ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal3c22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009480.1| Triticum aestivum clone wr1.pk0038.g11:fis, full ... 228 6e-57
2ref|XM_726152.1| Plasmodium yoelii yoelii str. 17XNL asparaginyl... 42 0.80
3ref|XM_675109.1| Plasmodium berghei strain ANKA asparagine--t RN... 42 0.80
4gb|AC105325.11| Mus musculus chromosome 1, clone RP24-455G23, co... 42 0.80
5gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, com... 42 0.80
6emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 i... 42 0.80
7gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, comp... 42 0.80
8gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome... 40 3.1
9gb|AF111103.1|MMHC322F16 Mouse major histocompatibility complex ... 40 3.1
10emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on ch... 40 3.1
11emb|AL691429.17| Human DNA sequence from clone RP13-137A17 on ch... 40 3.1
12gb|AC087216.1|AC087216 Mus musculus strain 129svj chromosome 17 ... 40 3.1
13gb|AC154730.3| Mus musculus BAC clone RP23-120M21 from chromosom... 40 3.1
14gb|AF023268.1|AF023268 Homo sapiens clk2 kinase (CLK2), propin1,... 40 3.1
15gb|AC145946.3| Gallus gallus BAC clone CH261-23O21 from chromoso... 40 3.1
16emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chro... 40 3.1
17emb|AL672122.9| Mouse DNA sequence from clone RP23-435H13 on chr... 40 3.1

>gb|BT009480.1| Triticum aestivum clone wr1.pk0038.g11:fis, full insert mRNA
           sequence
          Length = 844

 Score =  228 bits (115), Expect = 6e-57
 Identities = 205/235 (87%), Gaps = 6/235 (2%)
 Strand = Plus / Plus

                                                                       
Query: 14  aggngcctgccaatcataggcagagagaccaggcagatggagcctaacanccagngcnaa 73
           ||| ||||||||||||| |||| ||||||||||||||| |||||||||| |||| || ||
Sbjct: 89  aggtgcctgccaatcattggcaaagagaccaggcagatagagcctaacaaccagtgcaaa 148

                                                                       
Query: 74  aacgcnactnaccaaagttcaaccatggaggacaaaacattctatagcatcattgagac- 132
           ||||| ||| ||||||||||||||||||||||||||||| |||||||||||| |||||| 
Sbjct: 149 aacgcaactcaccaaagttcaaccatggaggacaaaacaatctatagcatca-tgagact 207

                                                                       
Query: 133 ---cgcaaactgacttctaaactaagagataatgccgacgctcagagacagcccagcang 189
               |||||||||| ||||| |||||||||||||||| ||||||  |  ||||| ||  |
Sbjct: 208 gcatgcaaactgac-tctaatctaagagataatgccgtcgctcaaggttagcccggcgag 266

                                                                  
Query: 190 ctggctggnnggggcgttagggttctgctgctgagccacgttgcggagaacatcc 244
           ||||||||  |||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 267 ctggctggtaggggcgttggggttctgctgctgggccacgttgcggagaacatcc 321



to top

>ref|XM_726152.1| Plasmodium yoelii yoelii str. 17XNL asparaginyl-tRNA synthetase
           (PY03253) partial mRNA
          Length = 1857

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 106 caaaacattctatagcatcat 126
           |||||||||||||||||||||
Sbjct: 424 caaaacattctatagcatcat 404



to top

>ref|XM_675109.1| Plasmodium berghei strain ANKA asparagine--t RNA ligase,
           (PB000193.02.0) partial mRNA
          Length = 1941

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 106 caaaacattctatagcatcat 126
           |||||||||||||||||||||
Sbjct: 529 caaaacattctatagcatcat 509



to top

>gb|AC105325.11| Mus musculus chromosome 1, clone RP24-455G23, complete sequence
          Length = 139801

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 208    agggttctgctgctgagccac 228
              |||||||||||||||||||||
Sbjct: 129129 agggttctgctgctgagccac 129109



to top

>gb|AC115917.10| Mus musculus chromosome 1, clone RP24-488H6, complete sequence
          Length = 186588

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   agggttctgctgctgagccac 228
             |||||||||||||||||||||
Sbjct: 25967 agggttctgctgctgagccac 25947



to top

>emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 in linkage group 10,
             complete sequence
          Length = 160042

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 173   agagacagcccagcangctggctg 196
             ||||||||||||||| ||||||||
Sbjct: 95616 agagacagcccagcatgctggctg 95639



to top

>gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, complete sequence
          Length = 219070

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 37     agagaccaggcagatggagcc 57
              |||||||||||||||||||||
Sbjct: 106559 agagaccaggcagatggagcc 106539



to top

>gb|AC169510.1| Mus musculus BAC clone RP23-121E6 from chromosome 14, complete sequence
          Length = 214403

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 22    gccaatcataggcagagagaccag 45
             |||||||| |||||||||||||||
Sbjct: 30116 gccaatcacaggcagagagaccag 30093



to top

>gb|AF111103.1|MMHC322F16 Mouse major histocompatibility complex region containing the Q region
             of class I
          Length = 159179

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   gggttctgctgctgagccac 228
             ||||||||||||||||||||
Sbjct: 63769 gggttctgctgctgagccac 63788



to top

>emb|AL713999.28| Human DNA sequence from clone RP11-263K19 on chromosome 1 Contains the
             3' end of the TRIM46 gene for tripartite motif-containing
             46, the MUC1 gene for mucin 1 (transmembrane), the THBS3
             gene for thrombospondin 3, two novel genes, the MTX1 gene
             for metaxin 1, the gene for a novel protein similar to
             glucosidase (beta; acid (includes glucosylceramidase))
             (GBA), a metaxin 1 (MTX1) pseudogene, the GBA gene for
             glucosidase (beta; acid (includes glucosylceramidase)),
             the C1orf2 gene for chromosome 1 open reading frame 2, the
             SCAMP3 gene for secretory carrier membrane protein 3, the
             CLK2 gene for CDC-like kinase 2, the HCN3 gene for
             hyperpolarization activated cyclic nucleotide-gated
             potassium channel 3, the PKLR gene for pyruvate kinase
             (liver and RBC) and three CpG islands, complete sequence
          Length = 133525

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    cagagagaccaggcagatgg 53
             ||||||||||||||||||||
Sbjct: 32506 cagagagaccaggcagatgg 32525



to top

>emb|AL691429.17| Human DNA sequence from clone RP13-137A17 on chromosome 10 Contains the
             5' end of a novel gene, four novel genes and nine CpG
             islands, complete sequence
          Length = 136299

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    ggcagagagaccaggcagat 51
             ||||||||||||||||||||
Sbjct: 93664 ggcagagagaccaggcagat 93683



to top

>gb|AC087216.1|AC087216 Mus musculus strain 129svj chromosome 17 clone GS1-11M9, complete
              sequence
          Length = 226594

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    gggttctgctgctgagccac 228
              ||||||||||||||||||||
Sbjct: 109024 gggttctgctgctgagccac 109043



to top

>gb|AC154730.3| Mus musculus BAC clone RP23-120M21 from chromosome 14, complete
             sequence
          Length = 217242

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 22    gccaatcataggcagagagaccag 45
             |||||||| |||||||||||||||
Sbjct: 89451 gccaatcacaggcagagagaccag 89474



to top

>gb|AF023268.1|AF023268 Homo sapiens clk2 kinase (CLK2), propin1, cote1, glucocerebrosidase
             (GBA), and metaxin genes, complete cds; metaxin pseudogene
             and glucocerebrosidase pseudogene; and thrombospondin3
             (THBS3) gene, partial cds
          Length = 75270

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    cagagagaccaggcagatgg 53
             ||||||||||||||||||||
Sbjct: 69140 cagagagaccaggcagatgg 69121



to top

>gb|AC145946.3| Gallus gallus BAC clone CH261-23O21 from chromosome unknown, complete
              sequence
          Length = 248690

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 136    aaactgacttctaaactaagagat 159
              |||||||||||||||| |||||||
Sbjct: 169988 aaactgacttctaaacaaagagat 169965



to top

>emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chromosome 17, complete
             sequence
          Length = 219471

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   gggttctgctgctgagccac 228
             ||||||||||||||||||||
Sbjct: 63092 gggttctgctgctgagccac 63111



to top

>emb|AL672122.9| Mouse DNA sequence from clone RP23-435H13 on chromosome X, complete
             sequence
          Length = 179648

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   aggacaaaacattctatagc 121
             ||||||||||||||||||||
Sbjct: 54595 aggacaaaacattctatagc 54576


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,495,001
Number of Sequences: 3902068
Number of extensions: 1495001
Number of successful extensions: 23011
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22989
Number of HSP's gapped (non-prelim): 20
length of query: 244
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 222
effective length of database: 17,147,199,772
effective search space: 3806678349384
effective search space used: 3806678349384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top