ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaal2n06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103602.1| Zea mays PCO093211 mRNA sequence Length = 1490 Score = 656 bits (331), Expect = 0.0 Identities = 421/451 (93%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 1243 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 1184 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 1183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 1124 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 1123 aggcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgagcggcacgt 1064 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 1063 cgcagacctcgaggatgcccgtgagctcgttggccgcggcgtcgcggaacgcctggttca 1004 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 1003 cctcctcggcgagggtcttcttggagacctgcacgacgaggtcgacgacggagacgttcg 944 Query: 548 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 607 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 943 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 884 Query: 608 ccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcac 667 ||||||||||| ||||||||||| || ||||| |||||||| |||||||||||||| | Sbjct: 883 agacggccttggcggcgccggtggatgtgggcacgatgttgagcgcggcggcgcgggcgc 824 Query: 668 ggcgcaggtcgcggtggctcgcgtcgagcag 698 ||||||||||||||||||||||||| ||||| Sbjct: 823 ggcgcaggtcgcggtggctcgcgtccagcag 793
>emb|X15408.1|ZMGPA1 Maize Gpa1 gene for glyceraldehyde-3-phosphate dehydrogenase subunit A Length = 6414 Score = 640 bits (323), Expect = e-180 Identities = 419/451 (92%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 3156 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 3097 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 3096 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 3037 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 3036 aggcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgagcggcacgt 2977 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 2976 cgcagacctcgaggatgcccgtgagctcgttggccgcggcgtcgcggaacgcctggttca 2917 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 2916 cctcctcggcgagggtcttcttggagacctgcacgacgaggtcgacgacggagacgttcg 2857 Query: 548 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 607 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 2856 gggtgggcacccggagcgcgatcccgttgagcttgcccttaaggttggggagcaccagcg 2797 Query: 608 ccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcac 667 ||||||||||| || |||||||| || ||||| |||||||| |||||||||||||| | Sbjct: 2796 agacggccttggcggcaccggtggacgtgggcacgatgttgagcgcggcggcgcgggcgc 2737 Query: 668 ggcgcaggtcgcggtggctcgcgtcgagcag 698 ||||||||||||||||||||||||| ||||| Sbjct: 2736 ggcgcaggtcgcggtggctcgcgtccagcag 2706
>emb|X07157.1|ZMCHGADP Maize cytosolic mRNA for subunit A of chloroplast GAPDH (GapA) glyceraldehyde-3-phosphate dehydrogenase Length = 1382 Score = 640 bits (323), Expect = e-180 Identities = 419/451 (92%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 1153 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 1094 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 1093 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 1034 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 1033 aggcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgagcggcacgt 974 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 973 cgcagacctcgaggatgcccgtgagctcgttggccgcggcgtcgcggaacgcctggttca 914 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 913 cctcctcggcgagggtcttcttggagacctgcacgacgaggtcgacgacggagacgttcg 854 Query: 548 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 607 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 853 gggtgggcacccggagcgcgatcccgttgagcttgcccttaaggttggggagcaccagcg 794 Query: 608 ccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcac 667 ||||||||||| || |||||||| || ||||| |||||||| |||||||||||||| | Sbjct: 793 agacggccttggcggcaccggtggacgtgggcacgatgttgagcgcggcggcgcgggcgc 734 Query: 668 ggcgcaggtcgcggtggctcgcgtcgagcag 698 ||||||||||||||||||||||||| ||||| Sbjct: 733 ggcgcaggtcgcggtggctcgcgtccagcag 703
>gb|M18976.1|MZEG3PD Zea mays chloroplast glyceraldehyde-3-phosphate dehydrogenase gene, complete cds, clone lambda-gapA1 Length = 6414 Score = 640 bits (323), Expect = e-180 Identities = 419/451 (92%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 3156 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 3097 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 3096 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 3037 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 3036 aggcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgagcggcacgt 2977 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 2976 cgcagacctcgaggatgcccgtgagctcgttggccgcggcgtcgcggaacgcctggttca 2917 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 2916 cctcctcggcgagggtcttcttggagacctgcacgacgaggtcgacgacggagacgttcg 2857 Query: 548 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 607 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 2856 gggtgggcacccggagcgcgatcccgttgagcttgcccttaaggttggggagcaccagcg 2797 Query: 608 ccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcac 667 ||||||||||| || |||||||| || ||||| |||||||| |||||||||||||| | Sbjct: 2796 agacggccttggcggcaccggtggacgtgggcacgatgttgagcgcggcggcgcgggcgc 2737 Query: 668 ggcgcaggtcgcggtggctcgcgtcgagcag 698 ||||||||||||||||||||||||| ||||| Sbjct: 2736 ggcgcaggtcgcggtggctcgcgtccagcag 2706
>ref|XM_472744.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1209 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1209 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1150 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1149 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1090 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1089 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1030 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1029 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 970 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 969 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 910 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 909 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 850 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 849 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 790 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 789 ccggaggtcacggtggctcgcgtcgagcag 760
>emb|AL606636.4|OSJN00075 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0036B21, complete sequence Length = 138969 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 122129 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 122070 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 122069 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 122010 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 122009 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 121950 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 121949 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 121890 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 121889 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 121830 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 121829 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 121770 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 121769 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 121710 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 121709 ccggaggtcacggtggctcgcgtcgagcag 121680 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 122256 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 122212
>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete sequence Length = 176383 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 7810 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 7751 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 7750 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 7691 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 7690 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 7631 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 7630 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 7571 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 7570 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 7511 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 7510 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 7451 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 7450 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 7391 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 7390 ccggaggtcacggtggctcgcgtcgagcag 7361 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 7937 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 7893
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 22913354 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 22913295 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 22913294 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 22913235 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 22913234 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 22913175 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 22913174 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 22913115 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 22913114 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 22913055 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 22913054 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 22912995 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 22912994 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 22912935 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 22912934 ccggaggtcacggtggctcgcgtcgagcag 22912905 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 22913481 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 22913437
>dbj|AK119522.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-D11, full insert sequence Length = 1468 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1245 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1186 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1185 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1126 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1125 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1066 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1065 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1006 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1005 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 946 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 945 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 886 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 885 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 826 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 825 ccggaggtcacggtggctcgcgtcgagcag 796 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1372 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1328
>dbj|AK119220.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-H03, full insert sequence Length = 1366 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1245 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1186 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1185 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1126 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1125 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1066 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1065 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1006 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1005 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 946 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 945 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 886 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 885 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 826 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 825 ccggaggtcacggtggctcgcgtcgagcag 796
>dbj|AK103932.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E09, full insert sequence Length = 1566 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1250 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1191 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1190 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1131 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1130 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1071 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1070 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1011 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1010 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 951 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 950 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 891 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 890 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 831 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 830 ccggaggtcacggtggctcgcgtcgagcag 801 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1377 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1333
>dbj|AK103922.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-B10, full insert sequence Length = 1473 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1250 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1191 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1190 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1131 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1130 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1071 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1070 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1011 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1010 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 951 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 950 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 891 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 890 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 831 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 830 ccggaggtcacggtggctcgcgtcgagcag 801 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1377 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1333
>dbj|AK071685.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H17, full insert sequence Length = 1571 Score = 622 bits (314), Expect = e-175 Identities = 416/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1246 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1187 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1186 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1127 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1126 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1067 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1066 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1007 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1006 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 947 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 946 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 887 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 886 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 827 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 826 ccggaggtcacggtggctcgcgtcgagcag 797 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1373 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1329
>dbj|AK103994.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-F06, full insert sequence Length = 1538 Score = 615 bits (310), Expect = e-173 Identities = 415/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||| | ||||| ||||| Sbjct: 1250 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctccgcgagtatcccca 1191 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 1190 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 1131 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1130 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1071 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1070 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1011 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1010 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 951 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 950 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 891 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 890 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 831 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 830 ccggaggtcacggtggctcgcgtcgagcag 801 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1377 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1333
>dbj|AK104690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-G03, full insert sequence Length = 1540 Score = 607 bits (306), Expect = e-170 Identities = 414/450 (92%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 1250 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 1191 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| ||||||||||||||||||| Sbjct: 1190 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcgg 1131 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 1130 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 1071 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcac 488 || ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 1070 gcggacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcctggttcac 1011 Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| || Sbjct: 1010 ctcctcggcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcgg 951 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 950 cgtcggcacccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgc 891 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 |||||||||||||||||||||||| |||||||| ||||| || || || || || || || Sbjct: 890 cacggccttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcg 831 Query: 669 gcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||| |||||||||||||||||||| Sbjct: 830 ccggaggtcacggtggctcgcgtcgagcag 801 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 1377 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 1333
>emb|X15406.1|ZMPGPA1 Maize pseudo-Gpa1 pseudogene for glyceraldehyde-3-phosphate dehydrogenase subunit A Length = 5922 Score = 533 bits (269), Expect = e-148 Identities = 368/401 (91%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgacc 357 ||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 3081 gagtacccccactcgttgtcgtaccaggagatgaccttgaccatgtcgtctcccatgact 3022 Query: 358 atgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacg 417 || |||| || |||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 3021 atagtgagggaggcgtcgatagtggaggagacgtcggagcacctgaagtcgacggacacg 2962 Query: 418 aggggctcgtcgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaac 477 || ||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 2961 agcggcacgtcgcagacctcgaggatgccctgcagctcgttggccgcggcgtcgcggaac 2902 Query: 478 gcctggttcacctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacg 537 ||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||| Sbjct: 2901 gcctggttcacctcctcggcgagcgtcttcctggagacctgcacgacgaggtcgacgacg 2842 Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 || ||||| |||||||||||||| |||| |||||||||||||||||| |||||||||||| Sbjct: 2841 gagacgttcggggtgggcacccgcagcgtgatcccgttgagcttgccgttgaggttgggg 2782 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcg 657 ||||||||| | ||||||||||| ||||||||||| || ||||| |||||||| |||||| Sbjct: 2781 agcaccagcacgacggccttggcggcgccggtggacgtgggcacgatgttgagcgcggcg 2722 Query: 658 gcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 |||||||| |||||||||||||||||||||||||| ||||| Sbjct: 2721 gcgcgggcgcggcgcaggtcgcggtggctcgcgtccagcag 2681
>emb|X15407.1|ZMPGPA2 Maize pseudo-Gpa2 pseudogene for glyceraldehyde-3-phosphate dehydrogenase subunit A Length = 8839 Score = 490 bits (247), Expect = e-135 Identities = 400/451 (88%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| ||||| |||||||||||||||| || ||||| |||| Sbjct: 6327 ttcacttccactggttggcgcaaatgtcatcgaggtcgacgaccctttgcgagtaccccc 6268 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||| |||| |||||| | |||||||||||||||||| |||||||||||||| |||| | Sbjct: 6267 actctttgttgtaccaggaaatgaccttgaccatgtcatctcccatgaccatagtgaggg 6208 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | ||||||||||||||||||| |||||||||||||||||||||||||||||| ||| | | Sbjct: 6207 aggcgtcgatggtggaggagaagtcggagcacctgaagtcgacggacacgagcggcacat 6148 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| ||||||||||||| |||||||| || |||| |||||||||||||||||||| Sbjct: 6147 cgcagacctcgaggatgccctgcagctcgttagccgcggtgtcgcggaacgcctggttca 6088 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 ||||||||||||| |||||| ||||||||||||| || ||||||| |||||| ||||| | Sbjct: 6087 cctcctcggcgagcgtcttcctggagacctgcacgacaaggtcgaggacggagacgttcg 6028 Query: 548 gggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcg 607 |||||||||||| |||||||||||||||||||||||||||||||| |||||||||| || Sbjct: 6027 gggtgggcacccacagcgcgatcccgttgagcttgcccttgaggttcgggagcaccaacg 5968 Query: 608 ccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcac 667 | || |||||||| |||| |||||| || || || |||||||| |||||||||||||| | Sbjct: 5967 cgacagccttggcggcgctggtggacgtgggaacgatgttgagcgcggcggcgcgggcgc 5908 Query: 668 ggcgcaggtcgcggtggctcgcgtcgagcag 698 |||||| |||||||||||||||||| ||||| Sbjct: 5907 ggcgcatgtcgcggtggctcgcgtccagcag 5877
>gb|M31483.1|MZENAR2 Maize glyceraldehyde-3-phosphate dehydrogenase, 3' end Length = 456 Score = 454 bits (229), Expect = e-124 Identities = 292/313 (93%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 313 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 254 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 253 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 194 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| Sbjct: 193 aggcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgagcggcacgt 134 Query: 428 cgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttca 487 ||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 133 cgcagacctcgaggatgcccgtgagctcgttggccgcggcgtcgcggaacgcctggttca 74 Query: 488 cctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgg 547 |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | Sbjct: 73 cctcctcggcgagggtcttcttggagacctgcacgacgaggtcgacgacggagacgttcg 14 Query: 548 gggtgggcacccg 560 ||||||||||||| Sbjct: 13 gggtgggcacccg 1
>dbj|AK067817.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O22, full insert sequence Length = 778 Score = 343 bits (173), Expect = 5e-91 Identities = 218/233 (93%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 465 tcacttccactggttggcgacgatgtcggcgaggtcgacgaccctctgcgagtatcccca 406 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcga 368 ||||||||||||||| || |||||||| ||||||||||| |||||||||||||||||||| Sbjct: 405 ctcgttgtcgtaccaggcgatgaccttcaccatgtcgtcgcccatgaccatgctgagcga 346 Query: 369 cgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtc 428 ||||||||||||| | || |||||||||||||||||||||||||||||||| ||| |||| Sbjct: 345 cgcgtcgatggtgcacgacacgtcggagcacctgaagtcgacggacacgagcggcacgtc 286 Query: 429 gcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcct 481 |||||| |||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 285 gcagacctcgaggatgcccttgagctcgttggcggcgctgtcgcggaacgcct 233 Score = 42.1 bits (21), Expect = 2.4 Identities = 40/45 (88%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 133 gtgttgggagctcgatactttgaa-ttctcattacaaagaatcga 176 |||||||| |||||| |||| ||| |||||||||||||| ||||| Sbjct: 592 gtgttgggcgctcgaaacttcgaaattctcattacaaaggatcga 548
>gb|AF022730.1|AF022730 Oryza sativa glyceralehyde-3-phosphate dehydrogenase subunit (GAPDH) mRNA, partial cds Length = 1073 Score = 319 bits (161), Expect = 7e-84 Identities = 234/257 (91%), Gaps = 1/257 (0%) Strand = Plus / Minus Query: 436 tcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcacctcctcg 495 ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1065 tcgaggatgcc-ttgagctcgttggcggcgctgtcgcggaacgcctggttcacctcctcg 1007 Query: 496 gcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggc 555 ||||||||||||||||| |||||||||||||||||||| ||||||||||| || || ||| Sbjct: 1006 gcgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcggcgtcggc 947 Query: 556 acccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggcc 615 |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| Sbjct: 946 acccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgccacggcc 887 Query: 616 ttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcagg 675 ||||||||||||||||| |||||||| ||||| || || || || || || || || ||| Sbjct: 886 ttggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcgccggagg 827 Query: 676 tcgcggtggctcgcgtc 692 || ||||||||| |||| Sbjct: 826 tcacggtggctcccgtc 810
>gb|AF010582.1|AF010582 Oryza sativa glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, partial cds Length = 804 Score = 317 bits (160), Expect = 3e-83 Identities = 233/256 (91%), Gaps = 1/256 (0%) Strand = Plus / Minus Query: 437 cgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcacctcctcgg 496 |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 801 cgaggatgcc-ttgagctcgttggcggcgctgtcgcggaacgcctggttcacctcctcgg 743 Query: 497 cgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggca 556 |||||||||||||||| |||||||||||||||||||| ||||||||||| || || |||| Sbjct: 742 cgagggtcttcttggacacctgcaccacgaggtcgaccacggacacgttcggcgtcggca 683 Query: 557 cccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggcct 616 ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct: 682 cccggagcgcgatcccgttgagcttccccttgaggttcgggagcaccagcgccacggcct 623 Query: 617 tggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggt 676 |||||||||||||||| |||||||| ||||| || || || || || || || || |||| Sbjct: 622 tggccgcgccggtggacgtcggcacgatgttcagcgccgccgcacgcgcgcgccggaggt 563 Query: 677 cgcggtggctcgcgtc 692 | ||||||||| |||| Sbjct: 562 cacggtggctcccgtc 547
>gb|DQ270258.1| Cyanophora paradoxa glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, complete cds Length = 1442 Score = 293 bits (148), Expect = 4e-76 Identities = 358/428 (83%) Strand = Plus / Minus Query: 268 acgatgtcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgca 327 ||||| || |||||||||||||| | ||||||||| |||||||||||||||||||| || Sbjct: 1226 acgatctccgcgaggtcgacgacgcgctgggagtagccccactcgttgtcgtaccaggcg 1167 Query: 328 atgaccttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggtggaggag 387 || ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| Sbjct: 1166 atcaccttgaccatgtcgtcgcccatgaccatggtgagcgacgcgtcgatggtggaggac 1107 Query: 388 acgtcggagcacctgaagtcgacggacacgaggggctcgtcgcagacgtcgaggatgccc 447 ||||| ||| | ||||||| ||| |||||||||||||| ||||| |||||| |||| Sbjct: 1106 tggtcggtgcagcggaagtcgcaggagacgaggggctcgtccgagacgacgaggacgccc 1047 Query: 448 ttgagctcgttggcggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttc 507 ||||| ||| || ||| || ||||||| || ||| ||||| ||||||| ||||||| Sbjct: 1046 ttgaggtcggtgttggccgcctcgcggagggcagcgttgacctcatcggcgaaggtcttc 987 Query: 508 ttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccggagcgcg 567 || |||||| || |||||||| |||| || ||||| ||||| ||||| ||||| ||| Sbjct: 986 ttctcgacctggacgacgaggtccacgatcgagacgttcggggtcggcacgcggagggcg 927 Query: 568 atcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccg 627 | ||||||||||||||||| |||||||| || || || || |||||||||||||| ||| Sbjct: 926 aggccgttgagcttgcccttaaggttgggcaggacgagggcgacggccttggccgcaccg 867 Query: 628 gtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtggctc 687 || ||||| || || ||||| | ||| || ||||| |||||||| || |||||||||||| Sbjct: 866 gtcgaggtggggacgatgttcatggccgcagcgcgcgcacggcggagatcgcggtggctc 807 Query: 688 gcgtcgag 695 |||||||| Sbjct: 806 gcgtcgag 799
>gb|DQ270260.1| Spermatozopsis similis glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 795 Score = 289 bits (146), Expect = 6e-75 Identities = 344/410 (83%) Strand = Plus / Minus Query: 274 tcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgacc 333 ||||||||||||||||| | ||||||||| |||||||||||||||||||| || | || | Sbjct: 768 tcggcgaggtcgacgacgcgctgggagtagccccactcgttgtcgtaccacgccacgatc 709 Query: 334 ttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcg 393 |||||||||||||| ||||||||||| ||||||||| |||||||| | || |||||| Sbjct: 708 ttgaccatgtcgtcgcccatgaccatcgtgagcgacgagtcgatggagaccgacacgtcg 649 Query: 394 gagcacctgaagtcgacggacacgaggggctcgtcgcagacgtcgaggatgcccttgagc 453 | ||| | ||||||||| ||||| || ||||||||||| || | |||| |||||| | | Sbjct: 648 gtgcagcggaagtcgaccgacaccagcggctcgtcgcacaccgccaggacgcccttcatc 589 Query: 454 tcgttggcggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttcttggag 513 ||| ||| || || |||||||| || | |||||||||||| |||| ||||||||| Sbjct: 588 tcgccggccgccgcctcgcggaaggcgttgttcacctcctccgcgaaggtcttcttctcc 529 Query: 514 acctgcaccacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccg 573 ||||| | ||||||||||||| ||||||||||| |||||||| || ||||||| ||| Sbjct: 528 acctggatgacgaggtcgacgatcgacacgttgggcgtgggcacgcgcagcgcgaagccg 469 Query: 574 ttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggag 633 || ||||||||||| |||||||| ||||||||||| ||||||||||| |||||||||| | Sbjct: 468 ttcagcttgcccttcaggttgggcagcaccagcgcgacggccttggcggcgccggtggtg 409 Query: 634 gtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || ||||| |||||||| || || ||||| || ||||||||||||||||| Sbjct: 408 gtgggcacgatgttgagcgccgccgcgcgcgcgcggcgcaggtcgcggtg 359
>dbj|AB035312.1| Chlamydomonas sp. W80 gap-1 mRNA for NADP-glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1311 Score = 258 bits (130), Expect = 2e-65 Identities = 340/410 (82%) Strand = Plus / Minus Query: 274 tcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgacc 333 ||||| ||||| ||||| | ||| ||||| |||||||||||||||||||| || | ||| Sbjct: 1122 tcggccaggtcaacgacgcgctgcgagtagccccactcgttgtcgtaccaggcgaccacc 1063 Query: 334 ttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcg 393 |||||||||||||| |||||||||||| | || || ||||||||||| |||||||| || Sbjct: 1062 ttgaccatgtcgtcgcccatgaccatggtcagggaggcgtcgatggtcgaggagacatcc 1003 Query: 394 gagcacctgaagtcgacggacacgaggggctcgtcgcagacgtcgaggatgcccttgagc 453 ||||| | ||||||||| ||||| || ||||||||| | ||| | |||| |||||| || Sbjct: 1002 gagcagcggaagtcgaccgacaccagcggctcgtcggacacggccaggacgcccttctgc 943 Query: 454 tcgttggcggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttcttggag 513 || | |||||| ||||||||||| ||| |||||||| || | ||||||||| Sbjct: 942 gcgccgttggcggcctcgcggaacgcggcgttgacctcctccgcaaaggtcttcttctcc 883 Query: 514 acctgcaccacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccg 573 ||||||||||| ||||| |||| ||||||||||||||||||||| || ||||| || ||| Sbjct: 882 acctgcaccaccaggtccacgatggacacgttgggggtgggcacgcgcagcgcaatgccg 823 Query: 574 ttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggag 633 ||||||||||| || | | || |||||||| || ||||||||||| |||||||| ||| Sbjct: 822 ttgagcttgcctttcatggacggcagcaccagggcgacggccttggcggcgccggtcgag 763 Query: 634 gtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 |||||||| ||||| | |||||||||||||| ||||||||||||||||| Sbjct: 762 gtcggcacaatgttcatcgcggcggcgcgggcgcggcgcaggtcgcggtg 713
>gb|AY103974.1| Zea mays PCO123560 mRNA sequence Length = 1889 Score = 210 bits (106), Expect = 5e-51 Identities = 172/194 (88%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | |||||||||||||||||| ||||||||||||||| Sbjct: 1449 ccccactcgttgtcgtaccaggcgacgaccttgaccatgtcgtcgcccatgaccatgctg 1390 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 |||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||| Sbjct: 1389 agcgacgcgtcgatggtgcaggacacgtcggagcacctgaagtcgacggacacgagcggc 1330 Query: 424 tcgtcgcagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctgg 483 |||||||||| || |||||||||| ||| | ||||||||| | |||||||||| | Sbjct: 1329 acgtcgcagacctccaggatgccctgcagcgggccggcggcggccttgcggaacgccgcg 1270 Query: 484 ttcacctcctcggc 497 ||||| || ||||| Sbjct: 1269 ttcacgtcgtcggc 1256 Score = 121 bits (61), Expect = 3e-24 Identities = 145/173 (83%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| |||||||| |||||||| ||||| ||||| ||| Sbjct: 1224 aggtccaccacggacacgttcggggtcggcacccgcagcgcgatgccgttcagcttcccc 1165 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 ||||| | || ||||||||||||||||||||||| ||||| ||| |||||||| ||| Sbjct: 1164 ttgagctgcggcagcaccagcgccacggccttggcggcgcccgtgctcgtcggcacgatg 1105 Query: 646 ttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || || || || |||||||| || || |||||||||||| |||||| ||||| Sbjct: 1104 ttcagcgccgccgcgcgggcccgccggaggtcgcggtgggacgcgtccagcag 1052
>ref|XM_493811.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1335 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 1193 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 1134 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 1133 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 1074 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 1073 acgtcgcagacgtcgaggatgcc 1051 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 968 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 909 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 908 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 849 Query: 646 tt 647 || Sbjct: 848 tt 847
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 1644649 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 1644590 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 1644589 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 1644530 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 1644529 acgtcgcagacgtcgaggatgcc 1644507 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 1644424 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 1644365 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 1644364 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 1644305 Query: 646 tt 647 || Sbjct: 1644304 tt 1644303
>gb|AC099739.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1528D07, complete sequence Length = 87592 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 52095 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 52036 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 52035 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 51976 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 51975 acgtcgcagacgtcgaggatgcc 51953 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 51870 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 51811 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 51810 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 51751 Query: 646 tt 647 || Sbjct: 51750 tt 51749
>gb|AC144426.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1015F07, complete sequence Length = 127098 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 124210 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 124151 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 124150 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 124091 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 124090 acgtcgcagacgtcgaggatgcc 124068 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 123985 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 123926 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 123925 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 123866 Query: 646 tt 647 || Sbjct: 123865 tt 123864
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 1644647 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 1644588 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 1644587 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 1644528 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 1644527 acgtcgcagacgtcgaggatgcc 1644505 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 1644422 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 1644363 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 1644362 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 1644303 Query: 646 tt 647 || Sbjct: 1644302 tt 1644301
>dbj|AK067755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118G18, full insert sequence Length = 1668 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 1248 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 1189 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 1188 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 1129 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 1128 acgtcgcagacgtcgaggatgcc 1106 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 1023 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 964 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 963 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 904 Query: 646 tt 647 || Sbjct: 903 tt 902
>dbj|AP000615.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, clone:P0043E01 Length = 154128 Score = 188 bits (95), Expect = 2e-44 Identities = 131/143 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | ||||||||||||||||| |||||||||||| || Sbjct: 57112 ccccactcgttgtcgtaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 57053 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 57052 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 56993 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 56992 acgtcgcagacgtcgaggatgcc 56970 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 56887 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 56828 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 56827 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 56768 Query: 646 tt 647 || Sbjct: 56767 tt 56766
>gb|DQ122894.1| Chlamydomonas incerta chloroplast glyceraldehyde-3-phosphate dehydrogenase (GapA) mRNA, partial cds; nuclear gene for chloroplast product Length = 1708 Score = 182 bits (92), Expect = 1e-42 Identities = 185/216 (85%) Strand = Plus / Minus Query: 483 gttcacctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacac 542 ||||||||||||||||| ||||||||| ||||| || || ||||||||||| ||||| Sbjct: 873 gttcacctcctcggcgaaggtcttcttctcaacctggacgaccaggtcgacgaccgacac 814 Query: 543 gttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcac 602 | ||||||||||||| || || || || ||||| ||||||||||| ||| |||| ||||| Sbjct: 813 ggtgggggtgggcacgcgcagggcaatgccgttcagcttgcccttcaggctgggcagcac 754 Query: 603 cagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcg 662 ||| || ||||||||||| || ||||||| ||| ||||| ||||| |||||||||||||| Sbjct: 753 cagggcgacggccttggcggcaccggtggtggtgggcacaatgttcagggcggcggcgcg 694 Query: 663 ggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 ||| |||||||||||||||||| |||||| ||||| Sbjct: 693 ggcgcggcgcaggtcgcggtgggacgcgtccagcag 658 Score = 111 bits (56), Expect = 3e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 280 aggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgacc 339 |||||||| || | ||||||||| |||||||||||||||||||| |||| |||||||||| Sbjct: 1076 aggtcgaccacgcgctgggagtagccccactcgttgtcgtaccaggcaacgaccttgacc 1017 Query: 340 atgtcgtctcccatgaccatgctgagcgacgcgtcgatgg 379 |||||||| |||||||||||| | || || |||||||||| Sbjct: 1016 atgtcgtcgcccatgaccatggtcagggaggcgtcgatgg 977
>dbj|AK059014.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-A08, full insert sequence Length = 892 Score = 180 bits (91), Expect = 4e-42 Identities = 130/143 (90%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 ||||||||||||||| |||| || | ||||||||||||||||| |||||||||||| || Sbjct: 518 ccccactcgttgtcgcaccaggcgaccaccttgaccatgtcgtcgcccatgaccatggtg 459 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 ||||| ||||||||||||||||||||||||||||| | ||||||||||||||| || ||| Sbjct: 458 agcgaggcgtcgatggtggaggagacgtcggagcagcggaagtcgacggacaccagcggc 399 Query: 424 tcgtcgcagacgtcgaggatgcc 446 |||||||||||||||||||||| Sbjct: 398 acgtcgcagacgtcgaggatgcc 376 Score = 99.6 bits (50), Expect = 1e-17 Identities = 104/122 (85%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| || ||||||||||| ||||| ||||| || |||||||| ||||||||||| ||| Sbjct: 293 aggtccaccacggacacgttcggggtcggcacgcgcagcgcgatgccgttgagcttcccc 234 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || || | ||||||||||||||||||||||| || ||||||||| |||||||| ||| Sbjct: 233 ttcagctgcgggagcaccagcgccacggccttcgcggcgccggtgctcgtcggcacgatg 174 Query: 646 tt 647 || Sbjct: 173 tt 172
>gb|AY094351.1| Zea mays cultivar C_9 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 271 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 130 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 189 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 190 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 249 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 250 aggcgtcgatggtggaggagac 271
>gb|AY094350.1| Zea mays cultivar F_7 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 246 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 105 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 164 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 165 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 224 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 225 aggcgtcgatggtggaggagac 246
>gb|AY094349.1| Zea mays cultivar D_9 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 267 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 126 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 185 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 186 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 245 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 246 aggcgtcgatggtggaggagac 267
>gb|AY094348.1| Zea mays cultivar D_6 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094347.1| Zea mays cultivar F_1 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 267 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 126 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 185 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 186 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 245 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 246 aggcgtcgatggtggaggagac 267
>gb|AY094346.1| Zea mays cultivar Mo17 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 265 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 124 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 183 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 184 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 243 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 244 aggcgtcgatggtggaggagac 265
>gb|AY094345.1| Zea mays cultivar D_7 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 262 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 121 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 180 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 181 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 240 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 241 aggcgtcgatggtggaggagac 262
>gb|AY094344.1| Zea mays cultivar Wf9Ht glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 258 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 117 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 176 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 177 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 236 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 237 aggcgtcgatggtggaggagac 258
>gb|AY094343.1| Zea mays cultivar C123 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 267 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 126 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 185 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 186 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 245 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 246 aggcgtcgatggtggaggagac 267
>gb|AY094342.1| Zea mays cultivar TX601 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094341.1| Zea mays cultivar B84 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 261 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 120 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 179 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 180 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 239 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 240 aggcgtcgatggtggaggagac 261
>gb|AY094340.1| Zea mays cultivar H60 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 260 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 119 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 178 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 179 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 238 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 239 aggcgtcgatggtggaggagac 260
>gb|AY094339.1| Zea mays cultivar DE811 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094338.1| Zea mays cultivar 684 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 262 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 121 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 180 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 181 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 240 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 241 aggcgtcgatggtggaggagac 262
>gb|AY094337.1| Zea mays cultivar D71-4HT glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 261 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 120 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 179 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 180 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 239 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 240 aggcgtcgatggtggaggagac 261
>gb|AY094336.1| Zea mays cultivar H99 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094335.1| Zea mays cultivar CO109 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 260 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 119 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 178 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 179 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 238 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 239 aggcgtcgatggtggaggagac 260
>gb|AY094333.1| Zea mays cultivar B73 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 271 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 130 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 189 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 190 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 249 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 250 aggcgtcgatggtggaggagac 271
>gb|AY094332.1| Zea mays cultivar F_2 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 271 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 130 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 189 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 190 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 249 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 250 aggcgtcgatggtggaggagac 271
>gb|AY094331.1| Zea mays cultivar G_1 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094330.1| Zea mays cultivar B_6 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 268 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 127 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 186 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 187 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 246 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 247 aggcgtcgatggtggaggagac 268
>gb|AY094329.1| Zea mays cultivar H_4 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 268 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 127 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 186 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 187 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 246 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 247 aggcgtcgatggtggaggagac 268
>gb|AY094328.1| Zea mays cultivar F_4 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 259 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 118 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 177 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 178 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 237 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 238 aggcgtcgatggtggaggagac 259
>gb|AY094327.1| Zea mays cultivar F_3 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 267 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 126 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 185 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 186 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 245 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 246 aggcgtcgatggtggaggagac 267
>gb|AY094326.1| Zea mays cultivar F_5 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 349 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 208 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 267 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 268 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 327 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 328 aggcgtcgatggtggaggagac 349
>gb|AY094325.1| Zea mays cultivar H_5 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094324.1| Zea mays cultivar H_3 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 254 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 113 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 172 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 173 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 232 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 233 aggcgtcgatggtggaggagac 254
>gb|AY094323.1| Zea mays cultivar J40 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 264 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 123 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 182 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 183 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 242 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 243 aggcgtcgatggtggaggagac 264
>gb|AY094322.1| Zea mays cultivar 647 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 271 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 130 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 189 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 190 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 249 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 250 aggcgtcgatggtggaggagac 271
>gb|AY094321.1| Zea mays cultivar B_1 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 341 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 200 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 259 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 260 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 319 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 320 aggcgtcgatggtggaggagac 341
>gb|AY094320.1| Zea mays cultivar F_6 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 335 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 194 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 253 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 254 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 313 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 314 aggcgtcgatggtggaggagac 335
>gb|AY094319.1| Zea mays cultivar C_5 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 262 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 121 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 180 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 181 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 240 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 241 aggcgtcgatggtggaggagac 262
>gb|AY094318.1| Zea mays cultivar H_1 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 267 Score = 178 bits (90), Expect = 2e-41 Identities = 129/142 (90%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 126 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 185 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| | |||||||||||||||||||| |||||||||||| |||| | Sbjct: 186 actcgttgtcgtaccaggagatgaccttgaccatgtcgtcgcccatgaccatggtgaggg 245 Query: 368 acgcgtcgatggtggaggagac 389 | |||||||||||||||||||| Sbjct: 246 aggcgtcgatggtggaggagac 267
>emb|AJ246029.2|KFL246029 Klebsormidium flaccidum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA Length = 949 Score = 172 bits (87), Expect = 1e-39 Identities = 303/375 (80%) Strand = Plus / Minus Query: 310 tcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcgac 369 |||||||||||||| || | |||||||||||||||||||||| |||||| |||| ||| Sbjct: 946 tcgttgtcgtaccaggccacaaccttgaccatgtcgtctcccaggaccatcgtgagggac 887 Query: 370 gcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtcg 429 | || | ||||| || || || |||||||| ||||| | |||||| |||||||||||| Sbjct: 886 gaatccacagtggaagaaacatcagagcacctaaagtcaatggacacaaggggctcgtcg 827 Query: 430 cagacgtcgaggatgcccttgagctcgttggcggcggcgtcgcggaacgcctggttcacc 489 |||||| | || |||||||||||||| ||| || || ||||| || | ||||||| Sbjct: 826 ttgacgtccaaaattcccttgagctcgttattggcagcctcccggaaagcattgttcacc 767 Query: 490 tcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggg 549 ||||| |||| ||||||||| | ||| | || ||||| || ||||| ||||||||| Sbjct: 766 tcctcagcgaaggtcttcttctcggtctggatgaccaggtcaacaacggagacgttgggg 707 Query: 550 gtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgcc 609 ||||| || ||||| || |||||||| |||||||||||||| | ||| |||||||| || Sbjct: 706 gtggggacacggagggcaatcccgttcagcttgcccttgagctggggcagcaccagggca 647 Query: 610 acggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacgg 669 || |||||||| ||||| |||||||| ||||| ||| | || || || |||||||| ||| Sbjct: 646 acagccttggcggcgccagtggaggtgggcacaatgctcagagcagcagcgcgggcgcgg 587 Query: 670 cgcaggtcgcggtgg 684 |||||||| |||||| Sbjct: 586 cgcaggtcacggtgg 572
>gb|L27668.1|CRECPGAPA Chlamydomonas reinhardtii chloroplast glyceraldehyde-3-phosphate dehydrogenase (gapA) gene, complete cds Length = 2219 Score = 168 bits (85), Expect = 2e-38 Identities = 151/173 (87%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||||||||| |||||| ||||||||||||| || || || || ||||| ||||||||| Sbjct: 1705 aggtcgacgaccgacacggtgggggtgggcacgcgcagggcaatgccgttcagcttgccc 1646 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || ||| |||| |||||||||| |||||||||||| || ||||||| ||| ||||| ||| Sbjct: 1645 ttcaggctgggcagcaccagcgacacggccttggcggcaccggtggtggtgggcacaatg 1586 Query: 646 ttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||||||||||||||| |||||||||||||||||| |||||| ||||| Sbjct: 1585 ttcagggcggcggcgcgggcgcggcgcaggtcgcggtgggacgcgtccagcag 1533 Score = 103 bits (52), Expect = 8e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 280 aggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgacc 339 |||||||| || | ||||||||| |||||||||||||||||||| || | |||||||||| Sbjct: 2122 aggtcgaccacgcgctgggagtagccccactcgttgtcgtaccaggccacgaccttgacc 2063 Query: 340 atgtcgtctcccatgaccatgctgagcgacgcgtcgatgg 379 |||||||| |||||||||||| | || || |||||||||| Sbjct: 2062 atgtcgtcgcccatgaccatggtcagggaggcgtcgatgg 2023 Score = 48.1 bits (24), Expect = 0.039 Identities = 42/48 (87%) Strand = Plus / Minus Query: 462 ggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttctt 509 |||||| |||||||| || ||||||||||||||||| ||||||||| Sbjct: 1940 ggcggcctcgcggaaggcggcgttcacctcctcggcgaaggtcttctt 1893
>gb|DQ270261.1| Cladophora rupestris glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 1443 Score = 165 bits (83), Expect = 2e-37 Identities = 179/211 (84%) Strand = Plus / Minus Query: 474 gaacgcctggttcacctcctcggcgagggtcttcttggagacctgcaccacgaggtcgac 533 ||||||||||||||||||||| || || |||||||| |||||||| || ||||| || Sbjct: 906 gaacgcctggttcacctcctcagcaagtgtcttcttctctacctgcacgacaaggtcaac 847 Query: 534 gacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggtt 593 ||||||||||||||||||||| || ||||| || || |||||||||||||||||||| | Sbjct: 846 gacggacacgttgggggtgggaacacggagagcaatgccgttgagcttgcccttgagctg 787 Query: 594 ggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggc 653 ||||| ||||| || |||||||| || || ||||||| ||| || || |||||||| || Sbjct: 786 tgggaggaccagggcgacggccttagcggcaccggtggtggtggggacgatgttgagcgc 727 Query: 654 ggcggcgcgggcacggcgcaggtcgcggtgg 684 ||| ||||| |||||||| |||||||||||| Sbjct: 726 ggcagcgcgagcacggcgaaggtcgcggtgg 696 Score = 48.1 bits (24), Expect = 0.039 Identities = 60/72 (83%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 ||||||||| ||| |||||||||||||||||||| || | ||||| ||||| || || Sbjct: 1091 accctctggctgtagccccactcgttgtcgtaccaagcgaccaccttcaccatatcatcg 1032 Query: 349 cccatgaccatg 360 ||||| |||||| Sbjct: 1031 cccatcaccatg 1020
>gb|DQ270259.1| Scherffelia dubia glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, complete cds Length = 1210 Score = 163 bits (82), Expect = 1e-36 Identities = 193/230 (83%) Strand = Plus / Minus Query: 469 tcgcggaacgcctggttcacctcctcggcgagggtcttcttggagacctgcaccacgagg 528 ||||||||||||||||| |||||||| || | ||||||||| ||||| ||||| ||| Sbjct: 966 tcgcggaacgcctggttgacctcctccgcaaaggtcttcttctccacctgtaccacaagg 907 Query: 529 tcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttg 588 || || |||||||||||||| |||||||| || ||||||| ||||| ||||||||||| Sbjct: 906 tccaccacggacacgttgggcgtgggcacgcgcagcgcgaagccgttcagcttgcccttc 847 Query: 589 aggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttg 648 ||| || ||||||||||| || |||||||| |||||||||| ||| || || ||||| Sbjct: 846 aggcccggcagcaccagcgcgacagccttggcggcgccggtggtggtggggacgatgttc 787 Query: 649 agggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||||||||| || |||||||||||||||||| |||||| ||||| Sbjct: 786 agcgcggcggcgcgcgcgcggcgcaggtcgcggtgggacgcgtccagcag 737 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 294 ctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccat 353 ||||||||| |||||||||||||||||||| || | || ||| ||||||||||| ||||| Sbjct: 1141 ctgggagtatccccactcgttgtcgtaccacgccacgatcttcaccatgtcgtcgcccat 1082 Query: 354 gaccat 359 ||||| Sbjct: 1081 caccat 1076
>gb|DQ122925.1| Chlamydomonas incerta chloroplast glyceraldehyde-3-phosphate dehydrogenase (GapA) gene, partial cds; nuclear gene for chloroplast product Length = 1772 Score = 161 bits (81), Expect = 4e-36 Identities = 150/173 (86%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||||||||| |||||| ||||||||||||| || || || || ||||| ||||||||| Sbjct: 1357 aggtcgacgaccgacacggtgggggtgggcacgcgcagggcaatgccgttcagcttgccc 1298 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatg 645 || ||| |||| |||||||| || ||||||||||| || ||||||| ||| ||||| ||| Sbjct: 1297 ttcaggctgggcagcaccagggcgacggccttggcggcaccggtggtggtgggcacaatg 1238 Query: 646 ttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || ||||||||||||||||| |||||||||||||||||| |||||| ||||| Sbjct: 1237 ttcagggcggcggcgcgggcgcggcgcaggtcgcggtgggacgcgtccagcag 1185 Score = 91.7 bits (46), Expect = 3e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 306 ccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgag 365 |||||||||||||||||| |||| |||||||||||||||||| |||||||||||| | || Sbjct: 1772 ccactcgttgtcgtaccaggcaacgaccttgaccatgtcgtcgcccatgaccatggtcag 1713 Query: 366 cgacgcgtcgatgg 379 || |||||||||| Sbjct: 1712 ggaggcgtcgatgg 1699 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 483 gttcacctcctcggcgagggtcttctt 509 ||||||||||||||||| ||||||||| Sbjct: 1595 gttcacctcctcggcgaaggtcttctt 1569
>emb|AJ246027.2|MPO246027 Marchantia polymorpha mRNA for glyceraldehyde-3-phosphate dehydrogenase, subunit GapB Length = 1770 Score = 155 bits (78), Expect = 2e-34 Identities = 132/150 (88%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | |||||||||||||||||| |||||||||||| || Sbjct: 1293 ccccactcgttgtcgtaccaggccacgaccttgaccatgtcgtcgcccatgaccatggtg 1234 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 || || | ||||| ||||||||||||||||||||| | |||||||| |||||| ||||| Sbjct: 1233 agggaggagtcgacggtggaggagacgtcggagcagcggaagtcgatggacaccaggggg 1174 Query: 424 tcgtcgcagacgtcgaggatgcccttgagc 453 |||||| ||| ||||||||||||||||| Sbjct: 1173 atgtcgcacacggcgaggatgcccttgagc 1144 Score = 95.6 bits (48), Expect = 2e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| |||||||||||||| || |||||||| || |||||||||||||| ||||||||| Sbjct: 1068 aggtccacgacggacacgttcggcgtgggcacgcgcagcgcgatcccgttcagcttgccc 1009 Query: 586 ttgaggttggggagcaccagcgccacggcctt 617 ||||| | || |||||||||| ||||||||| Sbjct: 1008 ttgagctgcggcagcaccagcgacacggcctt 977
>gb|DQ270268.1| Chlorokybus atmophyticus glyceraldehyde-3-phosphate dehydrogenase subunit B (gapB) mRNA, complete cds Length = 1444 Score = 155 bits (78), Expect = 2e-34 Identities = 141/162 (87%) Strand = Plus / Minus Query: 523 acgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttg 582 ||||||||||||||||| |||||||||||||| || ||||| ||||| ||||| | |||| Sbjct: 1018 acgaggtcgacgacggaaacgttgggggtggggacgcggagggcgatgccgttcaacttg 959 Query: 583 cccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcact 642 |||||||| | || ||||| ||||| ||||||||||| || ||||| | ||| ||||| Sbjct: 958 cccttgagctgtggcagcacgagcgcgacggccttggcggctccggttgtggtgggcaca 899 Query: 643 atgttgagggcggcggcgcgggcacggcgcaggtcgcggtgg 684 |||||||| |||||||||||||| |||||||||||||||||| Sbjct: 898 atgttgagcgcggcggcgcgggcgcggcgcaggtcgcggtgg 857 Score = 85.7 bits (43), Expect = 2e-13 Identities = 85/99 (85%) Strand = Plus / Minus Query: 261 gttggcgacgatgtcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgta 320 |||||||||||||| |||||||||||| || | |||| ||| ||||||||||||||||| Sbjct: 1283 gttggcgacgatgtgggcgaggtcgaccacgcgctggctgtagccccactcgttgtcgta 1224 Query: 321 ccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||| || | |||||||| ||| || |||||||| ||||| Sbjct: 1223 ccacgcgacgaccttgagcatatcatctcccataaccat 1185
>gb|DQ301767.1| Dunaliella viridis chloroplast glyceraldehyde-3-phosphate dehydrogenase (GapA2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1330 Score = 151 bits (76), Expect = 4e-33 Identities = 187/224 (83%) Strand = Plus / Minus Query: 460 gcggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttcttggagacctgc 519 |||||||| |||||||| || | |||||||||||| |||| ||||||||| ||||||| Sbjct: 923 gcggcggcctcgcggaaggcgttgttcacctcctcagcgaaggtcttcttctcgacctgc 864 Query: 520 accacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagc 579 ||||| || || || | ||||||||||||||||||||| || || || | ||||| ||| Sbjct: 863 accaccagatccacaatggacacgttgggggtgggcacacgcagggccacaccgttcagc 804 Query: 580 ttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggc 639 |||||||| |||| || |||||||| ||||| ||||||||||| || |||| ||| ||| Sbjct: 803 ttgcccttcaggtcaggcagcaccagggccacagccttggccgcaccagtggtggtgggc 744 Query: 640 actatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || ||||| ||||||||||| || || ||||||||||| ||||| Sbjct: 743 acaatgttcagggcggcggcacgagcgcggcgcaggtcccggtg 700 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 294 ctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccat 353 ||||||||| |||||||||||||||||||| || | |||||||||||||| || ||||| Sbjct: 1089 ctgggagtagccccactcgttgtcgtaccaggcgaccaccttgaccatgtcatcacccat 1030 Query: 354 gaccatg 360 ||||||| Sbjct: 1029 gaccatg 1023
>gb|DQ301766.1| Dunaliella viridis chloroplast glyceraldehyde-3-phosphate dehydrogenase (GapA1) mRNA, complete cds; nuclear gene for chloroplast product Length = 1478 Score = 151 bits (76), Expect = 4e-33 Identities = 187/224 (83%) Strand = Plus / Minus Query: 460 gcggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttcttggagacctgc 519 |||||||| |||||||| || | |||||||||||| |||| ||||||||| ||||||| Sbjct: 929 gcggcggcctcgcggaaggcgttgttcacctcctcagcgaaggtcttcttctcgacctgc 870 Query: 520 accacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagc 579 ||||| || || || | ||||||||||||||||||||| || || || | ||||| ||| Sbjct: 869 accaccagatccacaatggacacgttgggggtgggcacacgcagggccacaccgttcagc 810 Query: 580 ttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggc 639 |||||||| |||| || |||||||| ||||| ||||||||||| || |||| ||| ||| Sbjct: 809 ttgcccttcaggtcaggcagcaccagggccacagccttggccgcaccagtggtggtgggc 750 Query: 640 actatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || ||||| ||||||||||| || || ||||||||||| ||||| Sbjct: 749 acaatgttcagggcggcggcacgagcgcggcgcaggtcccggtg 706 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 294 ctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccat 353 ||||||||| |||||||||||||||||||| || | |||||||||||||| || ||||| Sbjct: 1095 ctgggagtagccccactcgttgtcgtaccaggcgaccaccttgaccatgtcatcacccat 1036 Query: 354 gaccatg 360 ||||||| Sbjct: 1035 gaccatg 1029
>gb|DQ270269.1| Mesostigma viride glyceraldehyde-3-phosphate dehydrogenase subunit B (gapB) mRNA, complete cds Length = 1481 Score = 147 bits (74), Expect = 6e-32 Identities = 146/170 (85%) Strand = Plus / Minus Query: 529 tcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttg 588 |||||||| |||||||||||||||||||| || || ||||| |||||||||||||||||| Sbjct: 900 tcgacgactgacacgttgggggtgggcacacgcagggcgatgccgttgagcttgcccttg 841 Query: 589 aggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttg 648 || ||||| || ||||| | || |||||||| || || |||||||| || || |||||| Sbjct: 840 agcttgggcaggaccagggagacagccttggcggcacccgtggaggtggggacgatgttg 781 Query: 649 agggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || |||||||| ||||| |||||||||||||||||| |||||| ||||| Sbjct: 780 agcgcggcggcacgggcgcggcgcaggtcgcggtgggacgcgtccagcag 731 Score = 145 bits (73), Expect = 2e-31 Identities = 160/189 (84%) Strand = Plus / Minus Query: 261 gttggcgacgatgtcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgta 320 |||||| || |||||||| ||||||||||| | ||| ||||| ||||||||||||||||| Sbjct: 1171 gttggccacaatgtcggccaggtcgacgacgcgctgcgagtagccccactcgttgtcgta 1112 Query: 321 ccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggt 380 ||| || | |||||||||||||||||||||||||||||| | ||||||| |||||| || Sbjct: 1111 ccaggcgacgaccttgaccatgtcgtctcccatgaccatcgtcagcgacgagtcgatcgt 1052 Query: 381 ggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtcgcagacgtcgag 440 | |||||||||| ||||| | ||| |||| || || |||||| |||| | ||| |||| Sbjct: 1051 gcaggagacgtccgagcagcggaaatcgatcgagactaggggcaggtcggacacggcgag 992 Query: 441 gatgccctt 449 ||||||||| Sbjct: 991 gatgccctt 983
>gb|DQ270265.1| Mesostigma viride glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 1437 Score = 145 bits (73), Expect = 2e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 270 gatgtcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaat 329 ||||| ||| || |||||||| | ||||||||| |||||||||||||||||||| |||| Sbjct: 981 gatgtgggccagatcgacgacgcgctgggagtagccccactcgttgtcgtaccaggcaac 922 Query: 330 gaccttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggtggaggagac 389 |||||||||||||| || |||||||||||| | || || || |||||||| |||||||| Sbjct: 921 aaccttgaccatgtcatcacccatgaccatggtcagggaggcatcgatggtcgaggagac 862 Query: 390 gtcggagcacctgaagtcgacggacacgaggggctcgtcgcagac 434 ||| |||||| ||||||| || ||||| |||||||| |||||||| Sbjct: 861 gtcagagcacttgaagtccacagacaccaggggctcatcgcagac 817 Score = 123 bits (62), Expect = 8e-25 Identities = 164/198 (82%) Strand = Plus / Minus Query: 487 acctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttg 546 |||||||| |||| ||||||||| |||||| | || || || ||||| ||||||||| Sbjct: 764 acctcctcagcgaaggtcttcttctcgacctggatgaccagatcaacgactgacacgttg 705 Query: 547 ggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagc 606 ||||| ||||| || || || || ||||||||||||||||| || ||||| || ||||| Sbjct: 704 ggggttggcacacgcagggcaatgccgttgagcttgcccttcagcttgggcaggaccagg 645 Query: 607 gccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggca 666 || || |||||||| || || |||||||| || || |||||||| ||||||||||| || Sbjct: 644 gcgacagccttggcagcaccagtggaggtggggacgatgttgagcgcggcggcgcgagcg 585 Query: 667 cggcgcaggtcgcggtgg 684 |||||||||||||||||| Sbjct: 584 cggcgcaggtcgcggtgg 567
>gb|DQ270263.1| Chlorokybus atmophyticus glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 1239 Score = 143 bits (72), Expect = 9e-31 Identities = 162/192 (84%) Strand = Plus / Minus Query: 261 gttggcgacgatgtcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgta 320 |||||||||||||||||||||||| || || | ||| ||| ||||| ||||||||||| Sbjct: 996 gttggcgacgatgtcggcgaggtcaacaacacgttggctgtagccccattcgttgtcgta 937 Query: 321 ccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcgacgcgtcgatggt 380 ||| || | ||||||||||||||| || |||||||||||| |||| || | ||| ||||| Sbjct: 936 ccaggcgacgaccttgaccatgtcatcacccatgaccatggtgagggatgagtcaatggt 877 Query: 381 ggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtcgcagacgtcgag 440 ||| || ||||| | ||| | |||||| || ||||| |||||||||||||| ||| |||| Sbjct: 876 ggatgacacgtctgtgcagcggaagtcaacagacaccaggggctcgtcgcacacggcgag 817 Query: 441 gatgcccttgag 452 |||||||||||| Sbjct: 816 gatgcccttgag 805 Score = 133 bits (67), Expect = 9e-28 Identities = 127/147 (86%) Strand = Plus / Minus Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 ||||||||||||||||| || || || || || ||||| |||||||||||||| | ||| Sbjct: 719 gacacgttgggggtggggacacgcagggcaatgccgttaagcttgcccttgagctggggc 660 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcg 657 || ||||| |||||||||||||| || ||||||||||| ||||| ||||||||||| || Sbjct: 659 aggaccagggccacggccttggcggcaccggtggaggtgggcacgatgttgagggcagca 600 Query: 658 gcgcgggcacggcgcaggtcgcggtgg 684 |||||||| |||||||| ||||||||| Sbjct: 599 gcgcgggcgcggcgcagatcgcggtgg 573
>gb|DQ270257.1| Chlorella sp. JP-2005 glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 1414 Score = 141 bits (71), Expect = 4e-30 Identities = 185/223 (82%) Strand = Plus / Minus Query: 462 ggcggcgtcgcggaacgcctggttcacctcctcggcgagggtcttcttggagacctgcac 521 |||||| || ||||| |||| || |||||||| |||| ||||||||| |||||||| Sbjct: 738 ggcggcctcacggaaagcctcattgacctcctcagcgaaggtcttcttctccacctgcac 679 Query: 522 cacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagctt 581 ||| ||||| || || |||||| ||||||||||||| || || || | || |||||||| Sbjct: 678 caccaggtccaccacagacacggtgggggtgggcacgcgcagggccacaccattgagctt 619 Query: 582 gcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcac 641 ||||||||| || || |||||||| ||||| |||||||| |||||||||| ||| || || Sbjct: 618 gcccttgagcttaggcagcaccagggccacagccttggcggcgccggtggtggtgggaac 559 Query: 642 tatgttgagggcggcggcgcgggcacggcgcaggtcgcggtgg 684 ||||| ||||| ||||| ||||| |||||||||||||||||| Sbjct: 558 gatgttcagggctgcggcacgggcgcggcgcaggtcgcggtgg 516 Score = 65.9 bits (33), Expect = 2e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatg 360 |||||||||||||||||||| || | ||||||||||||||||| ||||| |||||| Sbjct: 896 ccccactcgttgtcgtaccaggccacaaccttgaccatgtcgtcacccataaccatg 840
>gb|DQ301765.1| Chlamydomonas reinhardtii chloroplast glyceraldehyde-3-phosphate dehydrogenase mRNA, partial cds; nuclear gene for chloroplast product Length = 176 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%) Strand = Plus / Minus Query: 571 ccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtg 630 ||||| ||||||||||| ||| |||| |||||||||| |||||||||||| || |||||| Sbjct: 173 ccgttcagcttgcccttcaggctgggcagcaccagcgacacggccttggcggcaccggtg 114 Query: 631 gaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcg 690 | ||| ||||| ||||| ||||||||||||||||| |||||||||||||||||| |||| Sbjct: 113 gtggtgggcacaatgttcagggcggcggcgcgggcgcggcgcaggtcgcggtgggacgcg 54 Query: 691 tcgagcag 698 || ||||| Sbjct: 53 tccagcag 46
>dbj|AK109016.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-A07, full insert sequence Length = 1712 Score = 127 bits (64), Expect = 5e-26 Identities = 169/204 (82%) Strand = Plus / Minus Query: 483 gttcacctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacac 542 |||||||||||| |||| ||||||||| ||||||||| || ||||| || |||||||| Sbjct: 945 gttcacctcctcagcgaaggtcttcttctcgacctgcacgaccaggtccaccacggacac 886 Query: 543 gttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcac 602 || || || ||||| || || || || || |||||||||||||| || || || ||||| Sbjct: 885 atttggtgttggcacgcgcagtgcaatgccattgagcttgcccttcagctttggcagcac 826 Query: 603 cagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcg 662 ||| ||||| |||||||| || ||||||| ||| ||||| ||||| ||||| || || || Sbjct: 825 cagggccacagccttggcggcaccggtggtggtgggcacgatgttcagggcagctgcacg 766 Query: 663 ggcacggcgcaggtcgcggtggct 686 ||| |||||||||||||||||||| Sbjct: 765 ggcgcggcgcaggtcgcggtggct 742 Score = 61.9 bits (31), Expect = 3e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgacc 357 ||||| |||||||||||||| ||||| || | ||||||||||||||||| ||||| ||| Sbjct: 1130 gagtagccccactcgttgtcataccaggccaccaccttgaccatgtcgtcacccatcacc 1071 Query: 358 atg 360 ||| Sbjct: 1070 atg 1068
>emb|AJ246026.1|MPO246026 Marchantia polymorpha mRNA for glyceraldehyde-3-phosphate dehydrogenase, subunit GapA Length = 1443 Score = 121 bits (61), Expect = 3e-24 Identities = 127/149 (85%) Strand = Plus / Minus Query: 283 tcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatg 342 ||||| |||||||| ||||| ||||||||||||||||||||||| | ||||| |||||| Sbjct: 1185 tcgaccaccctctgcgagtatccccactcgttgtcgtaccatgcgacaaccttcaccatg 1126 Query: 343 tcgtctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctg 402 ||||||||||| ||||| | | ||||| ||||| |||||| || ||||| | ||| ||| Sbjct: 1125 tcgtctcccataaccatcgtcaacgacgagtcgacggtggatgaaacgtcagtgcatctg 1066 Query: 403 aagtcgacggacacgaggggctcgtcgca 431 |||||||||||||| | ||||||||||| Sbjct: 1065 aagtcgacggacaccaaaggctcgtcgca 1037 Score = 97.6 bits (49), Expect = 5e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 523 acgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttg 582 ||||||||||| || ||||| || |||||||| |||| ||| || ||||||||||||||| Sbjct: 945 acgaggtcgaccactgacacattcggggtgggtaccctgagggcaatcccgttgagcttg 886 Query: 583 cccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcact 642 ||||| | |||||| ||||||| |||||||||||||| || || ||||| || ||||| Sbjct: 885 cccttcaagttgggcagcaccaaagccacggccttggctgctccagtggaagtgggcacg 826 Query: 643 atgtt 647 ||||| Sbjct: 825 atgtt 821
>dbj|AB106704.1| Eutreptiella sp. MBIC11104 GapA mRNA for glyceraldehyde-3-phosphate dehydrogenase, partial cds Length = 910 Score = 107 bits (54), Expect = 5e-20 Identities = 126/150 (84%) Strand = Plus / Minus Query: 529 tcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttg 588 ||||||| ||||||||||||||||||||| ||||| ||||| ||||| | |||||||||| Sbjct: 702 tcgacgatggacacgttgggggtgggcacgcggagggcgataccgttcaacttgcccttg 643 Query: 589 aggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttg 648 ||| |||||||||||| || ||||| ||| || ||||||||||| ||||| ||||| Sbjct: 642 aggctggggagcaccaaggcgacggcggcggcggcaccggtggaggtgggcacgatgttc 583 Query: 649 agggcggcggcgcgggcacggcgcaggtcg 678 | ||| |||| ||||| || ||||||||| Sbjct: 582 acggcaccggcacgggcgcgacgcaggtcg 553
>gb|DQ270266.1| Physcomitrella patens glyceraldehyde-3-phosphate dehydrogenase subunit A1 (gapA1) mRNA, partial cds Length = 1444 Score = 103 bits (52), Expect = 8e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 280 aggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgacc 339 ||||||||||||||||| ||||| ||||||||||||||||||||||| | ||||| ||| Sbjct: 1106 aggtcgacgaccctctgtgagtatccccactcgttgtcgtaccatgccacaaccttcacc 1047 Query: 340 atgtcgtctcccatgaccat 359 || ||||||||||||||||| Sbjct: 1046 atatcgtctcccatgaccat 1027 Score = 67.9 bits (34), Expect = 4e-08 Identities = 145/182 (79%) Strand = Plus / Minus Query: 478 gcctggttcacctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacg 537 |||||||| ||||||||||| | ||||||||| || || || || | ||| || || Sbjct: 905 gcctggtttacctcctcggcaaaggtcttcttctcaacttggacgaccaagtctacaact 846 Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 ||||| || ||||||||||| ||||| || || ||||||| ||| ||||| || || || Sbjct: 845 gacacattaggggtgggcacacggagggcaattccgttgatctttcccttcagatttggc 786 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcg 657 | || || |||||||||||||| || ||||||||||| ||||| ||||| ||||| ||| Sbjct: 785 aatacgagagccacggccttggcagctccggtggaggtgggcacaatgttcagggctgcg 726 Query: 658 gc 659 || Sbjct: 725 gc 724
>gb|AY094334.1| Zea mays cultivar I_1 glyceraldehyde-3-phosphate dehydrogenase subunit A, 3' UTR and partial cds Length = 272 Score = 103 bits (52), Expect = 8e-19 Identities = 70/76 (92%) Strand = Plus / Plus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||||||||| ||||||||| |||||| |||||||||||||||||||| ||||| |||| Sbjct: 193 ttcacttccactggttggcgcagatgtcagcgaggtcgacgaccctctgcgagtagcccc 252 Query: 308 actcgttgtcgtacca 323 |||||||||||||||| Sbjct: 253 actcgttgtcgtacca 268
>gb|U82749.1|MAU82749 Mycobacterium avium glyceraldehyde-3-phosphate dehydrogenase homolog (gapdh) gene, complete cds; and phosphoglycerate kinase gene, partial cds Length = 2530 Score = 97.6 bits (49), Expect = 5e-17 Identities = 88/101 (87%) Strand = Plus / Minus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||||||||| | |||||| | | ||||||||||||||||||||||| Sbjct: 1039 agcttgcccttgaggttgggcatgaccagcccgatcgccttggccgcgccggtggaggtg 980 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcaggtc 677 ||||| ||||| || ||||||||||| || ||||||||||| Sbjct: 979 ggcacgatgttcagcgcggcggcgcgcgcccggcgcaggtc 939 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 1316 ggagtagccccactcgttgtcgtacca 1290
>emb|AJ246030.1|SSP246030 Spirogyra sp. mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA Length = 956 Score = 95.6 bits (48), Expect = 2e-16 Identities = 129/156 (82%) Strand = Plus / Minus Query: 528 gtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccctt 587 ||||||||| || ||||||||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 726 gtcgacgactgaaacgttgggggtgggcacacggagggcaataccgttgagctttccctt 667 Query: 588 gaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcactatgtt 647 | | ||||||| |||| | ||||||||||| || ||||||||||| || || ||||| Sbjct: 666 caagctggggagaaccaaggaaacggccttggcggctccggtggaggtggggacgatgtt 607 Query: 648 gagggcggcggcgcgggcacggcgcaggtcgcggtg 683 | |||||||| |||||||| |||| ||| ||||| Sbjct: 606 caaagcggcggcacgggcacgacgcaagtcacggtg 571 Score = 48.1 bits (24), Expect = 0.039 Identities = 42/48 (87%) Strand = Plus / Minus Query: 313 ttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatg 360 |||||||||||||||| ||||| ||||| || |||||||| |||||| Sbjct: 941 ttgtcgtaccatgcaacaaccttaaccatatcatctcccataaccatg 894
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 95.6 bits (48), Expect = 2e-16 Identities = 90/104 (86%) Strand = Plus / Minus Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 ||||||||||| ||||||||||| | ||| | |||||| ||||||||||| || | |||| Sbjct: 343100 gacacgttgggcgtgggcacccgtaccgccaccccgttcagcttgcccttcagttcgggg 343041 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcac 641 | |||||||||||| ||||||||||| ||||||| ||| ||||| Sbjct: 343040 atcaccagcgccaccgccttggccgccccggtggtggtgggcac 342997 Score = 48.1 bits (24), Expect = 0.039 Identities = 45/52 (86%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgacca 340 |||| ||| ||||| |||||||||||||||||||| || || ||||| |||| Sbjct: 343349 acccgctgcgagtagccccactcgttgtcgtaccaggccatcaccttcacca 343298
>gb|DQ224370.1| Glycine max glyceraldehyde-3-phosphate dehydrogenase A subunit mRNA, complete cds Length = 1212 Score = 93.7 bits (47), Expect = 7e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||||| ||| Sbjct: 1172 accctttgggagtagccccattcattgtcataccaagcaatgaccttcaccatgtcatct 1113 Query: 349 cccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcg 408 |||||||||||| | | ||| | ||| | ||| ||||| || || | |||||||||||| Sbjct: 1112 cccatgaccatggtcaacgaggagtcaacggttgaggacacatcagtgcacctgaagtca 1053 Query: 409 acggacacgaggggctcgtcgcagacgtcgaggatgcccttgagctc 455 |||||||| || ||||| || || || |||||| ||||||||||| Sbjct: 1052 acggacacaagtggctcatcacacacagagaggattcccttgagctc 1006 Score = 50.1 bits (25), Expect = 0.010 Identities = 148/189 (78%) Strand = Plus / Minus Query: 501 ggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccg 560 ||||||||| |||||||| || |||||||| || || || ||||| || || ||||| || Sbjct: 960 ggtcttctttgagacctgaacgacgaggtccaccactgagacgttcggtgttggcacacg 901 Query: 561 gagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggc 620 ||| || || || ||||| ||||| |||||| | ||||| || || ||||| ||||| || Sbjct: 900 gagtgcaatgccattgagtttgcctttgagggttgggaggacaagggccactgcctttgc 841 Query: 621 cgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcg 680 || || || || || || || |||||||| || || || | ||||| | |||||| || Sbjct: 840 tgctcctgttgaagtggggacaatgttgagtgctgctgcccttgcacgcctcaggtcacg 781 Query: 681 gtggctcgc 689 ||||||||| Sbjct: 780 gtggctcgc 772
>emb|AJ007274.1|GVI7274 Gloeobacter violaceus gap2 gene, partial Length = 907 Score = 93.7 bits (47), Expect = 7e-16 Identities = 146/179 (81%) Strand = Plus / Minus Query: 520 accacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagc 579 ||||| ||||| || || || |||||||||||||||||||||| || | || | ||| Sbjct: 711 accaccaggtccaccaccgagacgttgggggtgggcacccggaaggccagaccatccagc 652 Query: 580 ttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggc 639 |||||||| || | ||| |||||||| | | |||||||||||| |||||| ||| ||| Sbjct: 651 ttgcccttcagttcgggcagcaccaggccgatggccttggccgccccggtgctggtgggc 592 Query: 640 actatgttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || ||| ||||||| || |||||||| |||||| ||||||||||||||| |||||||| Sbjct: 591 acgatgctgagggcagcagcgcgggcgcggcgccagtcgcggtggctcgcatcgagcag 533
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 93.7 bits (47), Expect = 7e-16 Identities = 146/179 (81%) Strand = Plus / Minus Query: 520 accacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagc 579 ||||| ||||| || || || |||||||||||||||||||||| || | || | ||| Sbjct: 568496 accaccaggtccaccaccgagacgttgggggtgggcacccggaaggccagaccatccagc 568437 Query: 580 ttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggc 639 |||||||| || | ||| |||||||| | | |||||||||||| |||||| ||| ||| Sbjct: 568436 ttgcccttcagttcgggcagcaccaggccgatggccttggccgccccggtgctggtgggc 568377 Query: 640 actatgttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcgagcag 698 || ||| ||||||| || |||||||| |||||| ||||||||||||||| |||||||| Sbjct: 568376 acgatgctgagggcagcagcgcgggcgcggcgccagtcgcggtggctcgcatcgagcag 568318 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 283 tcgacgaccctctgggagtaaccccactcgttgtcgtacca 323 |||||||| | ||||||||| |||||||||||||||||||| Sbjct: 568733 tcgacgacgcgctgggagtagccccactcgttgtcgtacca 568693 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 3527749 ggagtagccccactcgttgtcgtacca 3527775 Score = 44.1 bits (22), Expect = 0.61 Identities = 31/34 (91%) Strand = Plus / Plus Query: 601 accagcgccacggccttggccgcgccggtggagg 634 ||||||| ||| ||||||||||| |||||||||| Sbjct: 3528053 accagcgtcactgccttggccgccccggtggagg 3528086
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 93.7 bits (47), Expect = 7e-16 Identities = 95/111 (85%) Strand = Plus / Minus Query: 528 gtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccctt 587 ||||||||| || ||||| ||||| ||||| |||| || ||| |||| |||||||||||| Sbjct: 3019365 gtcgacgaccgagacgttcggggtcggcacgcggatcgagatgccgtcgagcttgccctt 3019306 Query: 588 gaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcgg 638 ||||| ||||||||| || | | |||||||||||||||||| |||||||| Sbjct: 3019305 gaggtcggggagcacgaggccgatggccttggccgcgccggtcgaggtcgg 3019255 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 571 ccgttgagcttgcccttgag 590 |||||||||||||||||||| Sbjct: 2469958 ccgttgagcttgcccttgag 2469977
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 91.7 bits (46), Expect = 3e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||||||||||||||||||||| ||||| || |||||||||||||| || || Sbjct: 1613852 ggccttggccgcgccggtggaggtcggcacgatgttcagcgcggcggcgcgggcgcgacg 1613793 Query: 672 caggtc 677 |||||| Sbjct: 1613792 caggtc 1613787 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 1614164 ggagtagccccactcgttgtcgtacca 1614138
>emb|BX842576.1| Mycobacterium tuberculosis H37Rv complete genome; segment 5/13 Length = 348264 Score = 91.7 bits (46), Expect = 3e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||||||||||||||||||||| ||||| || |||||||||||||| || || Sbjct: 230926 ggccttggccgcgccggtggaggtcggcacgatgttcagcgcggcggcgcgggcgcgacg 230867 Query: 672 caggtc 677 |||||| Sbjct: 230866 caggtc 230861 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 231238 ggagtagccccactcgttgtcgtacca 231212
>emb|BX248338.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 5/14 Length = 299450 Score = 91.7 bits (46), Expect = 3e-15 Identities = 61/66 (92%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||||||||||||||||||||| ||||| || |||||||||||||| || || Sbjct: 295697 ggccttggccgcgccggtggaggtcggcacgatgttcagcgcggcggcgcgggcgcgacg 295638 Query: 672 caggtc 677 |||||| Sbjct: 295637 caggtc 295632 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 296009 ggagtagccccactcgttgtcgtacca 295983
>gb|DQ270267.1| Physcomitrella patens glyceraldehyde-3-phosphate dehydrogenase subunit A2 (gapA2) mRNA, partial cds Length = 1238 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Minus Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 |||||||| ||||| ||||| || || || || ||||||| ||||||||| | |||||| Sbjct: 680 gacacgtttggggttggcacacgcagggcaattccgttgatcttgcccttcaagttgggc 621 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgag 650 ||||||| ||||||||||||||| || || |||||||| ||||| |||||||| Sbjct: 620 agcaccaacgccacggccttggcagctcccgtggaggtgggcacaatgttgag 568 Score = 77.8 bits (39), Expect = 4e-11 Identities = 117/143 (81%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 |||||||||||||| ||||||||||| |||||||| |||| ||||| |||||||| ||| Sbjct: 932 accctctgggagtatccccactcgttatcgtaccacgcaacaaccttcaccatgtcttct 873 Query: 349 cccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcg 408 ||||| ||||| | | || | ||| | ||| || || || || | |||||||||||| Sbjct: 872 cccatcaccattgtcaaagatgagtccacggtcgatgacacatcagtgcacctgaagtct 813 Query: 409 acggacacgaggggctcgtcgca 431 || |||||||| ||||||||||| Sbjct: 812 actgacacgagtggctcgtcgca 790
>emb|X73035.1|CHCCGAPAR Chondrus crispus mRNA for glyceraldehyde-3-phosphate dehydrogenase (GapA gene) Length = 1655 Score = 85.7 bits (43), Expect = 2e-13 Identities = 79/91 (86%) Strand = Plus / Minus Query: 278 cgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttga 337 |||||||||| || || |||||||| |||||||||||||||||||| || | ||||||| Sbjct: 1523 cgaggtcgacaactctttgggagtatccccactcgttgtcgtaccaggcgacaaccttga 1464 Query: 338 ccatgtcgtctcccatgaccatgctgagcga 368 |||||| || |||||||||||| ||||||| Sbjct: 1463 tcatgtcatcacccatgaccatggtgagcga 1433 Score = 46.1 bits (23), Expect = 0.15 Identities = 50/59 (84%) Strand = Plus / Minus Query: 610 acggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 ||||||||||| || ||||||| ||| || || ||||| |||||||| | ||||||||| Sbjct: 1191 acggccttggcggcaccggtggtggtggggacaatgttaagggcggctgagcgggcacg 1133
>emb|X73033.1|CHCCGAPA Chondrus crispus GapA gene for glyceraldehyde-3-phosphate dehydrogenase Length = 3091 Score = 85.7 bits (43), Expect = 2e-13 Identities = 79/91 (86%) Strand = Plus / Minus Query: 278 cgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttga 337 |||||||||| || || |||||||| |||||||||||||||||||| || | ||||||| Sbjct: 2774 cgaggtcgacaactctttgggagtatccccactcgttgtcgtaccaggcgacaaccttga 2715 Query: 338 ccatgtcgtctcccatgaccatgctgagcga 368 |||||| || |||||||||||| ||||||| Sbjct: 2714 tcatgtcatcacccatgaccatggtgagcga 2684 Score = 46.1 bits (23), Expect = 0.15 Identities = 50/59 (84%) Strand = Plus / Minus Query: 610 acggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 ||||||||||| || ||||||| ||| || || ||||| |||||||| | ||||||||| Sbjct: 2442 acggccttggcggcaccggtggtggtggggacaatgttaagggcggctgagcgggcacg 2384
>gb|BT012685.1| Lycopersicon esculentum clone 113533R, mRNA sequence Length = 1501 Score = 83.8 bits (42), Expect = 7e-13 Identities = 99/118 (83%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||| ||||| ||||| || || ||||| || || || || |||||||| |||||||||| Sbjct: 1323 ttcatttccactggtttgcaacaatgtcagcaagatcaacaaccctctgtgagtaacccc 1264 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgag 365 | || ||||| ||||| ||||| ||||| |||||||| ||||||||||||||| |||| Sbjct: 1263 attcattgtcataccaagcaataaccttaaccatgtcatctcccatgaccatggtgag 1206
>emb|AJ252208.1|CFU252208 Scenedesmus vacuolatus partial mRNA for NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (phosphorylating), (gapA gene) Length = 941 Score = 83.8 bits (42), Expect = 7e-13 Identities = 159/198 (80%) Strand = Plus / Minus Query: 489 ctcctcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttggg 548 |||||| |||| ||||||||| ||||| || || ||||| || || |||||||| || Sbjct: 756 ctcctcagcgaaggtcttcttctccacctggacaaccaggtcaaccactgacacgtttgg 697 Query: 549 ggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgc 608 || ||||| || || || || || |||||||| ||||| || || || |||||||| || Sbjct: 696 tgttggcacacgcagagcaataccattgagctttcccttcagctttggcagcaccagggc 637 Query: 609 cacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacg 668 ||||||||||| || || |||| ||| ||||| ||||||||||| || || |||||||| Sbjct: 636 gacggccttggcggcaccagtggtggtgggcacaatgttgagggcagctgcacgggcacg 577 Query: 669 gcgcaggtcgcggtggct 686 ||| ||||| |||||||| Sbjct: 576 gcggaggtcacggtggct 559 Score = 65.9 bits (33), Expect = 2e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatg 360 |||||||||||||||||||| |||| ||||| ||||||||| | |||||||||||| Sbjct: 941 ccccactcgttgtcgtaccaggcaacaaccttcaccatgtcggcacccatgaccatg 885
>gb|AF260733.1|AF260733 Cucurbita pepo chloroplast NADP-dependent glyceraldehyde 3-phosphate dehydrogenase A subunit (GapA) mRNA, partial cds; nuclear gene for chloroplast product Length = 513 Score = 83.8 bits (42), Expect = 7e-13 Identities = 126/154 (81%) Strand = Plus / Minus Query: 302 aaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgc 361 ||||||| || ||||| ||||| ||||||||||| |||| ||| |||||||| ||||| Sbjct: 513 aaccccattcattgtcataccaagcaatgaccttcaccaagtcatctcccataaccatag 454 Query: 362 tgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggg 421 | | ||| | ||||| || ||||||||||||||||| || || ||||| || ||||||| Sbjct: 453 tcaacgaagagtcgacagtcgaggagacgtcggagcatctaaaatcgaccgaaacgaggg 394 Query: 422 gctcgtcgcagacgtcgaggatgcccttgagctc 455 ||||||| || ||| |||||| || |||||||| Sbjct: 393 gctcgtcacaaacggagaggataccgttgagctc 360
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||||||||| | |||||| | | ||||||||||||||||||||||| Sbjct: 1222597 agcttgcccttgaggttgggcatgaccagcccgatcgccttggccgcgccggtggaggtg 1222538 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcaggtc 677 || || ||||| || |||||||| || || ||||||||||| Sbjct: 1222537 gggacgatgttcagcgcggcggcacgcgcccggcgcaggtc 1222497 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 1222874 ggagtagccccactcgttgtcgtacca 1222848
>gb|BT012764.1| Lycopersicon esculentum clone 113710R, mRNA sequence Length = 1551 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||| ||||| |||| |||||||||||| || ||||||||||||||| | Sbjct: 1223 ccccactcgttgtcataccaagcaacgaccttgaccatatcatctcccatgaccatggtc 1164 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 | || | |||||||||||| || ||||| ||||| | |||||| Sbjct: 1163 aaggaggagtcgatggtggatgaaacgtcagagcatcggaagtc 1120
>emb|AJ246014.2|CVU246014 Chara vulgaris mRNA for glyceraldehyde-3-phosphate dehydrogenase, subunit GapB Length = 2218 Score = 79.8 bits (40), Expect = 1e-11 Identities = 106/128 (82%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||||||||||||||| || | |||||||||||||| || ||||| |||||| | Sbjct: 1405 ccccactcgttgtcgtaccaagccacaaccttgaccatgtcatcgcccataaccatggta 1346 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggc 423 || || | ||| | ||||||||||||||| | || | |||||| |||||||| || ||| Sbjct: 1345 agagaagagtcaacggtggaggagacgtccgtacaacggaagtcaacggacaccagaggc 1286 Query: 424 tcgtcgca 431 |||||||| Sbjct: 1285 tcgtcgca 1278
>gb|DQ270270.1| Spirogyra sp. SAG 170.80 glyceraldehyde-3-phosphate dehydrogenase subunit B (gapB) mRNA, partial cds Length = 965 Score = 79.8 bits (40), Expect = 1e-11 Identities = 91/108 (84%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||| | |||||||||||||| |||| || ||||||||||| |||||||| ||||| Sbjct: 963 gtaacccaattcgttgtcgtaccaggcaacaactttgaccatgtcatctcccatcaccat 904 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 | |||| || | |||||||||||||| || || ||||| |||||||| Sbjct: 903 ggtgagggaagaatcgatggtggaggaaacatctgagcatctgaagtc 856
>gb|M14418.1|TOBGAPB Tobacco (N.tabacum) GapB mRNA encoding B-subunit of chloroplast glyceradehyde-3-phosphate dehydrogenase Length = 1370 Score = 79.8 bits (40), Expect = 1e-11 Identities = 88/104 (84%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 ||||||||||| |||||||| || | |||||||||||| ||||||||||| |||||| | Sbjct: 1124 ccccactcgttatcgtaccaagccacgaccttgaccatatcgtctcccataaccatggtt 1065 Query: 364 agcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 | || | |||||||||||| ||||| || ||||| |||||||| Sbjct: 1064 aaagaggagtcgatggtggatgagacatcagagcatctgaagtc 1021
>gb|M14417.1|TOBGAPA Tobacco (N.tabacum) GapA mRNA encoding A-subunit of chloroplast glyceradehyde-3-phosphate dehydrogenase Length = 1327 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 248 ttcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccc 307 |||| ||||| ||||| || || ||||| || || || || |||||||| |||||||||| Sbjct: 1180 ttcatttccactggtttgcaacaatgtcagcaagatcaaccaccctctgtgagtaacccc 1121 Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 | || ||||| ||||| ||||| ||||| |||||||| |||||||||||||| Sbjct: 1120 attcattgtcataccaagcaataaccttaaccatgtcatctcccatgaccat 1069 Score = 50.1 bits (25), Expect = 0.010 Identities = 123/153 (80%), Gaps = 2/153 (1%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||||||||| || || || ||||| ||||| || ||||| ||||| ||||| ||| Sbjct: 926 gtcttcttggagacttggacgacaaggtcaacgaccgagacgttaggggttggcacacgg 867 Query: 562 a-gcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggc 620 | | || || || |||||||| ||||| ||| | ||||| || || ||||||||||| || Sbjct: 866 aggggcaatgccattgagcttccccttaaggcttgggaggacaag-gccacggccttagc 808 Query: 621 cgcgccggtggaggtcggcactatgttgagggc 653 || || || ||||| || || ||||||||||| Sbjct: 807 agcaccagttgaggttggaacgatgttgagggc 775
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 77.8 bits (39), Expect = 4e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 571 ccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtg 630 |||| ||||||||| ||||| | ||| |||||||| | | ||||||||||||||||||| Sbjct: 3799625 ccgtcgagcttgccgttgagctcgggcagcaccaggccgatggccttggccgcgccggtg 3799684 Query: 631 gaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtc 677 ||||||||| ||||| | |||||||||||||| || |||||||| Sbjct: 3799685 ctggtcggcacgatgttcaccgcggcggcgcgggcgcgacgcaggtc 3799731 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 3799354 ggagtagccccactcgttgtcgtacca 3799380 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 266 cgacgatgtcggcgaggtcgacga 289 ||||| |||||||||||||||||| Sbjct: 860252 cgacggtgtcggcgaggtcgacga 860275
>gb|AF173651.1|AF173651 Beta vulgaris clone PGAP109 glycerine aldehyde phosphate dehydrogenase, subunit A gene, partial sequence; nuclear gene for chloroplast product, Length = 1381 Score = 77.8 bits (39), Expect = 4e-11 Identities = 81/95 (85%) Strand = Plus / Plus Query: 493 tcggcgagggtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtg 552 ||||||| ||||||||||| ||| || || || ||||| || ||||| |||||||||||| Sbjct: 192 tcggcgaaggtcttcttggtgacttggacgacaaggtcaaccacggagacgttgggggtg 251 Query: 553 ggcacccggagcgcgatcccgttgagcttgccctt 587 || || || || ||||| ||||||||||||||||| Sbjct: 252 ggaacacgaagagcgattccgttgagcttgccctt 286
>dbj|AB042822.1| Kitasatospora griseola gdh gene for glyceraldehyde 3-phosphate dehydrogenase, complete cds Length = 999 Score = 77.8 bits (39), Expect = 4e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgc 672 ||||| || |||||||||| ||||||||| ||||||| | ||||||||||||| |||||| Sbjct: 644 gccttcgcggcgccggtggtggtcggcacgatgttgacgccggcggcgcgggcccggcgc 585 Query: 673 aggtcgcggtg 683 |||||||||| Sbjct: 584 gggtcgcggtg 574 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 950 ccccactcgttgtcgtacca 931
>gb|CP000110.1| Synechococcus sp. CC9605, complete genome Length = 2510659 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 601 accagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcg 660 ||||| |||||||||||||| || ||||||| ||| || || ||||| || || || || Sbjct: 30483 accagagccacggccttggctgcaccggtggtggtgggaaccatgttcagagctgcagca 30424 Query: 661 cgggcacggcgcaggtcgcggtggct 686 |||||||||||||||||||||||||| Sbjct: 30423 cgggcacggcgcaggtcgcggtggct 30398 Score = 44.1 bits (22), Expect = 0.61 Identities = 43/50 (86%) Strand = Plus / Minus Query: 274 tcggcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtacca 323 ||||||||||| || || | |||| ||| |||||||||||||||||||| Sbjct: 30810 tcggcgaggtcaacaacacgctggctgtagccccactcgttgtcgtacca 30761
>gb|L21904.1|EGRGAPA Euglena gracilis glyceraldehyde-3-phosphate dehydrogenase (gapA) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1487 Score = 75.8 bits (38), Expect = 2e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 ||||||||||| |||||||| || || ||||| ||||| | ||||||||| |||||||| Sbjct: 1160 gacacgttgggagtgggcacacgcagggcgatgccgttcaacttgcccttcaggttgggc 1101 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggt 635 |||||||| || || |||||||| || || |||||||| Sbjct: 1100 agcaccagtgcaacagccttggcagctcctgtggaggt 1063 Score = 50.1 bits (25), Expect = 0.010 Identities = 64/77 (83%) Strand = Plus / Minus Query: 283 tcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatg 342 |||||||| | ||||||||| ||||| || ||||||||||| | |||||||||||| Sbjct: 1415 tcgacgacacgctgggagtagccccattcattgtcgtaccacatcacaaccttgaccatg 1356 Query: 343 tcgtctcccatgaccat 359 || || ||||||||||| Sbjct: 1355 tcctcgcccatgaccat 1339
>emb|AJ012157.1|PDE012157 Paracoccus denitrificans gap gene, EcoRI clone Length = 1040 Score = 73.8 bits (37), Expect = 7e-10 Identities = 94/113 (83%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgccc 585 ||||| ||||| || ||||| ||||| ||||| |||| ||||| |||| ||| ||||| Sbjct: 739 aggtccacgaccgagacgttcggggtcggcacgcggatcgcgacgccgtccagcctgccc 680 Query: 586 ttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcgg 638 ||||| | || |||||||| |||||||||||||||||||||| |||||||| Sbjct: 679 ttgagctccggcagcaccaggcccacggccttggccgcgccggtcgaggtcgg 627
>gb|DQ270262.1| Chara vulgaris glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 956 Score = 73.8 bits (37), Expect = 7e-10 Identities = 118/145 (81%) Strand = Plus / Minus Query: 308 actcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcg 367 |||||||||||||||| || | ||||||||||| ||||| ||||| |||||| | | || Sbjct: 946 actcgttgtcgtaccacgcgacaaccttgaccatatcgtcacccataaccatggtcaacg 887 Query: 368 acgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgt 427 | | ||| | ||| || ||||| || | |||||||||||| |||||||| |||||||| | Sbjct: 886 aggagtcaacggttgaagagacatcagtgcacctgaagtcaacggacacaaggggctcat 827 Query: 428 cgcagacgtcgaggatgcccttgag 452 | || || | |||||||||||||| Sbjct: 826 cacatacagccaggatgcccttgag 802 Score = 69.9 bits (35), Expect = 1e-08 Identities = 110/135 (81%) Strand = Plus / Minus Query: 516 ctgcaccacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgtt 575 |||||| || |||||||||||||| || ||||| || ||||| ||||| ||||| || || Sbjct: 738 ctgcacaaccaggtcgacgacggagacattgggagttggcacacggagagcgataccatt 679 Query: 576 gagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggt 635 |||||| ||||| || | || || |||| || ||||||||||| ||||| |||||||| Sbjct: 678 gagcttccccttcagctgaggaagtaccaaagcgacggccttggcagcgcccgtggaggt 619 Query: 636 cggcactatgttgag 650 || || |||||||| Sbjct: 618 agggacaatgttgag 604
>ref|NM_103456.2| Arabidopsis thaliana GAPB (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE B SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase AT1G42970 (GAPB) mRNA, complete cds Length = 1721 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1327 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1268 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1267 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1220
>gb|AY142544.1| Arabidopsis thaliana clone RAFL07-08-B16 (R10654) mRNA sequence Length = 2947 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1333 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1274 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1273 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1226
>gb|AY079402.1| Arabidopsis thaliana putative glyceraldehyde-3-phosphate dehydrogenase (At1g42970) mRNA, complete cds Length = 1375 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1209 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1150 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1149 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1102
>gb|AY039961.1| Arabidopsis thaliana putative glyceraldehyde-3-phosphate dehydrogenase (At1g42970) mRNA, complete cds Length = 1654 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1328 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1269 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1268 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1221
>gb|AY140091.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1560 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1249 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1190 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1189 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1142
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 71.9 bits (36), Expect = 3e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgacca 340 |||| ||||||||| |||||||||||||||||||| || ||||||||||||| Sbjct: 1789641 acccgctgggagtagccccactcgttgtcgtaccaagccatgaccttgacca 1789590
>gb|AY095991.1| Arabidopsis thaliana At1g42970/F13A11_3 mRNA, complete cds Length = 1508 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1274 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1215 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1214 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1167
>gb|AY039539.1| Arabidopsis thaliana At1g42970/F13A11_3 mRNA, complete cds Length = 2912 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 2589 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 2530 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 2529 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 2482
>gb|AC068324.8|AC068324 Arabidopsis thaliana chromosome 1 BAC F13A11 genomic sequence, complete sequence Length = 95173 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 66553 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 66494 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 66493 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 66446
>gb|BT002267.1| Arabidopsis thaliana At1g42970/F13A11_3 mRNA, complete cds Length = 1344 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1209 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1150 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1149 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1102
>gb|M64115.1|ATHCPGAPBA Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase B subunit (GapB) mRNA, chloroplast gene encoding chloroplast protein, complete cds Length = 1319 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1086 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1027 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1026 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 979
>gb|M64118.1|ATHGAPBB Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase (GapB) gene, exons 1-9, complete cds Length = 2154 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||||||||| || ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 1824 gtaaccccactcgttatcataccaagcaaccaccttgaccatatcatcacccataaccat 1765 Query: 360 gctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtc 407 |||| |||| ||| ||||||| ||||| || |||||||||||||| Sbjct: 1764 agtgagggacgagtcaatggtggtagagacatcagagcacctgaagtc 1717
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 69.9 bits (35), Expect = 1e-08 Identities = 104/127 (81%) Strand = Plus / Minus Query: 547 ggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagc 606 ||||||||||| || |||| | | |||| || ||||||||| || |||||| |||| || Sbjct: 1203247 ggggtgggcacgcgcagcgaggttccgtcgaacttgcccttcagcttggggtacacctgc 1203188 Query: 607 gccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggca 666 | |||||||||||| |||||||||||||| || | || |||| |||||||| || ||| Sbjct: 1203187 gacacggccttggcggcgccggtggaggtggggatgatattgatcgcggcggcacgagca 1203128 Query: 667 cggcgca 673 ||||||| Sbjct: 1203127 cggcgca 1203121 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 1203494 ggagtagccccactcgttgtcgtacca 1203468
>emb|Z15102.1|GVCHGPD G.verrucosa mRNA for chloroplast glyceraldehyde 3-phosphate dehydrogenase Length = 1556 Score = 69.9 bits (35), Expect = 1e-08 Identities = 56/63 (88%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgacc 357 ||||||||||| ||||||||||||||||| | ||||||| |||||| || ||||||||| Sbjct: 1250 gagtaaccccattcgttgtcgtaccatgcgacaaccttgagcatgtcatcgcccatgacc 1191 Query: 358 atg 360 ||| Sbjct: 1190 atg 1188 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgc 672 |||||||| || ||||||| ||| || || |||||||||||||| | ||| |||||||| Sbjct: 935 gccttggcggcaccggtggtggtgggaacaatgttgagggcggctgagcgagcacggcga 876 Query: 673 aggtcgcggtg 683 || |||||||| Sbjct: 875 agatcgcggtg 865
>emb|AJ246009.1|CAN246009 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA2 Length = 936 Score = 69.9 bits (35), Expect = 1e-08 Identities = 101/123 (82%) Strand = Plus / Minus Query: 313 ttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagcgacgcg 372 ||||||||||| ||||| ||||| |||||||| ||||||||||||||| | || || || Sbjct: 935 ttgtcgtaccaagcaataaccttaaccatgtcatctcccatgaccatggtaagtgaagca 876 Query: 373 tcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcgtcgcag 432 || | || || || || || |||||||| |||||||| || |||||||| || |||||| Sbjct: 875 tccacagttgatgaaacatcagagcacctaaagtcgactgaaacgaggggttcatcgcag 816 Query: 433 acg 435 ||| Sbjct: 815 acg 813 Score = 40.1 bits (20), Expect = 9.6 Identities = 65/80 (81%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 ||||||||||| || || || |||||||| ||||| || || |||||||| ||||| || Sbjct: 746 gtcttcttggatacttgaacaacgaggtccacgaccgagacattgggggttggcacacgc 687 Query: 562 agcgcgatcccgttgagctt 581 | || || ||||||||||| Sbjct: 686 aaggcaatgccgttgagctt 667
>gb|L22011.1|GRCGAPAX Gracilaria gracilis glyceraldehyde-3-phosphate dehydrogenase precursor (gapA) gene, complete cds Length = 2878 Score = 69.9 bits (35), Expect = 1e-08 Identities = 56/63 (88%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgacc 357 ||||||||||| ||||||||||||||||| | ||||||| |||||| || ||||||||| Sbjct: 2329 gagtaaccccattcgttgtcgtaccatgcgacaaccttgagcatgtcatcgcccatgacc 2270 Query: 358 atg 360 ||| Sbjct: 2269 atg 2267 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgc 672 |||||||| || ||||||| ||| || || |||||||||||||| | ||| |||||||| Sbjct: 2014 gccttggcggcaccggtggtggtgggaacaatgttgagggcggctgagcgagcacggcga 1955 Query: 673 aggtcgcggtg 683 || |||||||| Sbjct: 1954 agatcgcggtg 1944
>gb|U21191.2|SAU21191 Streptomyces aureofaciens GapR transcripotional activator (gapR) and glyceraldehyde-3-phosphate dehydrogenase (gap) genes, complete cds; and delta-5-3-ketosteroid isomerase-like protein (ksi) gene, partial cds Length = 2731 Score = 69.9 bits (35), Expect = 1e-08 Identities = 53/59 (89%) Strand = Plus / Minus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||||| || | ||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 1916 gccttggccgcgcccgtcgtggtcggcacgatgttgacggcggcggcgcgggcgcggcg 1858 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 2222 ccccactcgttgtcgtacca 2203
>ref|NM_113576.2| Arabidopsis thaliana GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase AT3G26650 (GAPA) mRNA, complete cds Length = 1521 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 1071 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 1012 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 1011 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 962 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1324 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1265 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1264 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1214
>ref|NM_101161.2| Arabidopsis thaliana NAD binding / glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase AT1G12900 mRNA, complete cds Length = 1453 Score = 67.9 bits (34), Expect = 4e-08 Identities = 127/158 (80%) Strand = Plus / Minus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcg 345 ||||| ||||| ||||||||||| || ||||| ||||| ||||| || || ||||| || Sbjct: 1232 acgactctctgtgagtaaccccattcattgtcataccaagcaatcactttaaccatatca 1173 Query: 346 tctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaag 405 |||||||| ||||| |||| || | || || |||||||| || || |||||||||||| Sbjct: 1172 tctcccataaccattgtgagggaagaatcaatagtggaggatacatcagagcacctgaag 1113 Query: 406 tcgacggacacgaggggctcgtcgcagacgtcgaggat 443 || || || || || ||||| || |||||||| ||||| Sbjct: 1112 tcaacagagacaagaggctcatcacagacgtcaaggat 1075
>gb|BT015867.1| Arabidopsis thaliana At1g12900 mRNA, complete cds Length = 1200 Score = 67.9 bits (34), Expect = 4e-08 Identities = 127/158 (80%) Strand = Plus / Minus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcg 345 ||||| ||||| ||||||||||| || ||||| ||||| ||||| || || ||||| || Sbjct: 1163 acgactctctgtgagtaaccccattcattgtcataccaagcaatcactttaaccatatca 1104 Query: 346 tctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaag 405 |||||||| ||||| |||| || | || || |||||||| || || |||||||||||| Sbjct: 1103 tctcccataaccattgtgagggaagaatcaatagtggaggatacatcagagcacctgaag 1044 Query: 406 tcgacggacacgaggggctcgtcgcagacgtcgaggat 443 || || || || || ||||| || |||||||| ||||| Sbjct: 1043 tcaacagagacaagaggctcatcacagacgtcaaggat 1006
>emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence Length = 81493 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 48786 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 48727 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 48726 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 48677 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 49039 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 48980 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 48979 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 48929
>gb|BT008637.1| Arabidopsis thaliana clone RAFL09-89-F04 (R19904) putative calcium-binding protein, calreticulin (At1g12900) mRNA, complete cds Length = 1374 Score = 67.9 bits (34), Expect = 4e-08 Identities = 127/158 (80%) Strand = Plus / Minus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcg 345 ||||| ||||| ||||||||||| || ||||| ||||| ||||| || || ||||| || Sbjct: 1191 acgactctctgtgagtaaccccattcattgtcataccaagcaatcactttaaccatatca 1132 Query: 346 tctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaag 405 |||||||| ||||| |||| || | || || |||||||| || || |||||||||||| Sbjct: 1131 tctcccataaccattgtgagggaagaatcaatagtggaggatacatcagagcacctgaag 1072 Query: 406 tcgacggacacgaggggctcgtcgcagacgtcgaggat 443 || || || || || ||||| || |||||||| ||||| Sbjct: 1071 tcaacagagacaagaggctcatcacagacgtcaaggat 1034
>emb|AJ246031.1|SCU246031 Sphagnum cuspidatum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA1 Length = 956 Score = 67.9 bits (34), Expect = 4e-08 Identities = 66/77 (85%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 ||||| |||||| ||||||| |||| |||||||||||||| |||||||| |||||| || Sbjct: 950 ccccattcgttgncgtaccaagcaacaaccttgaccatgtcatctcccatcaccatggtg 891 Query: 364 agcgacgcgtcgatggt 380 || || | ||||||||| Sbjct: 890 agggaagagtcgatggt 874 Score = 44.1 bits (22), Expect = 0.61 Identities = 61/74 (82%) Strand = Plus / Minus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 ||||||||||| || || || || ||||| ||||| |||||||| || || || ||||| Sbjct: 677 agcttgcccttcagatttggcagtaccagtgccactgccttggctgcccctgttgaggtt 618 Query: 637 ggcactatgttgag 650 ||||| |||||||| Sbjct: 617 ggcacaatgttgag 604
>gb|AY142053.1| Arabidopsis thaliana At3g26650/MLJ15_5 mRNA, complete cds Length = 1191 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 938 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 879 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 878 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 829 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1191 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1132 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1131 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1081
>gb|AY075637.1| Arabidopsis thaliana AT3g26650/MLJ15_5 mRNA, complete cds Length = 1391 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 987 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 928 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 927 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 878 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1240 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1181 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1180 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1130
>gb|AY058140.1| Arabidopsis thaliana AT3g26650/MLJ15_5 mRNA, complete cds Length = 1383 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 985 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 926 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 925 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 876 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1238 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1179 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1178 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1128
>gb|AY058107.1| Arabidopsis thaliana AT3g26650/MLJ15_5 mRNA, complete cds Length = 1360 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 979 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 920 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 919 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 870 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1232 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1173 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1172 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1122
>gb|AF428431.1|AF428431 Arabidopsis thaliana AT3g26650/MLJ15_5 mRNA, complete cds Length = 1411 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 985 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 926 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 925 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 876 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1238 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1179 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1178 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1128
>dbj|AK220763.1| Arabidopsis thaliana mRNA for glyceraldehyde 3-phosphate dehydrogenase A subunit, complete cds, clone: RAFL22-19-D14 Length = 680 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 283 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 224 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 223 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 174 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 536 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 477 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 476 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 426
>dbj|AK221083.1| Arabidopsis thaliana mRNA for glyceraldehyde 3-phosphate dehydrogenase A, partial cds, clone: RAFL22-81-B12 Length = 359 Score = 67.9 bits (34), Expect = 4e-08 Identities = 127/158 (80%) Strand = Plus / Minus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcg 345 ||||| ||||| ||||||||||| || ||||| ||||| ||||| || || ||||| || Sbjct: 186 acgactctctgtgagtaaccccattcattgtcataccaagcaatcactttaaccatatca 127 Query: 346 tctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaag 405 |||||||| ||||| |||| || | || || |||||||| || || |||||||||||| Sbjct: 126 tctcccataaccattgtgagggaagaatcaatagtggaggatacatcagagcacctgaag 67 Query: 406 tcgacggacacgaggggctcgtcgcagacgtcgaggat 443 || || || || || ||||| || |||||||| ||||| Sbjct: 66 tcaacagagacaagaggctcatcacagacgtcaaggat 29
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 ||||||||| || ||| ||||||| ||||| ||||||||| | ||||| ||||||||||| Sbjct: 3746144 ggccttggcggctccgctggaggtgggcacgatgttgaggcccgcggcccgggcacggcg 3746085 Query: 672 caggtc 677 |||||| Sbjct: 3746084 caggtc 3746079 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 7560673 ggagtagccccactcgttgtcgtacca 7560647 Score = 46.1 bits (23), Expect = 0.15 Identities = 80/99 (80%) Strand = Plus / Minus Query: 579 cttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcgg 638 |||||||||||| | ||||| |||||||| ||||||||| || || |||| |||||| Sbjct: 7560391 cttgcccttgagctgcgggaggaccagcgcggtggccttggcggcacccgtggtggtcgg 7560332 Query: 639 cactatgttgagggcggcggcgcgggcacggcgcaggtc 677 | ||||| ||||||||| ||||| ||||||||||| Sbjct: 7560331 gatgatgttctcggcggcggcacgggcgcggcgcaggtc 7560293 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 3746456 ggagtagccccactcgttgtcgtacca 3746430 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 268 acgatgtcggcgaggtcgacgacc 291 |||||||||||||||||| ||||| Sbjct: 7816344 acgatgtcggcgaggtcggcgacc 7816367
>gb|AC012187.3|F13K23 Sequence of BAC F13K23 from Arabidopsis thaliana chromosome 1, complete sequence Length = 74328 Score = 67.9 bits (34), Expect = 4e-08 Identities = 127/158 (80%) Strand = Plus / Plus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcg 345 ||||| ||||| ||||||||||| || ||||| ||||| ||||| || || ||||| || Sbjct: 39489 acgactctctgtgagtaaccccattcattgtcataccaagcaatcactttaaccatatca 39548 Query: 346 tctcccatgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaag 405 |||||||| ||||| |||| || | || || |||||||| || || |||||||||||| Sbjct: 39549 tctcccataaccattgtgagggaagaatcaatagtggaggatacatcagagcacctgaag 39608 Query: 406 tcgacggacacgaggggctcgtcgcagacgtcgaggat 443 || || || || || ||||| || |||||||| ||||| Sbjct: 39609 tcaacagagacaagaggctcatcacagacgtcaaggat 39646
>dbj|AB026648.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLJ15 Length = 43481 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 6543 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 6484 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 6483 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 6434 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 6796 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 6737 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 6736 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 6686
>gb|M64114.1|ATHGAPAA Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) mRNA, complete cds Length = 1259 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 881 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 822 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 821 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 772 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1134 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1075 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1074 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1024
>gb|U44856.1|SAU44856 Streptomyces arenae pentalenolactone-insensitive glyceraldehyde-3-phosphate dehydrogenase (gapR) gene, complete cds Length = 1594 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 ||||||||| |||||| ||||||| ||||| ||||| ||||| ||||| ||||| ||||| Sbjct: 1002 ggccttggcggcgccgctggaggtgggcacgatgttcagggccgcggcccgggcccggcg 943 Query: 672 caggtc 677 |||||| Sbjct: 942 caggtc 937 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 ||||||||||||||||||||||||||| Sbjct: 1311 ggagtaaccccactcgttgtcgtacca 1285
>gb|M64117.1|ATHGAPAB Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) gene, exons 1-5 Length = 1970 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||||||||| ||||| || || || || ||||| || || || || ||| Sbjct: 1392 gtcttctttgagacctgcacaacgagatcaaccactgatacgtttggtgttggtacacgg 1333 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccac 611 || |||||||||||||| || || |||||||| |||||||| || ||||| Sbjct: 1332 agagcgatcccgttgagttttcctttgaggttagggagcacaagagccac 1283 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 249 tcacttccattggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaacccca 308 ||||||||| | |||||| || ||||| || | ||| || || ||||| ||||||||||| Sbjct: 1645 tcacttccagttgttggcaacaatgtcagccaagtcaacaactctctgtgagtaacccca 1586 Query: 309 ctcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 || || || ||||| ||||| ||||| ||||| || |||||||| ||||| Sbjct: 1585 ttcattatcataccaagcaatcaccttaaccatatcatctcccataaccat 1535
>dbj|AB037885.1| Mycobacterium smegmatis gpdA gene for glyceraldehyde-3-phosphate dehydrogenase, partial cds Length = 540 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||| | |||||||||||| | | ||||||||| |||||||| ||||| Sbjct: 281 agcttgcccttgagctcggggagcaccaggccgatggccttggcggcgccggtcgaggtg 222 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcag 674 || || ||||| ||||| ||||| ||||| || ||||| Sbjct: 221 gggacgatgttcagggccgcggcacgggcgcgacgcag 184
>gb|CP000111.1| Prochlorococcus marinus str. MIT 9312, complete genome Length = 1709204 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 286 acgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||| ||||||||||||||||| |||||||||| ||||||||| Sbjct: 25172 acgaccctctggctataaccccactcgttgtcataccatgcaaggaccttgac 25120 Score = 40.1 bits (20), Expect = 9.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 300 gtaaccccactcgttgtcgtacca 323 |||||||||||||||||| ||||| Sbjct: 676291 gtaaccccactcgttgtcatacca 676314
>emb|AL583919.1|MLEPRTN3 Mycobacterium leprae strain TN complete genome; segment 3/10 Length = 312050 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgc 672 ||||||||||| ||||| ||||||||||| | ||| || ||||| ||||||||||| ||| Sbjct: 7550 gccttggccgcaccggtagaggtcggcacaacgttcagcgcggcagcgcgggcacgacgc 7491 Query: 673 aggtc 677 ||||| Sbjct: 7490 aggtc 7486
>emb|AJ246032.1|SCU246032 Sphagnum cuspidatum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA2 Length = 852 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 574 ttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggag 633 |||||||||||||| ||||| || || ||||| ||||| |||||||| || || || ||| Sbjct: 577 ttgagcttgcccttcaggtttggcagtaccagtgccactgccttggctgcccctgttgag 518 Query: 634 gtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtggctcgcgtcg 693 || ||||| |||||||| || || || ||||| | ||| || || ||||||||||| || Sbjct: 517 gttggcacaatgttgagagcagctgcacgggccctgcgtagatcacggtggctcgcatca 458 Query: 694 agcag 698 ||||| Sbjct: 457 agcag 453 Score = 61.9 bits (31), Expect = 3e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctg 363 |||||||| ||||| ||||| |||| |||||||||||||| |||||||| |||||| || Sbjct: 847 ccccactcnttgtcataccaggcaacaaccttgaccatgtcatctcccatcaccatggtg 788 Query: 364 ag 365 || Sbjct: 787 ag 786
>gb|U00013.1|U00013 Mycobacterium leprae cosmid B1496 Length = 35881 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 613 gccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgc 672 ||||||||||| ||||| ||||||||||| | ||| || ||||| ||||||||||| ||| Sbjct: 31473 gccttggccgcaccggtagaggtcggcacaacgttcagcgcggcagcgcgggcacgacgc 31532 Query: 673 aggtc 677 ||||| Sbjct: 31533 aggtc 31537
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 63.9 bits (32), Expect = 7e-07 Identities = 116/144 (80%) Strand = Plus / Minus Query: 522 cacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagctt 581 ||||||||| || || || ||||| || || |||||||||| ||| | |||| |||||| Sbjct: 1642049 cacgaggtccaccaccgagacgttcggcgtcggcacccggatcgccacgccgtcgagctt 1641990 Query: 582 gcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcggcac 641 |||||| || | || ||||| || ||||||||||||| |||||||| |||||||| | Sbjct: 1641989 gcccttcagttccggcagcacgaggcccacggccttggcggcgccggtcgaggtcgggat 1641930 Query: 642 tatgttgagggcggcggcgcgggc 665 ||| |||| || ||||||||||| Sbjct: 1641929 catgctgagcgccgcggcgcgggc 1641906 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 1642267 ccccactcgttgtcgtacca 1642248
>ref|XM_306668.2| Anopheles gambiae str. PEST ENSANGP00000000051 (ENSANGG00000000051), partial mRNA Length = 1035 Score = 63.9 bits (32), Expect = 7e-07 Identities = 95/116 (81%) Strand = Plus / Minus Query: 538 gacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttgggg 597 ||||||||||||||||||||||||| ||| | ||| | |||||||||||||| | || Sbjct: 749 gacacgttgggggtgggcacccggatggcgttgccggtcagcttgcccttgagctccggc 690 Query: 598 agcaccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggc 653 ||| || ||||| |||||||| ||||||||| |||| ||| ||||||||||| Sbjct: 689 agcgccttggccaccgccttggcggcgccggtgctggtcatcaccatgttgagggc 634
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 63.9 bits (32), Expect = 7e-07 Identities = 92/112 (82%) Strand = Plus / Minus Query: 520 accacgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagc 579 ||||| || ||||| |||||||||| ||||||||||||||| || |||| ||||| ||| Sbjct: 2309352 accaccagatcgaccacggacacgtcgggggtgggcacccgcagggcgaagccgttcagc 2309293 Query: 580 ttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtgg 631 |||||| || | ||| |||||| | || ||||| || ||||||||||||| Sbjct: 2309292 cggcccttcagctcgggcagcacctgggcgacggctttcgccgcgccggtgg 2309241 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 277 gcgaggtcgacgaccctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttg 336 |||||||||||||||| ||||| |||||||||||||||||||| || ||||||||| Sbjct: 2309595 gcgaggtcgacgacccggcacgagtacccccactcgttgtcgtaccaggcgatgaccttg 2309536 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 1791954 ggagtagccccactcgttgtcgtacca 1791928 Score = 42.1 bits (21), Expect = 2.4 Identities = 72/89 (80%) Strand = Plus / Minus Query: 550 gtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgcc 609 ||||||||||| | ||||| ||| | ||||||||||| || | ||||| ||||| || Sbjct: 1791701 gtgggcacccgcatcgcgaagccggtcagcttgcccttcagctcggggatgaccagggcg 1791642 Query: 610 acggccttggccgcgccggtggaggtcgg 638 |||||||| || |||||||| | |||||| Sbjct: 1791641 acggccttcgcagcgccggtcgtggtcgg 1791613 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 370 gcgtcgatggtggaggagacg 390 ||||||||||||||||||||| Sbjct: 1241522 gcgtcgatggtggaggagacg 1241542
>gb|AF515622.1| Flammulina velutipes glyceraldehyde-3-phosphate dehydrogenase gene, complete cds Length = 3053 Score = 61.9 bits (31), Expect = 3e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||||||||||||||||||| || |||| |||||| Sbjct: 2881 gggagtaaccccactcgttgtcgtaccaggcgatgatcttgac 2839
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 61.9 bits (31), Expect = 3e-06 Identities = 88/107 (82%) Strand = Plus / Plus Query: 571 ccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtg 630 |||| |||||||||||| || | ||| |||||||| || ||||||||| || |||||| Sbjct: 2357280 ccgtcgagcttgcccttcagctcgggcagcaccagagcggtggccttggcggcaccggtg 2357339 Query: 631 gaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtc 677 | |||||| | ||||| | |||||||| ||||||||||||||||| Sbjct: 2357340 gtggtcgggatgatgttctgcgcggcggcccgggcacggcgcaggtc 2357386 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 2357009 ggagtagccccactcgttgtcgtacca 2357035
>emb|X73282.1|CPGPD Claviceps purpurea GPD 1 gene for glyceraldehyde-3-phosphate dehydrogenase Length = 3495 Score = 61.9 bits (31), Expect = 3e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 ||||||| |||||||||||||||||||| ||||||| |||||| Sbjct: 3157 gggagtagccccactcgttgtcgtaccaagcaatgagcttgac 3115
>emb|X04302.1|SAGAPD Mustard cytosolic mRNA for chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPDH, NADP-dependent; EC 1.2.1.13) Length = 829 Score = 61.9 bits (31), Expect = 3e-06 Identities = 97/119 (81%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||||||||| ||||| || | ||| || || || |||||||| || ||||| || Sbjct: 451 gtcttcttggagacttgcacaactaagtcaaccactgagacgttgggagttggcacacgc 392 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggc 620 | ||||| || ||||| || || |||||||| |||||||| || |||||||||||||| Sbjct: 391 aatgcgattccattgagttttcctttgaggttagggagcacgagagccacggccttggc 333 Score = 58.0 bits (29), Expect = 4e-05 Identities = 119/149 (79%) Strand = Plus / Minus Query: 292 ctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctccc 351 ||||| ||||||||||| || || || ||||| ||||| || || ||||| || |||||| Sbjct: 661 ctctgagagtaaccccattcattatcataccaagcaatcactttaaccatatcatctccc 602 Query: 352 atgaccatgctgagcgacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacg 411 || ||||| |||| || | || |||||||| || || || |||||||||||||| || Sbjct: 601 ataaccattgtgagagaagaatcaatggtggaagacacatcagagcacctgaagtcaaca 542 Query: 412 gacacgaggggctcgtcgcagacgtcgag 440 || || || ||||||||||| || ||||| Sbjct: 541 gagacaagaggctcgtcgcatacatcgag 513
>emb|AJ246010.1|CAN246010 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapB Length = 954 Score = 61.9 bits (31), Expect = 3e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 306 ccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatg 360 ||||||||| |||||||| |||| | ||||||||||||||||||||| |||||| Sbjct: 950 ccactcgttatcgtaccaagcaacaatcttgaccatgtcgtctcccataaccatg 896
>gb|L76552.1|SPIGDND Spinacia oleracea NADP-dependent glyceraldehydephosphate dehydrogenase subunit A mRNA, chloroplast gene encoding chloroplast protein, complete cds Length = 1397 Score = 61.9 bits (31), Expect = 3e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgacc 357 |||||||||||||| || || ||||||||||| || |||||||| || |||||||| ||| Sbjct: 1193 gagtaaccccactcattatcataccatgcaataactttgaccatatcatctcccataacc 1134 Query: 358 atg 360 ||| Sbjct: 1133 atg 1131
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 61.9 bits (31), Expect = 3e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 610 acggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacgg 669 ||||||||||| || || ||||||||||| | ||||| ||||||||||||||||| ||| Sbjct: 531566 acggccttggcggcacccgtggaggtcgggatcatgttcagggcggcggcgcgggcgcgg 531625 Query: 670 cgc 672 ||| Sbjct: 531626 cgc 531628 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 531251 ccccactcgttgtcgtacca 531270
>emb|BX569689.1| Synechococcus sp. WH8102 complete genome; segment 1/7 Length = 348764 Score = 60.0 bits (30), Expect = 1e-05 Identities = 117/146 (80%) Strand = Plus / Minus Query: 541 acgttgggggtgggcacccggagcgcgatcccgttgagcttgcccttgaggttggggagc 600 |||||||||||||| || || | |||| ||| ||||||||||||| | | |||| Sbjct: 30983 acgttgggggtgggaacgcgcatggcgaaaccggtgagcttgcccttcacctcggggtat 30924 Query: 601 accagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcg 660 ||||| ||||| ||||||||||| ||||||| ||| || || ||||| || || || || Sbjct: 30923 accagggccacagccttggccgcaccggtggtggtggggaccatgttcagagcagcagca 30864 Query: 661 cgggcacggcgcaggtcgcggtggct 686 ||||| || ||||||||||||||||| Sbjct: 30863 cgggcgcgacgcaggtcgcggtggct 30838 Score = 48.1 bits (24), Expect = 0.039 Identities = 24/24 (100%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||| Sbjct: 31224 gtaaccccactcgttgtcgtacca 31201
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Minus Query: 525 gaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcc 584 ||||||||| || || ||||| ||||| ||||| |||| ||||| |||| ||||||||| Sbjct: 5058866 gaggtcgaccaccgagacgttcggggtcggcacgcggatcgcgacgccgtcgagcttgcc 5058807 Query: 585 cttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtcgg 638 ||| || | ||| |||||||| | | |||||||| |||||||| |||||||| Sbjct: 5058806 cttcagttcgggcagcaccaggccgatcgccttggcggcgccggtcgaggtcgg 5058753 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 616 ttggccgcgccggtggaggtcggcac 641 |||||||||||||||||||||||||| Sbjct: 2577857 ttggccgcgccggtggaggtcggcac 2577832 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gctcgtcgcagacgtcgagg 441 |||||||||||||||||||| Sbjct: 2344549 gctcgtcgcagacgtcgagg 2344530 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 432 gacgtcgaggatgcccttga 451 |||||||||||||||||||| Sbjct: 1487295 gacgtcgaggatgcccttga 1487314
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||| || |||| ||| || | ||||||||||||||||| ||||| ||||| Sbjct: 865900 ggccttggccgcccccgtggtggtggggatgatgttgagggcggcggcccgggcgcggcg 865841 Query: 672 caggtc 677 |||||| Sbjct: 865840 caggtc 865835 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgacca 340 |||||||||||||||||||| || | ||||||||||| Sbjct: 866205 ccccactcgttgtcgtaccaggcgaagaccttgacca 866169
>emb|X16595.1|TAYT1GAP Thermus aquaticus gap gene for glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12) Length = 1393 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||| ||||||| ||| || | ||||||| ||||||||| ||||| ||||| Sbjct: 927 ggccttggccgccccggtggtggtggggatgatgttgatggcggcggcccgggcccggcg 868 Query: 672 caggtc 677 |||||| Sbjct: 867 caggtc 862 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgt 343 |||||||||||||||||||| || | |||||||||||||| Sbjct: 1232 ccccactcgttgtcgtaccaggcgaagaccttgaccatgt 1193
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 60.0 bits (30), Expect = 1e-05 Identities = 57/66 (86%) Strand = Plus / Minus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 |||||||||||| || |||| ||| || | ||||||||||||||||| ||||| ||||| Sbjct: 534950 ggccttggccgcccccgtggtggtggggatgatgttgagggcggcggcccgggcgcggcg 534891 Query: 672 caggtc 677 |||||| Sbjct: 534890 caggtc 534885 Score = 50.1 bits (25), Expect = 0.010 Identities = 34/37 (91%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgacca 340 |||||||||||||||||||| || | ||||||||||| Sbjct: 535255 ccccactcgttgtcgtaccaggcgaagaccttgacca 535219
>gb|AY673968.1| Galiella rufa glyceraldehyde 3-phosphate dehydrogenase (gpd) gene, complete cds Length = 2416 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||||||||||||||||| |||| || |||||| Sbjct: 2119 gagtaaccccactcgttgtcgtaccacgcaacgagcttgac 2079
>emb|X99652.1|ANG3PDEHY A.niger gpd gene Length = 3028 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 279 gaggtcgacgaccctctgggagtaaccccactcgttgtcgtacca 323 |||||||||||| | |||||||||||||||||||||||||||| Sbjct: 2607 gaggtcgacgacacggcgggagtaaccccactcgttgtcgtacca 2563
>emb|AJ252118.1|LSP252118 Lyngbya sp. PCC 7419 partial gap2 gene for NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) Length = 944 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtaccatgcaatgaccttgaccatgtc 344 |||||||||||||||||||| || |||||||| |||||||| Sbjct: 944 ccccactcgttgtcgtaccaagcgatgaccttcaccatgtc 904
>gb|DQ099333.1| Crinipellis perniciosa glyceraldehyde-3-phosphate dehydrogenase (gpd) gene, complete cds Length = 1461 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 1397 gagtaaccccactcgttgtcgtaccaagcgatgagcttgac 1357
>gb|AF320820.1| Leptomonas sp. Cfm glycosomal glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene, complete cds Length = 1086 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 295 tgggagtaaccccactcgttgtcgtacca 323 ||||||||||||||||||||||||||||| Sbjct: 1025 tgggagtaaccccactcgttgtcgtacca 997 Score = 42.1 bits (21), Expect = 2.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 526 aggtcgacgacggacacgttgggggtgggcacccgga 562 ||||||||||||||||||| ||||| ||||| |||| Sbjct: 782 aggtcgacgacggacacgtccggggtcggcacgcgga 746
>dbj|AK108431.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-A12, full insert sequence Length = 1211 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 295 tgggagtaaccccactcgttgtcgtacca 323 ||||||||||||||||||||||||||||| Sbjct: 996 tgggagtaaccccactcgttgtcgtacca 968
>dbj|AB013136.1| Lentinula edodes gLeGPD gene for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 4838 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||||||||||||||||| ||||| | |||||| Sbjct: 3622 gagtaaccccactcgttgtcgtaccaagcaatcaacttgac 3582
>dbj|AB012862.1| Lentinula edodes mRNA for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 1208 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtaccatgcaatgaccttgac 338 |||||||||||||||||||||||||| ||||| | |||||| Sbjct: 1004 gagtaaccccactcgttgtcgtaccaagcaatcaacttgac 964
>gb|DQ224371.1| Glycine max glyceraldehyde-3-phosphate dehydrogenase B subunit mRNA, complete cds Length = 1676 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||| || ||||| ||||| |||| ||||| |||||||| |||||||||||||| Sbjct: 1333 gtaaccccattcattgtcataccaagcaaccaccttaaccatgtcatctcccatgaccat 1274
>gb|DQ226803.1| Boechera divaricarpa isolate SLW-B-D12 mRNA sequence Length = 919 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 |||||||||||||||||| ||||| |||| ||||||||||| || || ||||| ||||| Sbjct: 636 gtaaccccactcgttgtcataccaggcaaccaccttgaccatatcatcacccattaccat 577
>ref|XM_386433.1| Gibberella zeae PH-1 chromosome 3 G3P_COLGL Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (FG06257.1) partial mRNA Length = 1017 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 964 gggagtaaccccactcgttgtcgtacca 937
>gb|AC126786.22| Medicago truncatula clone mth2-8c2, complete sequence Length = 115134 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||| || ||||| ||||| |||| ||||||||||| || |||||||||||||| Sbjct: 86760 gtaaccccattcattgtcataccaagcaaccaccttgaccatatcatctcccatgaccat 86701
>emb|X63516.1|CHGPD1 C.heterostrophus gpd1 gene for glyceraldehyde-3-phosphate dehydrogenase Length = 2522 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1941 gggagtaaccccactcgttgtcgtacca 1914
>gb|AY364464.1| Phaeosphaeria nodorum isolate S-82-13 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1251 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1198 gggagtaaccccactcgttgtcgtacca 1171
>gb|AY364463.1| Phaeosphaeria avenaria f. sp. triticae isolate Sat24-1 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1251 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1198 gggagtaaccccactcgttgtcgtacca 1171
>gb|AY364462.1| Phaeosphaeria nodorum isolate 9074 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1254 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1201 gggagtaaccccactcgttgtcgtacca 1174
>gb|AY364461.1| Phaeosphaeria nodorum isolate S74-20A glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1253 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1200 gggagtaaccccactcgttgtcgtacca 1173
>gb|AY364460.1| Phaeosphaeria nodorum isolate Sn37-1 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1255 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1202 gggagtaaccccactcgttgtcgtacca 1175
>gb|AY364459.1| Phaeosphaeria avenaria f. sp. avenaria strain ATCC 12277 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1251 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1198 gggagtaaccccactcgttgtcgtacca 1171
>gb|AY364458.1| Stagonospora sp. Sn48-1 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1254 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1201 gggagtaaccccactcgttgtcgtacca 1174
>gb|AY364457.1| Phaeosphaeria avenaria f. sp. triticae strain ATCC 26370 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1252 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1199 gggagtaaccccactcgttgtcgtacca 1172
>gb|AY364456.1| Phaeosphaeria avenaria f. sp. triticae isolate S81-W10 glyceraldehyde 3-phosphate dehydrogenase gene, complete cds Length = 1251 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1198 gggagtaaccccactcgttgtcgtacca 1171
>emb|Z68498.3|MAGPD1GN Monascus purpureus gpd1 gene for glyceraldehyde-3-phosphate dehydrogenase, exons 1-5 Length = 2834 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2406 gggagtaaccccactcgttgtcgtacca 2379
>emb|Y12542.1|THY12542 T.harzianum mRNA for glyceraldehyde-3-phosphate dehydrogenase Length = 1379 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 970 gggagtaaccccactcgttgtcgtacca 943
>emb|X58718.1|CLGPDG C.lunata gpd gene for glyceraldehyde-3-phosphate dehydrogenase Length = 2383 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2177 gggagtaaccccactcgttgtcgtacca 2150
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtaccatgcaatgaccttgacca 340 ||||||||||||||||||||| ||||| || | ||||||||||| Sbjct: 3849831 ggagtaaccccactcgttgtcataccaagccaggaccttgacca 3849788
>emb|AJ439986.1|OOL439986 Omphalotus olearius gpd gene for glyceraldehyde-3-phosphate dehydrogenase, exons 1-8 Length = 3270 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 3005 gggagtaaccccactcgttgtcgtacca 2978
>emb|AJ271155.1|SNO271155 Stagonospora nodorum GDP1 gene for glyceraldehyde 3-phosphate dehydrogenase, exons 1-5 Length = 3729 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 3140 gggagtaaccccactcgttgtcgtacca 3113
>gb|AC144482.11| Medicago truncatula clone mth2-10p1, complete sequence Length = 121112 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||||| || ||||| ||||| |||| ||||||||||| || |||||||||||||| Sbjct: 95217 gtaaccccattcattgtcataccaagcaaccaccttgaccatatcatctcccatgaccat 95158
>gb|AY273819.1| Porphyra yezoensis glyceraldehyde-3-phosphate dehydrogenase subunit A (GAPA) mRNA, complete cds Length = 1404 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 306 ccactcgttgtcgtaccatgcaatgaccttgaccat 341 |||||||||||||||||| |||| |||||||||||| Sbjct: 1274 ccactcgttgtcgtaccacgcaaggaccttgaccat 1239 Score = 50.1 bits (25), Expect = 0.010 Identities = 64/77 (83%) Strand = Plus / Minus Query: 607 gccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggca 666 |||||||||| |||||| || |||| ||| ||||| ||||||||||| || | ||||| Sbjct: 973 gccacggcctgggccgcacccgtggtggtgggcacaatgttgagggccgccgaccgggcg 914 Query: 667 cggcgcaggtcgcggtg 683 || |||||||| ||||| Sbjct: 913 cgacgcaggtcacggtg 897
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 521 ccacgaggtcgacgacggacacgttgggggtgggcacccg 560 |||| |||||||||||||| || ||||||||||||||||| Sbjct: 270994 ccaccaggtcgacgacggagacattgggggtgggcacccg 270955
>gb|M81724.1|SCOGLYC Schizophyllum commune glyceraldehyde-3-phosphate dehydrogenase (GPD) gene, complete cds Length = 1014 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtaccatgcaatga 331 ||||||| |||||||||||||||||||| ||||||| Sbjct: 961 gggagtagccccactcgttgtcgtaccaggcaatga 926
>dbj|AB194780.1| Pycnoporus coccineus gpd gene for glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 3184 Score = 56.0 bits (28), Expect = 2e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 523 acgaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttg 582 ||||||||||||||||| |||| | |||||||| |||| ||||| ||| |||||||| Sbjct: 1755 acgaggtcgacgacggagacgtcgatcgtgggcacacggaacgcgagaccggtgagcttg 1696 Query: 583 cccttgaggttgggga 598 || |||||| |||||| Sbjct: 1695 ccgttgaggctgggga 1680 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 ||||| |||||||||||||||||||| Sbjct: 1980 gagtagccccactcgttgtcgtacca 1955
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 56.0 bits (28), Expect = 2e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 600 caccagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggc 659 |||| ||| ||| |||||||| |||||||| ||||| || | ||||||| || ||||| Sbjct: 1349638 cacctgcgacacagccttggcggcgccggtcgaggtgggaatgatgttgatcgcagcggc 1349697 Query: 660 gcgggcacggcgcaggtcgc 679 |||||| ||||||||||||| Sbjct: 1349698 gcgggcgcggcgcaggtcgc 1349717 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 1349345 ccccactcgttgtcgtacca 1349364
>emb|AJ781266.1| Monascus purpureus mRNA for glyceraldehyde-3-phosphate dehydrogenase (gpd1 gene) Length = 1350 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1052 gggagtaaccccactcgttgtcgtacca 1025
>gb|AF000310.1|CLAF000310 Colletotrichum lindemuthianum glyceraldehyde-3-phosphate dehydrogenase (gpd) gene, complete cds Length = 3152 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2864 gggagtaaccccactcgttgtcgtacca 2837
>gb|M33539.1|EMEGPDAA A.nidulans glyceraldehyde-3-phosphate dehydrogenase (gpdA) mRNA, exons 1-7 Length = 3193 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2621 gggagtaaccccactcgttgtcgtacca 2594
>gb|M19694.1|EMEGPDA A.nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase, complete cds Length = 2758 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2186 gggagtaaccccactcgttgtcgtacca 2159
>gb|M93427.1|COGGPD Glomerella cingulata glyceraldehyde-3-phosphate dehydrogenase gene, complete cds Length = 3475 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 2624 gggagtaaccccactcgttgtcgtacca 2597
>gb|M88109.1|COGG3PD Colletotrichum gloeosporioides glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds Length = 1296 Score = 56.0 bits (28), Expect = 2e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 296 gggagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||||| Sbjct: 1002 gggagtaaccccactcgttgtcgtacca 975
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 608 ccacggccttggccgcgccggtggagg 634 ||||||||||||||||||||||||||| Sbjct: 3974913 ccacggccttggccgcgccggtggagg 3974939 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 297 ggagtaaccccactcgttgtcgtacca 323 |||||| |||||||||||||||||||| Sbjct: 3974602 ggagtagccccactcgttgtcgtacca 3974628
>emb|X59403.1|CGGAPPGK C.glutamicum gap, pgk and tpi genes for glyceraldehyde-3-phosphate, phosphoglycerate kinase and triosephosphate isomerase Length = 3804 Score = 54.0 bits (27), Expect = 6e-04 Identities = 87/107 (81%) Strand = Plus / Minus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||| | ||||| ||||| || || ||||| || || ||||||||||| Sbjct: 1012 agcttgcccttgagctctgggagaaccagagcaacagccttagctgcaccggtggaggta 953 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || || ||||||| || || || || ||||| |||||||||||||| Sbjct: 952 ggaacgatgttgactgctgctgcacgtgcacgacgcaggtcgcggtg 906 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 1282 ccccactcgttgtcgtacca 1263
>emb|X52148.1|CHPSGPA1 Pisum sativum gpa1 gene for glyceraldehyde-3-phosphate dehydrogenase, subunit A Length = 3696 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 ||||| || |||||||||||||| || || ||||| ||||| ||||| |||| ||| || Sbjct: 3422 accctttgtgagtaaccccactcattatcataccaagcaatcaccttaaccaggtcatcg 3363 Query: 349 cccatgaccat 359 ||||||||||| Sbjct: 3362 cccatgaccat 3352 Score = 54.0 bits (27), Expect = 6e-04 Identities = 150/191 (78%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||| || || |||||||| || || || ||||| || || ||||| || Sbjct: 3209 gtcttctttgagacttgaacgacgaggtccaccaccgaaacgtttggtgttggcacacga 3150 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggcc 621 ||||| || |||||||||||||| ||||| | ||||| || || ||||| || || || Sbjct: 3149 agcgcaataccgttgagcttgcctttgagtgttgggaggacaagggccactgctttagct 3090 Query: 622 gcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcgg 681 || || || || || || |||||||||||||| || || | ||||| | ||||| ||| Sbjct: 3089 gctcctgttgatgttgggactatgttgagggctgctgctctcgcacgccttaggtcacgg 3030 Query: 682 tggctcgcgtc 692 ||||||||||| Sbjct: 3029 tggctcgcgtc 3019
>emb|X15190.1|PSGAPA1 Pea chloroplast GAPA mRNA encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) subunit A (EC 1.2.1.13) Length = 1480 Score = 54.0 bits (27), Expect = 6e-04 Identities = 150/191 (78%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||| || || |||||||| || || || ||||| || || ||||| || Sbjct: 1027 gtcttctttgagacttgaacgacgaggtccaccaccgaaacgtttggtgttggcacacga 968 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggcc 621 ||||| || |||||||||||||| ||||| | ||||| || || ||||| || || || Sbjct: 967 agcgcaataccgttgagcttgcctttgagtgttgggaggacaagggccactgctttagct 908 Query: 622 gcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcgg 681 || || || || || || |||||||||||||| || || | ||||| | ||||| ||| Sbjct: 907 gctcctgttgatgttgggactatgttgagggctgctgctctcgcacgccttaggtcacgg 848 Query: 682 tggctcgcgtc 692 ||||||||||| Sbjct: 847 tggctcgcgtc 837 Score = 46.1 bits (23), Expect = 0.15 Identities = 59/71 (83%) Strand = Plus / Minus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 ||||| || |||||||||||||| || || ||||| ||||| ||||| || | ||| || Sbjct: 1240 accctttgtgagtaaccccactcattatcataccaagcaatcaccttaactaggtcatcg 1181 Query: 349 cccatgaccat 359 ||||||||||| Sbjct: 1180 cccatgaccat 1170
>emb|BX927152.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 5/10 Length = 349799 Score = 54.0 bits (27), Expect = 6e-04 Identities = 87/107 (81%) Strand = Plus / Plus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||| | ||||| ||||| || || ||||| || || ||||||||||| Sbjct: 288719 agcttgcccttgagctctgggagaaccagagcaacagccttagctgcaccggtggaggta 288778 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || || ||||||| || || || || ||||| |||||||||||||| Sbjct: 288779 ggaacgatgttgactgctgctgcacgtgcacgacgcaggtcgcggtg 288825 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 288449 ccccactcgttgtcgtacca 288468
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome Length = 3665893 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgt 343 |||||| |||||||||||||||||||| | | |||||||||||||| Sbjct: 1556757 ggagtatccccactcgttgtcgtaccaggacaagaccttgaccatgt 1556711
>gb|AY742764.1| Nitrosospira sp. KAN8 glyceraldehyde-3-phosphate dehydrogenase (cbbG) gene, complete cds Length = 1082 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 ||||||||||||||||||||||||||| Sbjct: 1040 ggagtaaccccactcgttgtcgtacca 1014
>gb|AY737493.1| Nitrosospira sp. PM2 glyceraldehyde-3-phosphate dehydrogenase (cbbG) gene, complete cds Length = 1082 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 297 ggagtaaccccactcgttgtcgtacca 323 ||||||||||||||||||||||||||| Sbjct: 1040 ggagtaaccccactcgttgtcgtacca 1014
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 608 ccacggccttggccgcgccggtggagg 634 ||||||||||||||||||||||||||| Sbjct: 1195986 ccacggccttggccgcgccggtggagg 1195960
>gb|DQ270264.1| Coleochaete scutata glyceraldehyde-3-phosphate dehydrogenase subunit A (gapA) mRNA, partial cds Length = 944 Score = 54.0 bits (27), Expect = 6e-04 Identities = 114/143 (79%) Strand = Plus / Minus Query: 307 cactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccatgctgagc 366 |||||||| ||||||||||||| ||||| |||||||| || ||||| ||||| | || Sbjct: 944 cactcgttatcgtaccatgcaaccaccttaaccatgtcatcacccataaccattgtcaga 885 Query: 367 gacgcgtcgatggtggaggagacgtcggagcacctgaagtcgacggacacgaggggctcg 426 |||| ||| | ||||| ||||| || ||| ||||||||| | || || ||||||||| Sbjct: 884 gacgagtcaacagtggatgagacatctgagagcctgaagtcagctgatacaaggggctcg 825 Query: 427 tcgcagacgtcgaggatgccctt 449 || |||||| | ||||| ||||| Sbjct: 824 tcacagacggcaaggattccctt 802
>gb|AC136505.41| Medicago truncatula clone mth2-24f15, complete sequence Length = 122801 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 289 accctctgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtct 348 ||||| || ||||||||||| || || || ||||| ||||| ||||| |||||||| ||| Sbjct: 16018 accctttgtgagtaaccccattcattatcataccaagcaatcaccttaaccatgtcatct 16077 Query: 349 cccatgaccat 359 ||||| ||||| Sbjct: 16078 cccataaccat 16088 Score = 42.1 bits (21), Expect = 2.4 Identities = 72/89 (80%) Strand = Plus / Plus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||| ||||| || || |||||||| || || || || || || || ||||| ||| Sbjct: 16231 gtcttctttgagacttgaacaacgaggtccaccaccgaaacatttggtgttggcacacgg 16290 Query: 562 agcgcgatcccgttgagcttgcccttgag 590 || || || |||||||||||||| ||||| Sbjct: 16291 agtgcaataccgttgagcttgcctttgag 16319
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 54.0 bits (27), Expect = 6e-04 Identities = 87/107 (81%) Strand = Plus / Plus Query: 577 agcttgcccttgaggttggggagcaccagcgccacggccttggccgcgccggtggaggtc 636 |||||||||||||| | ||||| ||||| || || ||||| || || ||||||||||| Sbjct: 1682943 agcttgcccttgagctctgggagaaccagagcaacagccttagctgcaccggtggaggta 1683002 Query: 637 ggcactatgttgagggcggcggcgcgggcacggcgcaggtcgcggtg 683 || || ||||||| || || || || ||||| |||||||||||||| Sbjct: 1683003 ggaacgatgttgactgctgctgcacgtgcacgacgcaggtcgcggtg 1683049 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 1682673 ccccactcgttgtcgtacca 1682692
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 54.0 bits (27), Expect = 6e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 525 gaggtcgacgacggacacgttgggggtgggcacccggagcgcgatcccgttgagcttgcc 584 |||||||||||| || ||||| ||||| ||||| |||| ||||| |||| ||||||||| Sbjct: 1660826 gaggtcgacgaccgagacgttcggggtcggcacgcggatcgcgacgccgtcgagcttgcc 1660885 Query: 585 ctt 587 ||| Sbjct: 1660886 ctt 1660888 Score = 40.1 bits (20), Expect = 9.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 ccccactcgttgtcgtacca 323 |||||||||||||||||||| Sbjct: 1660605 ccccactcgttgtcgtacca 1660624
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 608 ccacggccttggccgcgccggtggagg 634 ||||||||||||||||||||||||||| Sbjct: 1229531 ccacggccttggccgcgccggtggagg 1229505
>ref|XM_753545.1| Ustilago maydis 521 glyceraldehyde 3-phosphate dehydrogenase (UM02491.1) partial mRNA Length = 1014 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 962 gagtaaccccactcgttgtcgtacca 937
>ref|XM_743052.1| Aspergillus fumigatus Af293 glyceraldehyde 3-phosphate dehydrogenase GpdA (Afu5g01970) partial mRNA Length = 1017 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 965 gagtaaccccactcgttgtcgtacca 940
>emb|AJ609407.2| Armillariella tabescens mRNA for glyceraldehyde 3-phosphate dehydrogenase (gpd gene) Length = 1020 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 959 gagtaaccccactcgttgtcgtacca 934
>gb|AY373586.1| Armillariella tabescens glyceraldehyde 3-phosphate dehydrogenase (gpd) mRNA, complete cds Length = 924 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 721 gagtaaccccactcgttgtcgtacca 696
>emb|X86376.1|S6803GAP2 Synechocystis 6803 gap2 gene Length = 1496 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 295 tgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtc 344 ||||| || ||||| |||||||||||||| |||||||| || |||||||| Sbjct: 1205 tgggaatagccccattcgttgtcgtaccaagcaatgactttaaccatgtc 1156 Score = 46.1 bits (23), Expect = 0.15 Identities = 77/95 (81%) Strand = Plus / Minus Query: 601 accagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcg 660 ||||| ||||| || ||||| || ||||||||||| ||||| ||||| | ||| || || Sbjct: 899 accagggccaccgctttggcagctccggtggaggtgggcacgatgttaacggcagcagcc 840 Query: 661 cgggcacggcgcaggtcgcggtggctcgcgtcgag 695 ||||| ||||| || || |||||||| || ||||| Sbjct: 839 cgggcccggcgtagatcccggtggctagcatcgag 805 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 535 acggacacgttgggggtgggcacccg 560 ||||| |||||||||||||||||||| Sbjct: 965 acggaaacgttgggggtgggcacccg 940
>emb|X83564.1|SDNAGAP2 Synechocystis sp. (strain PCC 6803) gap2 gene Length = 1874 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 295 tgggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatgtc 344 ||||| || ||||| |||||||||||||| |||||||| || |||||||| Sbjct: 1422 tgggaatagccccattcgttgtcgtaccaagcaatgactttaaccatgtc 1373 Score = 46.1 bits (23), Expect = 0.15 Identities = 77/95 (81%) Strand = Plus / Minus Query: 601 accagcgccacggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcg 660 ||||| ||||| || ||||| || ||||||||||| ||||| ||||| | ||| || || Sbjct: 1116 accagggccaccgctttggcagctccggtggaggtgggcacgatgttaacggcagcagcc 1057 Query: 661 cgggcacggcgcaggtcgcggtggctcgcgtcgag 695 ||||| ||||| || || |||||||| || ||||| Sbjct: 1056 cgggcccggcgtagatcccggtggctagcatcgag 1022 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 535 acggacacgttgggggtgggcacccg 560 ||||| |||||||||||||||||||| Sbjct: 1182 acggaaacgttgggggtgggcacccg 1157
>emb|X15189.1|SOGPB1 Spinach chloroplast Gpb1 mRNA encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) subunit A (GapA) (EC 1.2.1.13) Length = 1549 Score = 52.0 bits (26), Expect = 0.003 Identities = 38/42 (90%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccat 341 |||||||||||| ||||||||||| |||| |||||| ||||| Sbjct: 1224 gtaaccccactcattgtcgtaccaagcaacgaccttaaccat 1183
>emb|X07879.1|UMGAPD Ustilaga maydis gene for glyceraldehyde-3-phosphate dehydrogenase (gapd, EC 1.2.1.12.) Length = 2273 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 1959 gagtaaccccactcgttgtcgtacca 1934
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 52.0 bits (26), Expect = 0.003 Identities = 92/114 (80%) Strand = Plus / Plus Query: 564 cgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggccgc 623 |||||| |||| ||||||||||||||| | || || |||||||| ||||||||| || Sbjct: 261508 cgcgatgccgtcgagcttgcccttgagctgcggcaggaccagcgcggtggccttggcggc 261567 Query: 624 gccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcgcaggtc 677 ||| |||| |||||| | ||||| |||||||| ||||| ||||||||||| Sbjct: 261568 gcccgtggtggtcgggatgatgttctccgcggcggcacgggcgcggcgcaggtc 261621 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Plus Query: 298 gagtaaccccactcgttgtcgtacca 323 ||||| |||||||||||||||||||| Sbjct: 261239 gagtagccccactcgttgtcgtacca 261264
>emb|AL162752.2|NMA1Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 1/7 Length = 340806 Score = 52.0 bits (26), Expect = 0.003 Identities = 53/62 (85%) Strand = Plus / Plus Query: 612 ggccttggccgcgccggtggaggtcggcactatgttgagggcggcggcgcgggcacggcg 671 ||||||||| || |||||| | | ||||| |||||||| |||||||||||||| ||||| Sbjct: 230125 ggccttggcggcaccggtgctgttgggcacgatgttgagcgcggcggcgcgggcgcggcg 230184 Query: 672 ca 673 || Sbjct: 230185 ca 230186
>emb|AJ246008.1|CAN246008 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate dehydrogenase, subunit GapA1 Length = 942 Score = 52.0 bits (26), Expect = 0.003 Identities = 44/50 (88%) Strand = Plus / Minus Query: 310 tcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||| || ||||| ||||| ||||| |||||||| |||||||||||||| Sbjct: 938 tcgttatcataccaagcaataaccttaaccatgtcatctcccatgaccat 889 Score = 50.1 bits (25), Expect = 0.010 Identities = 118/149 (79%) Strand = Plus / Minus Query: 502 gtcttcttggagacctgcaccacgaggtcgacgacggacacgttgggggtgggcacccgg 561 |||||||||||||| || || || ||||| || || || || || |||||||| || ||| Sbjct: 746 gtcttcttggagacttgaacgacaaggtccacaactgagacattaggggtggggacacgg 687 Query: 562 agcgcgatcccgttgagcttgcccttgaggttggggagcaccagcgccacggccttggcc 621 || || || || |||||||| ||||| ||| | ||||| || || ||||| ||||| || Sbjct: 686 agggcaatgccattgagcttacccttaaggcttgggaggacaagggccacagccttagca 627 Query: 622 gcgccggtggaggtcggcactatgttgag 650 || || || ||||| || ||||||||||| Sbjct: 626 gcaccagttgaggttggaactatgttgag 598
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 297 ggagtaaccccactcgttgtcgtaccatgcaatgaccttgaccatg 342 |||||| |||||||||||||| ||||| || | ||||||||||||| Sbjct: 1867949 ggagtatccccactcgttgtcataccaggccaggaccttgaccatg 1867994
>gb|L76553.1|SPIGDNDA Spinacia oleracea NADP-dependent glyceraldehydephosphate dehydrogenase subunit B mRNA, chloroplast gene encoding chloroplast protein, complete cds Length = 1469 Score = 52.0 bits (26), Expect = 0.003 Identities = 38/42 (90%) Strand = Plus / Minus Query: 300 gtaaccccactcgttgtcgtaccatgcaatgaccttgaccat 341 |||||||||||| ||||||||||| |||| |||||| ||||| Sbjct: 1232 gtaaccccactcattgtcgtaccaagcaacgaccttaaccat 1191
>gb|AF417110.1|AF417110 Sclerotinia sclerotiorum glyceraldehyde-3-phosphate dehydrogenase (gpds) gene, complete cds Length = 1905 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 1794 gagtaaccccactcgttgtcgtacca 1769
>emb|AL116738.1|CNS01DEY Botrytis cinerea strain T4 cDNA library Length = 630 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 394 gagtaaccccactcgttgtcgtacca 369
>emb|AL116690.1|CNS01DDM Botrytis cinerea strain T4 cDNA library Length = 480 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 303 gagtaaccccactcgttgtcgtacca 278
>emb|AL115961.1|CNS01CTD Botrytis cinerea strain T4 cDNA library Length = 420 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 216 gagtaaccccactcgttgtcgtacca 191
>emb|AL116558.1|CNS01D9Y Botrytis cinerea strain T4 cDNA library Length = 540 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 328 gagtaaccccactcgttgtcgtacca 303
>emb|AL116326.1|CNS01D3I Botrytis cinerea strain T4 cDNA library Length = 600 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 394 gagtaaccccactcgttgtcgtacca 369
>emb|AL115408.1|CNS01CE0 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 562 gagtaaccccactcgttgtcgtacca 537
>emb|AL115132.1|CNS01C6C Botrytis cinerea strain T4 cDNA library Length = 360 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 183 gagtaaccccactcgttgtcgtacca 158
>emb|AL114219.1|CNS01BGZ Botrytis cinerea strain T4 cDNA library Length = 720 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 600 gagtaaccccactcgttgtcgtacca 575
>emb|AL110743.1|CNS018SG Botrytis cinerea strain T4 cDNA library Length = 516 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 331 gagtaaccccactcgttgtcgtacca 306
>gb|AF339929.1|AF339929 Thanatephorus cucumeris glyceraldehyde-3-phosphate dehydrogenase (gpd) gene, complete cds Length = 2147 Score = 52.0 bits (26), Expect = 0.003 Identities = 26/26 (100%) Strand = Plus / Minus Query: 298 gagtaaccccactcgttgtcgtacca 323 |||||||||||||||||||||||||| Sbjct: 1801 gagtaaccccactcgttgtcgtacca 1776
>gb|AF260734.1|AF260734 Cucurbita pepo chloroplast NADP-dependent glyceraldehyde 3-phosphate dehydrogenase B subunit (GapB) mRNA, partial cds; nulcear gene for chloroplast product Length = 516 Score = 52.0 bits (26), Expect = 0.003 Identities = 50/58 (86%) Strand = Plus / Minus Query: 302 aaccccactcgttgtcgtaccatgcaatgaccttgaccatgtcgtctcccatgaccat 359 ||||||| || ||||| ||||| |||| |||||||| ||| ||||||||||| ||||| Sbjct: 516 aaccccaatcattgtcataccaagcaacgaccttgagcatatcgtctcccattaccat 459 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,174,943 Number of Sequences: 3902068 Number of extensions: 4174943 Number of successful extensions: 96430 Number of sequences better than 10.0: 593 Number of HSP's better than 10.0 without gapping: 598 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 84894 Number of HSP's gapped (non-prelim): 11493 length of query: 698 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 675 effective length of database: 17,143,297,704 effective search space: 11571725950200 effective search space used: 11571725950200 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
