            |||||||||| |  || ||||| ||||| ||||| || ||||| ||||| || |  ||||
Sbjct: 1035 cctttttctcgtttctagctttattgaagataacagtaaatccctcagctgatgaagggt 976

                                                 
Query: 372  cgttgacgtcccattcgccaaacttgggcaaagggcg 408
            | || || ||||||||||||||||| ||||| |||||
Sbjct: 975  cattcacatcccattcgccaaacttcggcaacgggcg 939
to top
>gb|AY140530.1| Arabidopsis lyrata clone P3WB2-A11-KAR99-14 unknown protein gene,
            exons 1 and 2 and partial cds
          Length = 1137

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 79/97 (81%)
 Strand = Plus / Minus

                                                                        
Query: 312  cctttttctcatccctggctttgttgaatataactgtgaatccatcagcagaagctgggt 371
            |||||||||| |  || ||||| ||||| ||||| || ||||| ||||| || |  ||||
Sbjct: 1036 cctttttctcgtttctagctttattgaagataacagtaaatccctcagctgatgaagggt 977

                                                 
Query: 372  cgttgacgtcccattcgccaaacttgggcaaagggcg 408
            | || || ||||||||||||||||| ||||| |||||
Sbjct: 976  cattcacatcccattcgccaaacttcggcaacgggcg 940
to top
>ref|NM_126474.1| Arabidopsis thaliana unknown protein AT2G04410 mRNA, complete cds
          Length = 521

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || || || ||||| || |  ||||| || || |||||||||
Sbjct: 223 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 164

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 163 ccaaacttcggcaacgggcg 144
to top
>gb|AC006951.6| Arabidopsis thaliana chromosome 2 clone T1O3 map RNS1, complete
             sequence
          Length = 99804

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                         
Query: 329   gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
             ||||||||||| ||||| || || || ||||| || |  ||||| || || |||||||||
Sbjct: 68016 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 67957

                                 
Query: 389   ccaaacttgggcaaagggcg 408
             |||||||| ||||| |||||
Sbjct: 67956 ccaaacttcggcaacgggcg 67937
to top
>gb|AY058877.1| Arabidopsis thaliana At2g04410/T1O3.18 mRNA, complete cds
          Length = 563

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || || || ||||| || |  ||||| || || |||||||||
Sbjct: 172 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 113

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 112 ccaaacttcggcaacgggcg 93
to top
>gb|AY140523.1| Arabidopsis thaliana clone P3WB2-A11-1248 unknown protein gene,
           exons 1 and 2 and partial cds
          Length = 1012

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 329 gctttgttgaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcg 388
           ||||||||||| ||||| || || || ||||| || |  ||||| || || |||||||||
Sbjct: 883 gctttgttgaagataacagtaaacccctcagctgatgaagggtcattaacatcccattcg 824

                               
Query: 389 ccaaacttgggcaaagggcg 408
           |||||||| ||||| |||||
Sbjct: 823 ccaaacttcggcaacgggcg 804
to top
>ref|NM_123429.2| Arabidopsis thaliana unknown protein AT5G40645 mRNA, complete cds
          Length = 438

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 337 gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 393
           ||||||||| || ||||| || || || ||||| ||||| ||||||||||| |||||
Sbjct: 197 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 141
to top
>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 457    gagggggagggagaggggctt 477
              |||||||||||||||||||||
Sbjct: 161958 gagggggagggagaggggctt 161938
to top
>gb|AC150788.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073C10,
              complete sequence
          Length = 165350

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 501    ggtgggaggaggaaggggaaa 521
              |||||||||||||||||||||
Sbjct: 104799 ggtgggaggaggaaggggaaa 104779
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 501     ggtgggaggaggaaggggaaa 521
               |||||||||||||||||||||
Sbjct: 2475909 ggtgggaggaggaaggggaaa 2475889
to top
>gb|DQ447022.1| Arabidopsis thaliana clone pENTR221-At5g40645 nitrate-responsive
           NOI protein (At5g40645) mRNA, complete cds
          Length = 222

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 337 gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 393
           ||||||||| || ||||| || || || ||||| ||||| ||||||||||| |||||
Sbjct: 108 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 52
to top
>emb|AL138899.23| Human DNA sequence from clone RP11-404O13 on chromosome 1 Contains two
             novel genes, a elongation factor RNA polymerase II 2
             (ELL2) pseudogene, the CD1D gene for CD1D antigen, d
             polypeptide and a ribosomal protein S10 (RPS10)
             pseudogene, complete sequence
          Length = 134137

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 144   ttcccaaccattcttcttctg 164
             |||||||||||||||||||||
Sbjct: 22089 ttcccaaccattcttcttctg 22069
to top
>emb|AL138649.1|ATT14D3 Arabidopsis thaliana DNA chromosome 3, BAC clone T14D3
          Length = 88010

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 113   tatgtatatagcaaaattaaa 133
             |||||||||||||||||||||
Sbjct: 34515 tatgtatatagcaaaattaaa 34495
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 501     ggtgggaggaggaaggggaaa 521
               |||||||||||||||||||||
Sbjct: 3906912 ggtgggaggaggaaggggaaa 3906892
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 501     ggtgggaggaggaaggggaaa 521
               |||||||||||||||||||||
Sbjct: 2476019 ggtgggaggaggaaggggaaa 2475999
to top
>gb|AC119796.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1172F09,
             complete sequence
          Length = 106057

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 501   ggtgggaggaggaaggggaaa 521
             |||||||||||||||||||||
Sbjct: 48405 ggtgggaggaggaaggggaaa 48385
to top
>dbj|AB009052.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNF13
          Length = 85992

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 337   gaatataactgtgaatccatcagcagaagctgggtcgttgacgtcccattcgccaaa 393
             ||||||||| || ||||| || || || ||||| ||||| ||||||||||| |||||
Sbjct: 55414 gaatataaccgtaaatccttcggctgatgctggatcgttcacgtcccattctccaaa 55470
to top
>emb|AL135818.3|CNS01DVH Human chromosome 14 DNA sequence BAC C-2547L24 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 203777

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 460    ggggagggagaggggcttgggggaa 484
              |||||||||||||||| ||||||||
Sbjct: 181202 ggggagggagaggggcctgggggaa 181226
to top
>emb|AL133153.3|CNS01DU3 Human chromosome 14 DNA sequence BAC R-895M11 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 231490

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 460   ggggagggagaggggcttgggggaa 484
             |||||||||||||||| ||||||||
Sbjct: 92744 ggggagggagaggggcctgggggaa 92768
to top
>gb|CP000078.1| Leishmania major strain Friedlin chromosome 2, complete sequence
          Length = 355714

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 456    cgagggggagggagaggggc 475
              ||||||||||||||||||||
Sbjct: 109590 cgagggggagggagaggggc 109571



 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 456   cgagggggagggagaggggc 475
             ||||||||||||||||||||
Sbjct: 89936 cgagggggagggagaggggc 89917
to top
>gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, complete sequence
          Length = 203574

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 457    gagggggagggagaggggct 476
              ||||||||||||||||||||
Sbjct: 196542 gagggggagggagaggggct 196523
to top
>gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 249629

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 460    ggggagggagaggggcttggggga 483
              ||||||||||||||||| ||||||
Sbjct: 134262 ggggagggagaggggctaggggga 134239
to top
>gb|AC006028.3| Homo sapiens BAC clone GS1-165O14 from 7, complete sequence
          Length = 210608

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 495    gctgctggtgggaggaggaagggg 518
              ||||||||||| ||||||||||||
Sbjct: 195148 gctgctggtggcaggaggaagggg 195171
to top
>gb|AC112150.4| Mus musculus BAC clone RP24-84I17 from chromosome 16, complete sequence
          Length = 211640

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 497    tgctggtgggaggaggaagg 516
              ||||||||||||||||||||
Sbjct: 136288 tgctggtgggaggaggaagg 136307
to top
>gb|AC122214.4| Mus musculus BAC clone RP23-104J10 from chromosome 7, complete
            sequence
          Length = 176054

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 186  aagattgtgtaggacttggc 205
            ||||||||||||||||||||
Sbjct: 7126 aagattgtgtaggacttggc 7145
to top
>gb|BC014806.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA clone
           IMAGE:4237171), containing frame-shift errors
          Length = 1595

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 502 gtgggaggaggaaggggaaa 521
           ||||||||||||||||||||
Sbjct: 293 gtgggaggaggaaggggaaa 274
to top
>gb|AC099668.2| Homo sapiens chromosome 3 clone RP11-901L6, complete sequence
          Length = 242222

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 504   gggaggaggaaggggaaagc 523
             ||||||||||||||||||||
Sbjct: 64964 gggaggaggaaggggaaagc 64983
to top
>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence
          Length = 221903

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    cacaccatacatacaaacac 39
             ||||||||||||||||||||
Sbjct: 33377 cacaccatacatacaaacac 33358
to top
>gb|AC099930.11| Mus musculus chromosome 7, clone RP23-17C12, complete sequence
          Length = 224617

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    aagattgtgtaggacttggc 205
              ||||||||||||||||||||
Sbjct: 180995 aagattgtgtaggacttggc 181014
to top
>gb|BC039766.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA clone
           IMAGE:4159060), partial cds
          Length = 1598

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 502 gtgggaggaggaaggggaaa 521
           ||||||||||||||||||||
Sbjct: 297 gtgggaggaggaaggggaaa 278
to top
>emb|BX511035.7| Human DNA sequence from clone RP11-435J19 on chromosome 22, complete
            sequence
          Length = 70823

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 462  ggagggagaggggcttgggg 481
            ||||||||||||||||||||
Sbjct: 8506 ggagggagaggggcttgggg 8487
to top
>gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, complete sequence
          Length = 181948

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   cctcacaccatacatacaaa 36
            ||||||||||||||||||||
Sbjct: 2278 cctcacaccatacatacaaa 2297
to top
>emb|AL355310.20| Human DNA sequence from clone RP5-1160K1 on chromosome 1 Contains the
            GPR61 gene for G protein-coupled receptor 61, the GNAI3
            gene for guanine nucleotide binding protein (G protein)
            alpha inhibiting activity polypeptide 3, two novel genes,
            the GNAT2 gene for guanine nucleotide binding protein (G
            protein) alpha transducing activity polypeptide 2, the
            AMPD2 gene for adenosine monophosphate deaminase 2
            (isoform L) and the 5' end of a ribosomal protein L7
            (RPL7) pseudogene, complete sequence
          Length = 112911

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 500  tggtgggaggaggaagggga 519
            ||||||||||||||||||||
Sbjct: 7543 tggtgggaggaggaagggga 7562
to top
>ref|NM_003458.2| Homo sapiens bassoon (presynaptic cytomatrix protein) (BSN), mRNA
          Length = 15966

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   gggaggaggaaggggaaagc 523
             ||||||||||||||||||||
Sbjct: 15719 gggaggaggaaggggaaagc 15700
to top
>emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J21 on chromosome 1q23.3-24.3
              Contains part of the TNR gene for tenascin R (restrictin,
              janusin), a novel gene and one CpG island, complete
              sequence
          Length = 138636

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 305    ttcccagcctttttctcatc 324
              ||||||||||||||||||||
Sbjct: 101046 ttcccagcctttttctcatc 101027
to top
>gb|AC118290.7| Rattus norvegicus 2 BAC CH230-366D18 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 210896

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 460   ggggagggagaggggcttggggga 483
             ||||||||||||||||| ||||||
Sbjct: 91035 ggggagggagaggggctaggggga 91012
to top
>gb|AC162287.4| Mus musculus chromosome 7, clone RP24-243J4, complete sequence
          Length = 152934

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 502   gtgggaggaggaaggggaaa 521
             ||||||||||||||||||||
Sbjct: 84665 gtgggaggaggaaggggaaa 84646
to top
>emb|AL031883.1|DMC11F6 Drosophila melanogaster cosmid clone 11F6
          Length = 36000

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 457  gagggggagggagaggggcttggg 480
            ||||||||||| ||||||||||||
Sbjct: 7344 gagggggagggggaggggcttggg 7367
to top
>emb|AL954258.2| Pan troglodytes chromosome 22 clone PTB-146D01 map 22q22.3, complete
             sequence
          Length = 185080

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 118   atatagcaaaattaaacgaccatacttt 145
             |||||||||||||||||| |||| ||||
Sbjct: 14595 atatagcaaaattaaacgcccattcttt 14568
to top
>emb|AL844182.10| Mouse DNA sequence from clone RP23-399H17 on chromosome 4, complete
              sequence
          Length = 201590

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 142    ctttcccaaccattcttcttctgg 165
              |||||||||||||||||| |||||
Sbjct: 111528 ctttcccaaccattcttcctctgg 111505
to top
>emb|AL589744.18| Mouse DNA sequence from clone RP23-80C18 on chromosome 13 Contains a nove
              gene, a ribosomal protein large p1 (Rplp1) pseudogene and
              the Cmah gene for CMP-N-Acetylneuraminic acid hydroxylase,
              complete sequence
          Length = 216800

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     cacaccatacatacaaacac 39
              ||||||||||||||||||||
Sbjct: 158268 cacaccatacatacaaacac 158287
to top
>gb|AC105774.8| Drosophila melanogaster X BAC RP98-8O5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 170186

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 457    gagggggagggagaggggcttggg 480
              ||||||||||| ||||||||||||
Sbjct: 168413 gagggggagggggaggggcttggg 168436
to top
>gb|AC092859.26| Pan troglodytes clone rp43-111m15, complete sequence
          Length = 175281

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 500    tggtgggaggaggaagggga 519
              ||||||||||||||||||||
Sbjct: 138778 tggtgggaggaggaagggga 138759
to top
>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 414   attcctccgacatggattga 433
             ||||||||||||||||||||
Sbjct: 15324 attcctccgacatggattga 15343
to top
>gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 161668

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 457   gagggggagggagaggggcttggg 480
             ||||||||||| ||||||||||||
Sbjct: 54849 gagggggagggggaggggcttggg 54872
to top
>emb|BX465229.7| Zebrafish DNA sequence from clone CH211-174D2 in linkage group 2,
              complete sequence
          Length = 154954

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    gtatgtatatagcaaaatta 131
              ||||||||||||||||||||
Sbjct: 123320 gtatgtatatagcaaaatta 123301
to top
>gb|AC105061.16| Mus musculus chromosome 19, clone RP23-117I10, complete sequence
          Length = 210038

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     cacaccatacatacaaacac 39
              ||||||||||||||||||||
Sbjct: 127480 cacaccatacatacaaacac 127461
to top
>gb|AC121099.8| Mus musculus chromosome 3, clone RP24-501F21, complete sequence
          Length = 157318

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   tgggaggaggaaggggaaag 522
             ||||||||||||||||||||
Sbjct: 84920 tgggaggaggaaggggaaag 84901
to top
>gb|AC022267.8|AC022267 Homo sapiens BAC clone RP11-407H18 from 4, complete sequence
          Length = 199472

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 306    tcccagcctttttctcatcc 325
              ||||||||||||||||||||
Sbjct: 168944 tcccagcctttttctcatcc 168963
to top
>emb|BX324002.8| Zebrafish DNA sequence from clone CH211-129H21 in linkage group 24,
              complete sequence
          Length = 178173

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 330    ctttgttgaatataactgtg 349
              ||||||||||||||||||||
Sbjct: 120365 ctttgttgaatataactgtg 120384
to top
>gb|AC141000.7| Homo sapiens 3 BAC RP11-480C15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 175946

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   gggaggaggaaggggaaagc 523
             ||||||||||||||||||||
Sbjct: 88091 gggaggaggaaggggaaagc 88072
to top
>gb|AC007614.7| Homo sapiens chromosome 16 clone RP11-491F9, complete sequence
          Length = 192347

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 499   ctggtgggaggaggaagggg 518
             ||||||||||||||||||||
Sbjct: 74644 ctggtgggaggaggaagggg 74663
to top
>gb|AC138374.2| Homo sapiens chromosome 11, clone CTD-2647G13, complete sequence
          Length = 196424

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 460    ggggagggagaggggcttgg 479
              ||||||||||||||||||||
Sbjct: 137856 ggggagggagaggggcttgg 137875
to top
>gb|AY230143.1| Leishmania major clone B2015 phosphoglycan beta 1,2
            arabinosyltransferase 1 (SCA1) gene, complete cds
          Length = 3185

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 456  cgagggggagggagaggggc 475
            ||||||||||||||||||||
Sbjct: 2834 cgagggggagggagaggggc 2853
to top
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 154     ttcttcttctggggtggcagcttg 177
               |||||||||||||||||| |||||
Sbjct: 2937175 ttcttcttctggggtggctgcttg 2937198
to top
>gb|AC131934.13| Homo sapiens chromosome 11, clone RP11-754B17, complete sequence
          Length = 154813

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 460    ggggagggagaggggcttgg 479
              ||||||||||||||||||||
Sbjct: 128931 ggggagggagaggggcttgg 128912
to top
>gb|AF434264.1| Salmo trutta clone 64 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434263.1| Salmo trutta clone 76 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434262.1| Salmo trutta clone 75 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434261.1| Salmo trutta clone 74 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434260.1| Salmo trutta clone 53 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434259.1| Salmo trutta clone 68 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434258.1| Salmo trutta clone 52 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434257.1| Salmo trutta clone 55 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AF434256.1| Salmo trutta clone 51 internal transcribed spacer 1, complete
           sequence
          Length = 575

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 453 cgccgagggggagggagagg 472
           ||||||||||||||||||||
Sbjct: 109 cgccgagggggagggagagg 90
to top
>gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, complete sequence
          Length = 228068

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 502   gtgggaggaggaaggggaaa 521
             ||||||||||||||||||||
Sbjct: 18532 gtgggaggaggaaggggaaa 18551
to top
>gb|BC087948.1| Mus musculus cDNA sequence BC023486, mRNA (cDNA clone
           IMAGE:30122298)
          Length = 1631

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 502 gtgggaggaggaaggggaaa 521
           ||||||||||||||||||||
Sbjct: 277 gtgggaggaggaaggggaaa 258
to top
>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102
          Length = 340000

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 118   atatagcaaaattaaacgaccatacttt 145
             |||||||||||||||||| |||| ||||
Sbjct: 96496 atatagcaaaattaaacgcccattcttt 96469
to top
>emb|CR937049.3| CH230-323M7, complete sequence
          Length = 198674

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 460   ggggagggagaggggcttggggga 483
             ||||||||||||||||| ||||||
Sbjct: 28810 ggggagggagaggggctaggggga 28787
to top
>dbj|AP006284.2| Homo sapiens genomic DNA, chromosome 11 clone:RP11-496I9, complete
             sequence
          Length = 104658

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 460   ggggagggagaggggcttgg 479
             ||||||||||||||||||||
Sbjct: 80383 ggggagggagaggggcttgg 80402
to top
>gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 of 74 of the complete
             sequence
          Length = 315092

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 457   gagggggagggagaggggcttggg 480
             ||||||||||| ||||||||||||
Sbjct: 38216 gagggggagggggaggggcttggg 38239
to top
>gb|AF052224.1|AF052224 Homo sapiens neuronal double zinc finger protein (ZNF231) mRNA,
             complete cds
          Length = 15964

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   gggaggaggaaggggaaagc 523
             ||||||||||||||||||||
Sbjct: 15718 gggaggaggaaggggaaagc 15699
to top
>emb|BX322562.1|HSQ21A11 Homo sapiens chromosome 21 from cosmid LL21NC02-21A1 map 21q22.3 region
             D21S171-LA161, complete sequence
          Length = 45600

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 118   atatagcaaaattaaacgaccatacttt 145
             |||||||||||||||||| |||| ||||
Sbjct: 14960 atatagcaaaattaaacgcccattcttt 14933
to top
>emb|CT010517.11| Mouse DNA sequence from clone RP23-357P12 on chromosome 16, complete
             sequence
          Length = 188228

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 497   tgctggtgggaggaggaagg 516
             ||||||||||||||||||||
Sbjct: 21946 tgctggtgggaggaggaagg 21927
to top
>emb|CR962122.2| Medicago truncatula chromosome 5 clone mte1-46l20, COMPLETE SEQUENCE
          Length = 150486

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 122   agcaaaattaaacgaccatacttt 145
             ||||||||||||||| ||||||||
Sbjct: 70547 agcaaaattaaacgatcatacttt 70524
to top
>emb|CT010439.6| Mouse DNA sequence from clone RP23-26E8 on chromosome 13, complete
             sequence
          Length = 231247

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 457   gagggggagggagaggggct 476
             ||||||||||||||||||||
Sbjct: 44823 gagggggagggagaggggct 44804
to top
>dbj|AP006701.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT08P04, TM0587,
             complete sequence
          Length = 110885

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 147   ccaaccattcttcttctggggtgg 170
             ||||||||||||||||||| ||||
Sbjct: 64483 ccaaccattcttcttctggtgtgg 64460
to top
>emb|AL929506.8| Mouse DNA sequence from clone RP23-223I8 on chromosome 4, complete
             sequence
          Length = 63478

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 129   ttaaacgaccatactttcccaacc 152
             |||||| |||||||||||||||||
Sbjct: 60468 ttaaaccaccatactttcccaacc 60491


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,528,211
Number of Sequences: 3902068
Number of extensions: 5528211
Number of successful extensions: 145584
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 114
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 145052
Number of HSP's gapped (non-prelim): 530
length of query: 523
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 500
effective length of database: 17,143,297,704
effective search space: 8571648852000
effective search space used: 8571648852000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top