ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags39p09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_472497.1| Oryza sativa (japonica cultivar-group), predic... 607 e-170
2dbj|AK102190.1| Oryza sativa (japonica cultivar-group) cDNA clon... 599 e-168
3dbj|AB054123.1| Oryza sativa (japonica cultivar-group) mRNA for ... 567 e-158
4gb|AY103548.1| Zea mays PCO091529 mRNA sequence 517 e-143
5gb|BT019280.1| Zea mays clone Contig953.F mRNA sequence 470 e-129
6ref|XM_466144.1| Oryza sativa (japonica cultivar-group), mRNA 448 e-122
7dbj|AK066564.1| Oryza sativa (japonica cultivar-group) cDNA clon... 448 e-122
8emb|AL606632.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 385 e-103
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 385 e-103
10ref|NM_189370.1| Oryza sativa (japonica cultivar-group), predic... 357 3e-95
11dbj|AK073846.1| Oryza sativa (japonica cultivar-group) cDNA clon... 349 8e-93
12gb|BT016501.1| Zea mays clone Contig334 mRNA sequence 283 4e-73
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 242 1e-60
14dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic D... 242 1e-60
15dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic D... 242 1e-60
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 228 2e-56
17dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic D... 228 2e-56
18gb|BT017535.1| Zea mays clone EL01N0422A10.c mRNA sequence 224 3e-55
19gb|DQ268860.1| Solanum tuberosum clone 178H07 40S ribosomal prot... 111 3e-21
20gb|DQ252484.1| Solanum tuberosum clone 048B07 40S ribosomal prot... 111 3e-21
21gb|DQ252521.1| Solanum tuberosum clone 111F10 40S ribosomal prot... 101 3e-18
22ref|NM_118706.2| Arabidopsis thaliana structural constituent of ... 76 2e-10
23ref|NM_001036641.1| Arabidopsis thaliana structural constituent ... 76 2e-10
24gb|AY113926.1| Arabidopsis thaliana putative ribosomal protein S... 76 2e-10
25gb|AY035172.1| Arabidopsis thaliana putative ribosomal protein S... 76 2e-10
26emb|AL161563.2|ATCHRIV63 Arabidopsis thaliana DNA chromosome 4, ... 76 2e-10
27emb|AL050400.1|ATL73G19 Arabidopsis thaliana DNA chromosome 4, c... 76 2e-10
28emb|AL049480.1|ATF14M19 Arabidopsis thaliana DNA chromosome 4, B... 76 2e-10
29gb|DQ226795.1| Boechera divaricarpa isolate SLW-B-C05 mRNA sequence 72 3e-09
30emb|AJ538899.1|NTA538899 Nicotiana tabacum cDNA-AFLP-fragment BT... 64 7e-07
31emb|CT025844.1| Medicago truncatula chromosome 5 clone mte1-41h1... 62 3e-06
32gb|DQ066194.1| Ixodes scapularis isolate ISUFL81 40S ribosomal p... 60 1e-05
33gb|AY961467.1| Phytophthora infestans clone MY-06-E-07 ribosomal... 56 2e-04
34ref|NM_124643.2| Arabidopsis thaliana structural constituent of ... 50 0.010
35gb|AY122932.1| Arabidopsis thaliana unknown protein (At5g52650) ... 50 0.010
36gb|AY065217.1| Arabidopsis thaliana unknown protein (At5g52650) ... 50 0.010
37emb|BX830280.1|CNS0A19J Arabidopsis thaliana Full-length cDNA Co... 50 0.010
38emb|BX830062.1|CNS0A1D6 Arabidopsis thaliana Full-length cDNA Co... 50 0.010
39gb|AY088678.1| Arabidopsis thaliana clone 91769 mRNA, complete s... 50 0.010
40ref|NM_123516.2| Arabidopsis thaliana structural constituent of ... 48 0.040
41gb|AF375440.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, comp... 48 0.040
42gb|AY060539.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, comp... 48 0.040
43gb|AY037240.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, comp... 48 0.040
44emb|BX830030.1|CNS0A1DV Arabidopsis thaliana Full-length cDNA Co... 48 0.040
45emb|BX832280.1|CNS0A13B Arabidopsis thaliana Full-length cDNA Co... 48 0.040
46dbj|AB005233.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 48 0.040
47emb|AJ538646.1|NTA538646 Nicotiana tabacum cDNA-AFLP-fragment BC... 46 0.16
48emb|AJ538565.1|NTA538565 Nicotiana tabacum cDNA-AFLP-fragment BC... 46 0.16
49dbj|D88764.1| Rana catesbeiana mRNA for alpha 2 type I collagen,... 46 0.16
50gb|AY070896.1| Drosophila melanogaster LP04958 full insert cDNA 44 0.62
51ref|NM_167668.1| Drosophila melanogaster Ribosomal protein S10b ... 44 0.62
52ref|NM_134480.2| Drosophila melanogaster Ribosomal protein S10b ... 44 0.62
53dbj|AK045503.1| Mus musculus adult male corpora quadrigemina cDN... 44 0.62
54gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, r... 44 0.62
55dbj|AB025606.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.62
56gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 44 0.62
57emb|CR376839.12| Zebrafish DNA sequence from clone DKEY-75G22 in... 42 2.4
58gb|AC105075.6| Mus musculus chromosome 1, clone RP23-366P11, com... 42 2.4
59emb|AL627248.7| Zebrafish DNA sequence from clone RP71-1G18 in l... 42 2.4
60emb|BX829499.1|CNS0A1BF Arabidopsis thaliana Full-length cDNA Co... 42 2.4
61dbj|AB049721.2| Pisum sativum ssa-11 mRNA for putative senescenc... 42 2.4
62gb|BC101918.1| Rattus norvegicus cytochrome P450, family 4, subf... 42 2.4
63ref|NM_001033686.1| Rattus norvegicus cytochrome P450, family 4,... 42 2.4
64emb|AL845366.6| Zebrafish DNA sequence from clone CH211-167C22 i... 42 2.4
65gb|AC154142.24| Mus musculus chromosome 1, clone RP23-187M7, com... 42 2.4
66gb|BC081808.1| Rattus norvegicus cytochrome P450, family 4, subf... 40 9.7
67ref|XM_521903.1| PREDICTED: Pan troglodytes cholinergic receptor... 40 9.7
68gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 9.7
69gb|AE017130.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 9.7
70ref|XM_322656.1| Neurospora crassa OR74A predicted protein (NCU0... 40 9.7
71ref|XM_951753.1| Neurospora crassa OR74A hypothetical protein (N... 40 9.7
72ref|NM_000741.2| Homo sapiens cholinergic receptor, muscarinic 4... 40 9.7
73emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 9.7
74ref|XM_567314.1| Cryptococcus neoformans var. neoformans JEC21 A... 40 9.7
75gb|AC090681.13| Homo sapiens 12 BAC RP11-369C14 (Roswell Park Ca... 40 9.7
76emb|CR974458.2| Pig DNA sequence from clone CH242-29M17 on chrom... 40 9.7
77gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 9.7
78gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 9.7
79emb|AL356501.6| Human DNA sequence from clone RP5-1159G19 on chr... 40 9.7
80emb|CR788255.6| Zebrafish DNA sequence from clone DKEY-9C18 in l... 40 9.7
81gb|AC123178.4| Rattus norvegicus 7 BAC CH230-20I17 (Children's H... 40 9.7
82emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 9.7
83emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II B... 40 9.7
84emb|AJ414146.1| Yersinia pestis strain CO92 complete genome; seg... 40 9.7
85gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, co... 40 9.7
86emb|BX469889.7| Zebrafish DNA sequence from clone DKEY-156P3 in ... 40 9.7
87gb|AC117467.3| Homo sapiens 3 BAC RP11-669C7 (Roswell Park Cance... 40 9.7
88gb|AC116021.5| Homo sapiens chromosome 11, clone CTD-2589M5, com... 40 9.7
89gb|AF498918.1| Homo sapiens muscarinic acetylcholine receptor M4... 40 9.7
90dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple... 40 9.7
91gb|AC079789.7| Homo sapiens BAC clone RP11-475B2 from 4, complet... 40 9.7
92gb|AC073917.19| Homo sapiens 12q BAC RP11-415D21 (Roswell Park C... 40 9.7
93gb|BC102416.1| Bos taurus similar to 40S ribosomal protein S10, ... 40 9.7
94gb|AC024293.18| Homo sapiens chromosome 11, clone RP11-425L10, c... 40 9.7
95gb|AF385590.1|AF385590 Homo sapiens m4 muscarinic cholinergic re... 40 9.7
96gb|AC008102.18| Homo sapiens chromosome 11 clone bac41i21 map 11... 40 9.7
97gb|BC095546.1| Homo sapiens cholinergic receptor, muscarinic 4, ... 40 9.7
98gb|AC073532.18|AC073532 Homo sapiens 12 BAC RP11-150F20 (Roswell... 40 9.7
99dbj|AP003516.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.7
100gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 9.7
101ref|XM_578642.1| PREDICTED: Rattus norvegicus similar to Cyp4f15... 40 9.7
102gb|M16405.2|HUMACHRM4 Homo sapiens muscarinic acetylcholine rece... 40 9.7
103emb|BX470166.11| Zebrafish DNA sequence from clone CH211-238N5 i... 40 9.7
104gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cance... 40 9.7
105dbj|AP000822.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.7
106dbj|AB098806.1| Bos taurus mRNA for similar to ribosomal protein... 40 9.7
107ref|NM_019623.2| Rattus norvegicus cytochrome P450, family 4, su... 40 9.7
108gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 9.7
109dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 9.7
110ref|NM_001034716.1| Bos taurus similar to 40S ribosomal protein ... 40 9.7
111emb|AL929314.9| Zebrafish DNA sequence from clone CH211-155E19 i... 40 9.7
112gb|AC138221.23| Mus musculus chromosome 15, clone RP23-204C16, c... 40 9.7
113emb|X15265.1|HSACM4 Homo sapiens gene for muscarinic acetylcholi... 40 9.7
114dbj|AB065585.1| Homo sapiens gene for seven transmembrane helix ... 40 9.7

>ref|XM_472497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 552

 Score =  607 bits (306), Expect = e-170
 Identities = 438/482 (90%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacca 254
           |||||||||||||| || ||||||||||| || ||||||||||| || ||||||||||||
Sbjct: 482 ccaccagagctcctaaaggatggctggaactcagcaggagctccacccttctcaccacca 423

                                                                       
Query: 255 aagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggc 314
           ||||||||||| |||||||||||||| |||||||| ||||| ||||| ||| | ||||||
Sbjct: 422 aagtcaccaggagcaccacgaggaccaccacggtacccatctctgtcaccaaaccttggc 363

                                                                       
Query: 315 ctgtcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagt 374
           ||||| || ||||| ||||| || ||||| ||||| || ||||||||||||||||| | |
Sbjct: 362 ctgtccccttcaaagcgaggcgggccccttgggcggtcgccaggtgggccagaaccaaat 303

                                                                       
Query: 375 gggcggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcagg 434
           ||||||||||| ||||||||||| || ||||| |||||||||||||||||||| ||||||
Sbjct: 302 gggcggccaggtggcctggcagacttcttgagtgtggcaggcacaatctcagatggcagg 243

                                                                       
Query: 435 ttgaggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgc 494
           || ||| |||||||||||  ||||||||||||||||||||||||||| ||||| | ||||
Sbjct: 242 ttaaggtagttgcgcaggtgctcaatgccatcgttggtgaggtaccagtagtagtactgc 183

                                                                       
Query: 495 cacgagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacc 554
           || |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 182 caggagaaggtctccctgacgtactccttggacttgaagctctgcatgagcttgatcacc 123

                                                                       
Query: 555 tggaggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatac 614
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 122 tgcaggttcggcacatcgatctgcgggtgcttcgccaggttgtagtccttcttggcatac 63

                                                                       
Query: 615 agcaccccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
           ||||| ||||||||||||||||||||||| |||||||||||||||||||| | |||||||
Sbjct: 62  agcactccctcttggaagaggtacttgcagatctcattgcggttcttcttcgggatgatc 3

             
Query: 675 at 676
           ||
Sbjct: 2   at 1



to top

>dbj|AK102190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087A06, full
           insert sequence
          Length = 902

 Score =  599 bits (302), Expect = e-168
 Identities = 437/482 (90%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacca 254
           |||||||||||||| || ||||||||||| || ||||||||||| || ||||||||||||
Sbjct: 575 ccaccagagctcctaaaggatggctggaactcagcaggagctccacccttctcaccacca 516

                                                                       
Query: 255 aagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggc 314
           ||||||||||| |||||||||||||| |||||||| ||||| ||||| ||| | ||||||
Sbjct: 515 aagtcaccaggagcaccacgaggaccaccacggtacccatctctgtcaccaaaccttggc 456

                                                                       
Query: 315 ctgtcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagt 374
           ||||| || ||||| ||||| || ||||| ||||| || ||||||||||||||||| | |
Sbjct: 455 ctgtccccttcaaagcgaggcgggccccttgggcggtcgccaggtgggccagaaccaaat 396

                                                                       
Query: 375 gggcggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcagg 434
           ||||||||||| ||||||||||| || | ||| |||||||||||||||||||| ||||||
Sbjct: 395 gggcggccaggtggcctggcagacttctcgagtgtggcaggcacaatctcagatggcagg 336

                                                                       
Query: 435 ttgaggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgc 494
           || ||| |||||||||||  ||||||||||||||||||||||||||| ||||| | ||||
Sbjct: 335 ttaaggtagttgcgcaggtgctcaatgccatcgttggtgaggtaccagtagtagtactgc 276

                                                                       
Query: 495 cacgagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacc 554
           || |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 275 caggagaaggtctccctgacgtactccttggacttgaagctctgcatgagcttgatcacc 216

                                                                       
Query: 555 tggaggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatac 614
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tgcaggttcggcacatcgatctgcgggtgcttcgccaggttgtagtccttcttggcatac 156

                                                                       
Query: 615 agcaccccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
           ||||| ||||||||||||||||||||||| |||||||||||||||||||| | |||||||
Sbjct: 155 agcactccctcttggaagaggtacttgcagatctcattgcggttcttcttcgggatgatc 96

             
Query: 675 at 676
           ||
Sbjct: 95  at 94



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                 
Query: 78  aaaacatcacatccaaactacgaggaagttcactccat 115
           ||||||||| |||||||||||| |||||||||||||||
Sbjct: 673 aaaacatcatatccaaactacg-ggaagttcactccat 637



to top

>dbj|AB054123.1| Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein
           S10, complete cds
          Length = 756

 Score =  567 bits (286), Expect = e-158
 Identities = 433/482 (89%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacca 254
           |||||||||||||| || ||||| ||||| || ||||||||||| || ||||||||||||
Sbjct: 573 ccaccagagctcctaaaggatggttggaactcagcaggagctccacccttctcaccacca 514

                                                                       
Query: 255 aagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggc 314
           ||||||||||| |||||||||||||| |||||||| ||||| ||||| ||| | ||||||
Sbjct: 513 aagtcaccaggagcaccacgaggaccaccacggtacccatctctgtcaccaaaccttggc 454

                                                                       
Query: 315 ctgtcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagt 374
           ||||| || ||||| ||||| || ||||| || || || ||||||||||||||||| | |
Sbjct: 453 ctgtccccttcaaagcgaggcgggccccttggacggtcgccaggtgggccagaaccaaat 394

                                                                       
Query: 375 gggcggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcagg 434
           ||||| ||||| ||||||||||| || ||||| |||||||||||||||||||| ||||||
Sbjct: 393 gggcgaccaggtggcctggcagacttcttgagtgtggcaggcacaatctcagatggcagg 334

                                                                       
Query: 435 ttgaggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgc 494
           || ||| ||||| |||||  ||||||||||||||||||||||||||| ||||| | ||||
Sbjct: 333 ttaaggtagttgagcaggtgctcaatgccatcgttggtgaggtaccagtagtagtactgc 274

                                                                       
Query: 495 cacgagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacc 554
           || |||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||
Sbjct: 273 caggagaaggtctccctgacgtactccttggacttgaagctctgcatgaacttgatcacc 214

                                                                       
Query: 555 tggaggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatac 614
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 tgcaggttcggcacatcgatctgcgggtgcttcgccaggttgtagtccttcttggcatac 154

                                                                       
Query: 615 agcaccccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
           ||||| ||||||||||||||||||||||| |||||||||||||||||||| | |||||||
Sbjct: 153 agcactccctcttggaagaggtacttgcagatctcattgcggttcttcttcgggatgatc 94

             
Query: 675 at 676
           ||
Sbjct: 93  at 92



to top

>gb|AY103548.1| Zea mays PCO091529 mRNA sequence
          Length = 1541

 Score =  517 bits (261), Expect = e-143
 Identities = 420/473 (88%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcacca 263
           |||||||||||||||||||| || ||||||||||| |  || || |||||||||||||||
Sbjct: 719 ctcctgaatgatggctggaactcagcaggagctccactcttatcgccaccaaagtcacca 660

                                                                       
Query: 264 ggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccc 323
           || |||||||||||||| ||||||||  |||||||||| ||| | ||||||||||| || 
Sbjct: 659 ggagcaccacgaggaccaccacggtactcatccctgtcaccaaaccttggcctgtcgccg 600

                                                                       
Query: 324 tcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagtgggcggcca 383
           |||||||||  ||| ||||| ||||| |||||||| |||||||| || | ||||||||||
Sbjct: 599 tcaaaacgacctgggccccttgggcggtcaccaggagggccagagccaaatgggcggcca 540

                                                                       
Query: 384 ggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcaggttgaggaag 443
           || ||| ||||||| || ||||||||||||||||| ||||||||||| ||||| ||| ||
Sbjct: 539 ggtggcttggcagacttcttgagcgtggcaggcacgatctcagacgggaggttcaggtag 480

                                                                       
Query: 444 ttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaag 503
           ||||| |||  ||||||||||||||||||||| ||||| ||||| | |||||| ||||||
Sbjct: 479 ttgcgtaggtgctcaatgccatcgttggtgagataccagtagtagtactgccaggagaag 420

                                                                       
Query: 504 gtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacctggaggttc 563
           |||||||| || || ||||| ||||| |||||||||||||||||||||||||||||||| 
Sbjct: 419 gtctccctaacatactccttggacttaaagctctgcatgagcttgatcacctggaggttg 360

                                                                       
Query: 564 ggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccc 623
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 359 ggcacatcgatctgcgggtgcttcgccaggttgtagtccttcttggcatacagcacgccc 300

                                                                
Query: 624 tcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatcat 676
           || | ||||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 299 tccttgaagaggtacttgcagatctcattgcggttcttcttggggatgatcat 247



 Score =  250 bits (126), Expect = 5e-63
 Identities = 156/166 (93%)
 Strand = Plus / Minus

                                                                       
Query: 455 ctcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgac 514
           ||||||||||||||||||||||||||| ||||| | |||||| ||||||||||| |||||
Sbjct: 181 ctcaatgccatcgttggtgaggtaccagtagtagtactgccaggagaaggtctctctgac 122

                                                                       
Query: 515 gtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaat 574
            || ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 121 atactccttggacttgaagctctgcatgagcttgatcacctggaggttgggcacatcaat 62

                                                         
Query: 575 ctgcgggtgcttcgccaggttgtagtccttcttggcatacagcacc 620
           ||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctgtgggtgcttcgccaggttgtagtccttcttggcatacagcacc 16



to top

>gb|BT019280.1| Zea mays clone Contig953.F mRNA sequence
          Length = 872

 Score =  470 bits (237), Expect = e-129
 Identities = 419/479 (87%), Gaps = 3/479 (0%)
 Strand = Plus / Plus

                                                                       
Query: 198 ccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaag 257
           ||||| |||||||| ||||||||||| || ||||||||||| |  || || ||||| |||
Sbjct: 317 ccagaactcctgaaagatggctggaactcagcaggagctccactcttatcgccaccgaag 376

                                                                       
Query: 258 tcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctg 317
           |||||||| |||||||||||||| ||||||||  |||||||||| ||| | ||||| |||
Sbjct: 377 tcaccaggagcaccacgaggaccaccacggtactcatccctgtctccaaaccttggtctg 436

                                                                       
Query: 318 tcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagtggg 377
           ||    |||||||||   || ||||| ||||| |||||||| |||||||| || | ||| 
Sbjct: 437 tct---tcaaaacgaccagggccccttgggcggtcaccaggagggccagagccaaatgga 493

                                                                       
Query: 378 cggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcaggttg 437
           |||||  | ||||||||||| || ||||||||||||||||| ||||||||||| ||||| 
Sbjct: 494 cggcccagtggcctggcagacttcttgagcgtggcaggcacgatctcagacgggaggttc 553

                                                                       
Query: 438 aggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccac 497
           ||| ||||||| |||  ||||||||||||||||||||||||||| ||||| | |||||| 
Sbjct: 554 aggtagttgcgtaggtgctcaatgccatcgttggtgaggtaccagtagtagtactgccag 613

                                                                       
Query: 498 gagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacctgg 557
           ||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 614 gagaaggtctctctgacatactccttggacttgaagctctgcatgagcttgatcacctgg 673

                                                                       
Query: 558 aggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatacagc 617
           ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 674 aggttgggcacatcaatctgtgggtgcttcgccaggttgtagtccttcttggcatacagc 733

                                                                      
Query: 618 accccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatcat 676
           || ||||| | ||||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 734 acgccctccttgaagaggtacttgcagatctcattgcggttcttcttggggatgatcat 792



to top

>ref|XM_466144.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 853

 Score =  448 bits (226), Expect = e-122
 Identities = 418/482 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacca 254
           |||||||| |||||||||||||||||||| ||||||||||| || || ||||||||||||
Sbjct: 562 ccaccagaactcctgaatgatggctggaattctgcaggagcaccacccttctcaccacca 503

                                                                       
Query: 255 aagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggc 314
           || |||||||| ||||||||||| || |||||||| ||||||| ||| ||| | ||||| 
Sbjct: 502 aaatcaccaggcgcaccacgaggtccaccacggtagccatcccggtctccaaaccttggt 443

                                                                       
Query: 315 ctgtcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagt 374
           ||||| || || || |||||||| ||||| |||||||||||||| |||||||| || | |
Sbjct: 442 ctgtccccttcgaaccgaggtgggccccttgggcgatcaccaggggggccagagccaaat 383

                                                                       
Query: 375 gggcggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcagg 434
           |||||||| || ||||| ||||| || ||||| || ||||| |||||||||||||||| |
Sbjct: 382 gggcggcctggtggccttgcagacttcttgagtgtagcaggtacaatctcagacggcaag 323

                                                                       
Query: 435 ttgaggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgc 494
           || ||| | || | ||||  |||||||||||| || ||||||||||| ||||| | ||||
Sbjct: 322 ttaaggtaattcctcaggtgctcaatgccatcattagtgaggtaccagtagtagtactgc 263

                                                                       
Query: 495 cacgagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacc 554
           || ||||||||||||||||| || ||||| |||||||||||||||||||||||||| |||
Sbjct: 262 caggagaaggtctccctgacatactccttggacttgaagctctgcatgagcttgatgacc 203

                                                                       
Query: 555 tggaggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatac 614
           || ||||| |||||||||||||| ||||| || ||||  ||||||||||||||||| |||
Sbjct: 202 tgaaggtttggcacatcaatctgtgggtgttttgccaaattgtagtccttcttggcgtac 143

                                                                       
Query: 615 agcaccccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
           |  |||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||
Sbjct: 142 aaaaccccctcttggaagaggtacttgcagatctcattccggttcttcttggggatgatc 83

             
Query: 675 at 676
           ||
Sbjct: 82  at 81



to top

>dbj|AK066564.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013073I17, full
           insert sequence
          Length = 853

 Score =  448 bits (226), Expect = e-122
 Identities = 418/482 (86%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacca 254
           |||||||| |||||||||||||||||||| ||||||||||| || || ||||||||||||
Sbjct: 562 ccaccagaactcctgaatgatggctggaattctgcaggagcaccacccttctcaccacca 503

                                                                       
Query: 255 aagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggc 314
           || |||||||| ||||||||||| || |||||||| ||||||| ||| ||| | ||||| 
Sbjct: 502 aaatcaccaggcgcaccacgaggtccaccacggtagccatcccggtctccaaaccttggt 443

                                                                       
Query: 315 ctgtcaccctcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagt 374
           ||||| || || || |||||||| ||||| |||||||||||||| |||||||| || | |
Sbjct: 442 ctgtccccttcgaaccgaggtgggccccttgggcgatcaccaggggggccagagccaaat 383

                                                                       
Query: 375 gggcggccaggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcagg 434
           |||||||| || ||||| ||||| || ||||| || ||||| |||||||||||||||| |
Sbjct: 382 gggcggcctggtggccttgcagacttcttgagtgtagcaggtacaatctcagacggcaag 323

                                                                       
Query: 435 ttgaggaagttgcgcaggaactcaatgccatcgttggtgaggtaccaatagtaatgctgc 494
           || ||| | || | ||||  |||||||||||| || ||||||||||| ||||| | ||||
Sbjct: 322 ttaaggtaattcctcaggtgctcaatgccatcattagtgaggtaccagtagtagtactgc 263

                                                                       
Query: 495 cacgagaaggtctccctgacgtattccttagacttgaagctctgcatgagcttgatcacc 554
           || ||||||||||||||||| || ||||| |||||||||||||||||||||||||| |||
Sbjct: 262 caggagaaggtctccctgacatactccttggacttgaagctctgcatgagcttgatgacc 203

                                                                       
Query: 555 tggaggttcggcacatcaatctgcgggtgcttcgccaggttgtagtccttcttggcatac 614
           || ||||| |||||||||||||| ||||| || ||||  ||||||||||||||||| |||
Sbjct: 202 tgaaggtttggcacatcaatctgtgggtgttttgccaaattgtagtccttcttggcgtac 143

                                                                       
Query: 615 agcaccccctcttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
           |  |||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||
Sbjct: 142 aaaaccccctcttggaagaggtacttgcagatctcattccggttcttcttggggatgatc 83

             
Query: 675 at 676
           ||
Sbjct: 82  at 81



to top

>emb|AL606632.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16,
              complete sequence
          Length = 163738

 Score =  385 bits (194), Expect = e-103
 Identities = 260/282 (92%)
 Strand = Plus / Minus

                                                                          
Query: 345    gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
              ||||| || ||||||||||||||||| | |||||||||||| ||||||||||| || |||
Sbjct: 152441 gggcggtcgccaggtgggccagaaccaaatgggcggccaggtggcctggcagacttcttg 152382

                                                                          
Query: 405    agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
              || |||||||||||||||||||| |||||||| ||| |||||||||||  ||||||||||
Sbjct: 152381 agtgtggcaggcacaatctcagatggcaggttaaggtagttgcgcaggtgctcaatgcca 152322

                                                                          
Query: 465    tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
              ||||||||||||||||| ||||| | |||||| |||||||||||||||||||| ||||| 
Sbjct: 152321 tcgttggtgaggtaccagtagtagtactgccaggagaaggtctccctgacgtactccttg 152262

                                                                          
Query: 525    gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
              |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 152261 gacttgaagctctgcatgagcttgatcacctgcaggttcggcacatcgatctgcgggtgc 152202

                                                        
Query: 585    ttcgccaggttgtagtccttcttggcatacagcaccccctct 626
              ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 152201 ttcgccaggttgtagtccttcttggcatacagcactccctct 152160



 Score =  133 bits (67), Expect = 9e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                          
Query: 213    gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
              ||||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||
Sbjct: 153172 gatggctggaactcagcaggagctccacccttctcaccaccaaagtcaccaggagcacca 153113

                                                                          
Query: 273    cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
              |||||||| |||||||| ||||| ||||| ||| | ||||||||||| || ||||| |||
Sbjct: 153112 cgaggaccaccacggtacccatctctgtcaccaaaccttggcctgtccccttcaaagcga 153053

                         
Query: 333    ggtggccccct 343
              || || |||||
Sbjct: 153052 ggcgggcccct 153042



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 625    cttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
              ||||||||||||||||||| |||||||||||||||||||| | |||||||
Sbjct: 151714 cttggaagaggtacttgcagatctcattgcggttcttcttcgggatgatc 151665



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                    
Query: 78     aaaacatcacatccaaactacgaggaagttcactccat 115
              ||||||||| |||||||||||| |||||||||||||||
Sbjct: 153789 aaaacatcatatccaaactacg-ggaagttcactccat 153753



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  385 bits (194), Expect = e-103
 Identities = 260/282 (92%)
 Strand = Plus / Minus

                                                                            
Query: 345      gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
                ||||| || ||||||||||||||||| | |||||||||||| ||||||||||| || |||
Sbjct: 21338967 gggcggtcgccaggtgggccagaaccaaatgggcggccaggtggcctggcagacttcttg 21338908

                                                                            
Query: 405      agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
                || |||||||||||||||||||| |||||||| ||| |||||||||||  ||||||||||
Sbjct: 21338907 agtgtggcaggcacaatctcagatggcaggttaaggtagttgcgcaggtgctcaatgcca 21338848

                                                                            
Query: 465      tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
                ||||||||||||||||| ||||| | |||||| |||||||||||||||||||| ||||| 
Sbjct: 21338847 tcgttggtgaggtaccagtagtagtactgccaggagaaggtctccctgacgtactccttg 21338788

                                                                            
Query: 525      gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
                |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 21338787 gacttgaagctctgcatgagcttgatcacctgcaggttcggcacatcgatctgcgggtgc 21338728

                                                          
Query: 585      ttcgccaggttgtagtccttcttggcatacagcaccccctct 626
                ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 21338727 ttcgccaggttgtagtccttcttggcatacagcactccctct 21338686



 Score =  133 bits (67), Expect = 9e-28
 Identities = 115/131 (87%)
 Strand = Plus / Minus

                                                                            
Query: 213      gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
                ||||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||
Sbjct: 21339698 gatggctggaactcagcaggagctccacccttctcaccaccaaagtcaccaggagcacca 21339639

                                                                            
Query: 273      cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
                |||||||| |||||||| ||||| ||||| ||| | ||||||||||| || ||||| |||
Sbjct: 21339638 cgaggaccaccacggtacccatctctgtcaccaaaccttggcctgtccccttcaaagcga 21339579

                           
Query: 333      ggtggccccct 343
                || || |||||
Sbjct: 21339578 ggcgggcccct 21339568



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                  
Query: 625      cttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
                ||||||||||||||||||| |||||||||||||||||||| | |||||||
Sbjct: 21338240 cttggaagaggtacttgcagatctcattgcggttcttcttcgggatgatc 21338191



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                      
Query: 78       aaaacatcacatccaaactacgaggaagttcactccat 115
                ||||||||| |||||||||||| |||||||||||||||
Sbjct: 21340315 aaaacatcatatccaaactacg-ggaagttcactccat 21340279



to top

>ref|NM_189370.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 540

 Score =  357 bits (180), Expect = 3e-95
 Identities = 393/464 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
           ||||||||||| || || ||||| || || ||||| |||||||| ||||| || ||||||
Sbjct: 464 gatggctggaactcagctggagcaccacccttctcgccaccaaaatcacctggagcacca 405

                                                                       
Query: 273 cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
           || || || || | ||||||||||||||| ||| | || ||||||||||||||||| |||
Sbjct: 404 cgtgggccacccctgtaaccatccctgtcaccaaacctgggcctgtcaccctcaaagcga 345

                                                                       
Query: 333 ggtggccccctcgggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctg 392
           || || || || ||||| |||||||| |||||||| |||| ||||||    || ||| ||
Sbjct: 344 ggcgggcctctggggcggtcaccaggagggccagagccgaatgggcgagacgggggcttg 285

                                                                       
Query: 393 gcagattttttgagcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcagg 452
           ||||| || ||||| |||  |||||||| |||||| |||||||||||| || |||| |||
Sbjct: 284 gcagacttcttgagggtgttaggcacaacctcagatggcaggttgaggtagctgcggagg 225

                                                                       
Query: 453 aactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctg 512
             |||||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||| 
Sbjct: 224 tgctcaatgccatcattggtcaggtaccagtagtagtgctgccacgagaaggtctccctc 165

                                                                       
Query: 513 acgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcacatca 572
           || || ||||| ||||||||||||||||||||||| |||||||  | ||| |||||||||
Sbjct: 164 acatactcctttgacttgaagctctgcatgagcttaatcacctccaagttgggcacatca 105

                                                                       
Query: 573 atctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccctcttggaag 632
           | ||  |||||||| ||||||||||||||||||||||||||||  || ||||| ||||||
Sbjct: 104 acctttgggtgcttggccaggttgtagtccttcttggcatacaagactccctcatggaag 45

                                                       
Query: 633 aggtacttgcaaatctcattgcggttcttcttggagatgatcat 676
           ||||||||||| |||||   ||||||||||||||||||||||||
Sbjct: 44  aggtacttgcagatctcgcggcggttcttcttggagatgatcat 1



to top

>dbj|AK073846.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070I05, full
           insert sequence
          Length = 900

 Score =  349 bits (176), Expect = 8e-93
 Identities = 392/464 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
           ||||||||||| || || ||||| || || ||||| |||||||| ||||| || ||||||
Sbjct: 552 gatggctggaactcagctggagcaccacccttctcgccaccaaaatcacctggagcacca 493

                                                                       
Query: 273 cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
           || || || || | ||||||||||||||| ||| | || ||||||||||||||||| |||
Sbjct: 492 cgtgggccacccctgtaaccatccctgtcaccaaacctgggcctgtcaccctcaaagcga 433

                                                                       
Query: 333 ggtggccccctcgggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctg 392
           || || || || ||||| |||||||| |||||||| |||| ||||||    || ||| ||
Sbjct: 432 ggcgggcctctggggcggtcaccaggagggccagagccgaatgggcgagacgggggcttg 373

                                                                       
Query: 393 gcagattttttgagcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcagg 452
           ||||| || ||||| |||  |||||||| |||||| |||||||||||| || |||| |||
Sbjct: 372 gcagacttcttgagggtgttaggcacaacctcagatggcaggttgaggtagctgcggagg 313

                                                                       
Query: 453 aactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctg 512
             |||||||||||| ||||| |||||||| ||||| ||||||||||||||||||||||| 
Sbjct: 312 tgctcaatgccatcattggtcaggtaccagtagtagtgctgccacgagaaggtctccctc 253

                                                                       
Query: 513 acgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcacatca 572
           || || ||||| ||||||||||||||||||||||| |||||||  | ||| |||||||||
Sbjct: 252 acatactcctttgacttgaagctctgcatgagcttaatcacctccaagttgggcacatca 193

                                                                       
Query: 573 atctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccctcttggaag 632
           | ||  |||||||| ||||||||||||||||||||||||||||  || ||||| ||||||
Sbjct: 192 acctttgggtgcttggccaggttgtagtccttcttggcatacaagactccctcatggaag 133

                                                       
Query: 633 aggtacttgcaaatctcattgcggttcttcttggagatgatcat 676
           ||||||||||| |||||   ||||||||||||| ||||||||||
Sbjct: 132 aggtacttgcagatctcgcggcggttcttcttgcagatgatcat 89



to top

>gb|BT016501.1| Zea mays clone Contig334 mRNA sequence
          Length = 841

 Score =  283 bits (143), Expect = 4e-73
 Identities = 233/263 (88%)
 Strand = Plus / Minus

                                                                       
Query: 414 ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
           ||||||| ||| |||||||||||||||||| |||| |||  |||||||||||||||||||
Sbjct: 326 ggcacaacctctgacggcaggttgaggaagctgcggaggtgctcaatgccatcgttggtg 267

                                                                       
Query: 474 aggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaag 533
           |||||||| ||||| | |||||| ||||||||||||||||| || ||||| |||||||||
Sbjct: 266 aggtaccagtagtagtactgccaggagaaggtctccctgacatactccttggacttgaag 207

                                                                       
Query: 534 ctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccagg 593
           |||||||||||||| |||||||  ||||| ||||| |||| ||  |||||||| ||||||
Sbjct: 206 ctctgcatgagcttaatcacctccaggttgggcacgtcaagcttggggtgcttggccagg 147

                                                                       
Query: 594 ttgtagtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattg 653
           |||||||||||||||||||| || |||||||| ||||||| ||||||||| |||||   |
Sbjct: 146 ttgtagtccttcttggcatatagaaccccctcatggaagatgtacttgcagatctcgcgg 87

                                  
Query: 654 cggttcttcttggagatgatcat 676
           |||||||||||||||||||||||
Sbjct: 86  cggttcttcttggagatgatcat 64



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 125/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 213 gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
           ||||||||||| || |||||||| |  || |||||||||||||| |||||   |||||| 
Sbjct: 527 gatggctggaaatccgcaggagcactacccttctcaccaccaaaatcacccattgcacct 468

                                                                       
Query: 273 cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
           || ||||| || | |||||||||||| || ||| | || || |||||  || |||| |||
Sbjct: 467 cgtggacctcctctgtaaccatccctatccccaaacctaggtctgtcttccccaaagcga 408

                                              
Query: 333 ggtggccccctcgggcgatcaccaggtgggccaga 367
           || || ||||| ||||| ||||| |||||||||||
Sbjct: 407 gggggacccctggggcggtcacccggtgggccaga 373



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  242 bits (122), Expect = 1e-60
 Identities = 242/282 (85%)
 Strand = Plus / Minus

                                                                            
Query: 345      gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
                |||||||||||||| |||||||| || | ||||||||| || ||||| ||||| || |||
Sbjct: 20669959 gggcgatcaccaggggggccagagccaaatgggcggcctggtggccttgcagacttcttg 20669900

                                                                            
Query: 405      agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
                || || ||||| |||||||||||||||| ||| ||| | || | ||||  ||||||||||
Sbjct: 20669899 agtgtagcaggtacaatctcagacggcaagttaaggtaattcctcaggtgctcaatgcca 20669840

                                                                            
Query: 465      tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
                || || ||||||||||| ||||| | |||||| ||||||||||||||||| || ||||| 
Sbjct: 20669839 tcattagtgaggtaccagtagtagtactgccaggagaaggtctccctgacatactccttg 20669780

                                                                            
Query: 525      gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
                |||||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||| 
Sbjct: 20669779 gacttgaagctctgcatgagcttgatgacctgaaggtttggcacatcaatctgtgggtgt 20669720

                                                          
Query: 585      ttcgccaggttgtagtccttcttggcatacagcaccccctct 626
                || ||||  ||||||||||||||||| ||||  |||||||||
Sbjct: 20669719 tttgccaaattgtagtccttcttggcgtacaaaaccccctct 20669678



 Score =  123 bits (62), Expect = 8e-25
 Identities = 119/138 (86%)
 Strand = Plus / Minus

                                                                            
Query: 206      cctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccagg 265
                |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 20670661 cctgaatgatggctggaattctgcaggagcaccacccttctcaccaccaaaatcaccagg 20670602

                                                                            
Query: 266      tgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctc 325
                 ||||||||||| || |||||||| ||||||| ||| ||| | ||||| ||||| || ||
Sbjct: 20670601 cgcaccacgaggtccaccacggtagccatcccggtctccaaaccttggtctgtccccttc 20670542

                                  
Query: 326      aaaacgaggtggccccct 343
                 || |||||||| |||||
Sbjct: 20670541 gaaccgaggtgggcccct 20670524



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                  
Query: 625      cttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
                ||||||||||||||||||| |||||||| ||||||||||||| |||||||
Sbjct: 20669198 cttggaagaggtacttgcagatctcattccggttcttcttggggatgatc 20669149



to top

>dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0451A10
          Length = 137046

 Score =  242 bits (122), Expect = 1e-60
 Identities = 242/282 (85%)
 Strand = Plus / Minus

                                                                         
Query: 345   gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
             |||||||||||||| |||||||| || | ||||||||| || ||||| ||||| || |||
Sbjct: 21065 gggcgatcaccaggggggccagagccaaatgggcggcctggtggccttgcagacttcttg 21006

                                                                         
Query: 405   agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
             || || ||||| |||||||||||||||| ||| ||| | || | ||||  ||||||||||
Sbjct: 21005 agtgtagcaggtacaatctcagacggcaagttaaggtaattcctcaggtgctcaatgcca 20946

                                                                         
Query: 465   tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
             || || ||||||||||| ||||| | |||||| ||||||||||||||||| || ||||| 
Sbjct: 20945 tcattagtgaggtaccagtagtagtactgccaggagaaggtctccctgacatactccttg 20886

                                                                         
Query: 525   gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
             |||||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||| 
Sbjct: 20885 gacttgaagctctgcatgagcttgatgacctgaaggtttggcacatcaatctgtgggtgt 20826

                                                       
Query: 585   ttcgccaggttgtagtccttcttggcatacagcaccccctct 626
             || ||||  ||||||||||||||||| ||||  |||||||||
Sbjct: 20825 tttgccaaattgtagtccttcttggcgtacaaaaccccctct 20784



 Score =  123 bits (62), Expect = 8e-25
 Identities = 119/138 (86%)
 Strand = Plus / Minus

                                                                         
Query: 206   cctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccagg 265
             |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 21767 cctgaatgatggctggaattctgcaggagcaccacccttctcaccaccaaaatcaccagg 21708

                                                                         
Query: 266   tgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctc 325
              ||||||||||| || |||||||| ||||||| ||| ||| | ||||| ||||| || ||
Sbjct: 21707 cgcaccacgaggtccaccacggtagccatcccggtctccaaaccttggtctgtccccttc 21648

                               
Query: 326   aaaacgaggtggccccct 343
              || |||||||| |||||
Sbjct: 21647 gaaccgaggtgggcccct 21630



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 625   cttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
             ||||||||||||||||||| |||||||| ||||||||||||| |||||||
Sbjct: 20304 cttggaagaggtacttgcagatctcattccggttcttcttggggatgatc 20255



to top

>dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0040I22
          Length = 134273

 Score =  242 bits (122), Expect = 1e-60
 Identities = 242/282 (85%)
 Strand = Plus / Minus

                                                                         
Query: 345   gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
             |||||||||||||| |||||||| || | ||||||||| || ||||| ||||| || |||
Sbjct: 66814 gggcgatcaccaggggggccagagccaaatgggcggcctggtggccttgcagacttcttg 66755

                                                                         
Query: 405   agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
             || || ||||| |||||||||||||||| ||| ||| | || | ||||  ||||||||||
Sbjct: 66754 agtgtagcaggtacaatctcagacggcaagttaaggtaattcctcaggtgctcaatgcca 66695

                                                                         
Query: 465   tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
             || || ||||||||||| ||||| | |||||| ||||||||||||||||| || ||||| 
Sbjct: 66694 tcattagtgaggtaccagtagtagtactgccaggagaaggtctccctgacatactccttg 66635

                                                                         
Query: 525   gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
             |||||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||| 
Sbjct: 66634 gacttgaagctctgcatgagcttgatgacctgaaggtttggcacatcaatctgtgggtgt 66575

                                                       
Query: 585   ttcgccaggttgtagtccttcttggcatacagcaccccctct 626
             || ||||  ||||||||||||||||| ||||  |||||||||
Sbjct: 66574 tttgccaaattgtagtccttcttggcgtacaaaaccccctct 66533



 Score =  123 bits (62), Expect = 8e-25
 Identities = 119/138 (86%)
 Strand = Plus / Minus

                                                                         
Query: 206   cctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccagg 265
             |||||||||||||||||| ||||||||||| || || |||||||||||||| ||||||||
Sbjct: 67516 cctgaatgatggctggaattctgcaggagcaccacccttctcaccaccaaaatcaccagg 67457

                                                                         
Query: 266   tgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctc 325
              ||||||||||| || |||||||| ||||||| ||| ||| | ||||| ||||| || ||
Sbjct: 67456 cgcaccacgaggtccaccacggtagccatcccggtctccaaaccttggtctgtccccttc 67397

                               
Query: 326   aaaacgaggtggccccct 343
              || |||||||| |||||
Sbjct: 67396 gaaccgaggtgggcccct 67379



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 625   cttggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
             ||||||||||||||||||| |||||||| ||||||||||||| |||||||
Sbjct: 66053 cttggaagaggtacttgcagatctcattccggttcttcttggggatgatc 66004



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  228 bits (115), Expect = 2e-56
 Identities = 232/271 (85%)
 Strand = Plus / Plus

                                                                            
Query: 345      gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
                ||||| |||||||| |||||||| |||| ||||||    || ||| ||||||| || |||
Sbjct: 42418829 gggcggtcaccaggagggccagagccgaatgggcgagacgggggcttggcagacttcttg 42418888

                                                                            
Query: 405      agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
                || |||  |||||||| |||||| |||||||||||| || |||| |||  ||||||||||
Sbjct: 42418889 agggtgttaggcacaacctcagatggcaggttgaggtagctgcggaggtgctcaatgcca 42418948

                                                                            
Query: 465      tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
                || ||||| |||||||| ||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 42418949 tcattggtcaggtaccagtagtagtgctgccacgagaaggtctccctcacatactccttt 42419008

                                                                            
Query: 525      gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
                ||||||||||||||||||||||| |||||||  | ||| |||||||||| ||  ||||||
Sbjct: 42419009 gacttgaagctctgcatgagcttaatcacctccaagttgggcacatcaacctttgggtgc 42419068

                                               
Query: 585      ttcgccaggttgtagtccttcttggcataca 615
                || ||||||||||||||||||||||||||||
Sbjct: 42419069 ttggccaggttgtagtccttcttggcataca 42419099



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                            
Query: 213      gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
                ||||||||||| || || ||||| || || ||||| |||||||| ||||| || ||||||
Sbjct: 42418214 gatggctggaactcagctggagcaccacccttctcgccaccaaaatcacctggagcacca 42418273

                                                                            
Query: 273      cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
                || || || || | ||||||||||||||| ||| | || ||||||||||||||||| |||
Sbjct: 42418274 cgtgggccacccctgtaaccatccctgtcaccaaacctgggcctgtcaccctcaaagcga 42418333

                  
Query: 333      gg 334
                ||
Sbjct: 42418334 gg 42418335



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                                
Query: 627      tggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
                ||||||||||||||||| |||||   ||||||||||||||||||||||
Sbjct: 42419461 tggaagaggtacttgcagatctcgcggcggttcttcttggagatgatc 42419508



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 433      ggttgaggaagttgcgcagg 452
                ||||||||||||||||||||
Sbjct: 19807898 ggttgaggaagttgcgcagg 19807879



to top

>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0483G10
          Length = 190721

 Score =  228 bits (115), Expect = 2e-56
 Identities = 232/271 (85%)
 Strand = Plus / Plus

                                                                         
Query: 345   gggcgatcaccaggtgggccagaaccgagtgggcggccaggaggcctggcagattttttg 404
             ||||| |||||||| |||||||| |||| ||||||    || ||| ||||||| || |||
Sbjct: 78167 gggcggtcaccaggagggccagagccgaatgggcgagacgggggcttggcagacttcttg 78226

                                                                         
Query: 405   agcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgcca 464
             || |||  |||||||| |||||| |||||||||||| || |||| |||  ||||||||||
Sbjct: 78227 agggtgttaggcacaacctcagatggcaggttgaggtagctgcggaggtgctcaatgcca 78286

                                                                         
Query: 465   tcgttggtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattcctta 524
             || ||||| |||||||| ||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 78287 tcattggtcaggtaccagtagtagtgctgccacgagaaggtctccctcacatactccttt 78346

                                                                         
Query: 525   gacttgaagctctgcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgc 584
             ||||||||||||||||||||||| |||||||  | ||| |||||||||| ||  ||||||
Sbjct: 78347 gacttgaagctctgcatgagcttaatcacctccaagttgggcacatcaacctttgggtgc 78406

                                            
Query: 585   ttcgccaggttgtagtccttcttggcataca 615
             || ||||||||||||||||||||||||||||
Sbjct: 78407 ttggccaggttgtagtccttcttggcataca 78437



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                         
Query: 213   gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcaccaggtgcacca 272
             ||||||||||| || || ||||| || || ||||| |||||||| ||||| || ||||||
Sbjct: 77552 gatggctggaactcagctggagcaccacccttctcgccaccaaaatcacctggagcacca 77611

                                                                         
Query: 273   cgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacga 332
             || || || || | ||||||||||||||| ||| | || ||||||||||||||||| |||
Sbjct: 77612 cgtgggccacccctgtaaccatccctgtcaccaaacctgggcctgtcaccctcaaagcga 77671

               
Query: 333   gg 334
             ||
Sbjct: 77672 gg 77673



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                             
Query: 627   tggaagaggtacttgcaaatctcattgcggttcttcttggagatgatc 674
             ||||||||||||||||| |||||   ||||||||||||||||||||||
Sbjct: 78799 tggaagaggtacttgcagatctcgcggcggttcttcttggagatgatc 78846



to top

>gb|BT017535.1| Zea mays clone EL01N0422A10.c mRNA sequence
          Length = 568

 Score =  224 bits (113), Expect = 3e-55
 Identities = 212/245 (86%)
 Strand = Plus / Minus

                                                                       
Query: 204 ctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcacca 263
           |||||||||||||||||||| || ||||||||||| |  || || |||||||||||||||
Sbjct: 261 ctcctgaatgatggctggaactcagcaggagctccactcttatcgccaccaaagtcacca 202

                                                                       
Query: 264 ggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccc 323
           || |||||||||||||| |||||||| ||||||||||| ||| | ||||||||||| || 
Sbjct: 201 ggagcaccacgaggaccaccacggtacccatccctgtcaccaaaccttggcctgtcgccg 142

                                                                       
Query: 324 tcaaaacgaggtggccccctcgggcgatcaccaggtgggccagaaccgagtgggcggcca 383
           ||||||||   ||| ||||| ||||| |||||||| |||||||| || | ||||||||||
Sbjct: 141 tcaaaacggcctgggccccttgggcggtcaccaggagggccagagccaaatgggcggcca 82

                                                                       
Query: 384 ggaggcctggcagattttttgagcgtggcaggcacaatctcagacggcaggttgaggaag 443
           || ||| ||||||| || ||||||||||||||||| ||||||||||| ||||| ||| ||
Sbjct: 81  ggtggcttggcagacttcttgagcgtggcaggcacgatctcagacgggaggttcaggtag 22

                
Query: 444 ttgcg 448
           |||||
Sbjct: 21  ttgcg 17



to top

>gb|DQ268860.1| Solanum tuberosum clone 178H07 40S ribosomal protein S10-like
           protein mRNA, complete cds
          Length = 735

 Score =  111 bits (56), Expect = 3e-21
 Identities = 158/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 450 aggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctcc 509
           ||||||||||||||||| ||||| || ||||| ||||| |||  ||| |  |||||||| 
Sbjct: 263 aggaactcaatgccatcattggtaagataccagtagtagtgcatccaagcaaaggtctca 204

                                                                       
Query: 510 ctgacgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcaca 569
           |  || || ||||| ||||| ||||||||||| ||||| ||||| || ||||||||||||
Sbjct: 203 cgcacatactcctttgacttaaagctctgcatcagcttaatcacttgtaggttcggcaca 144

                                                                       
Query: 570 tcaatctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccctcttgg 629
           ||||| |  || || ||||||| ||||||||||||||| ||| |    || |||||||||
Sbjct: 143 tcaatgttgggatgtttcgccaagttgtagtccttcttagcaaagcatactccctcttgg 84

                       
Query: 630 aagaggtacttg 641
           ||||||||||||
Sbjct: 83  aagaggtacttg 72



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggagctccgcctttctcaccaccaaagtcaccaggtgcaccacgaggaccgccacggtaa 290
           |||||||| || |||||||| ||||| |||||||||| ||| |  |||||  ||||||||
Sbjct: 479 ggagctccacccttctcacctccaaattcaccaggtggacctcttggaccagcacggtaa 420

                                              
Query: 291 ccatccctgtcgccatatcttggcctgtcaccctc 325
           |||||||| || ||| | |||||||| ||||||||
Sbjct: 419 ccatccctatcaccaaaccttggcctatcaccctc 385



to top

>gb|DQ252484.1| Solanum tuberosum clone 048B07 40S ribosomal protein S10-like mRNA,
           complete cds
          Length = 738

 Score =  111 bits (56), Expect = 3e-21
 Identities = 158/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 450 aggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctcc 509
           ||||||||||||||||| ||||| || ||||| ||||| |||  ||| |  |||||||| 
Sbjct: 261 aggaactcaatgccatcattggtaagataccagtagtagtgcatccaagcaaaggtctca 202

                                                                       
Query: 510 ctgacgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcaca 569
           |  || || ||||| ||||| ||||||||||| ||||| ||||| || ||||||||||||
Sbjct: 201 cgcacatactcctttgacttaaagctctgcatcagcttaatcacttgtaggttcggcaca 142

                                                                       
Query: 570 tcaatctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccctcttgg 629
           ||||| |  || || ||||||| ||||||||||||||| ||| |    || |||||||||
Sbjct: 141 tcaatgttgggatgtttcgccaagttgtagtccttcttagcaaagcatactccctcttgg 82

                       
Query: 630 aagaggtacttg 641
           ||||||||||||
Sbjct: 81  aagaggtacttg 70



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                       
Query: 231 ggagctccgcctttctcaccaccaaagtcaccaggtgcaccacgaggaccgccacggtaa 290
           |||||||| || |||||||| ||||| |||||||||| ||| |  |||||  ||||||||
Sbjct: 477 ggagctccacccttctcacctccaaattcaccaggtggacctcttggaccagcacggtaa 418

                                              
Query: 291 ccatccctgtcgccatatcttggcctgtcaccctc 325
           |||||||| || ||| | |||||||| ||||||||
Sbjct: 417 ccatccctatcaccaaaccttggcctatcaccctc 383



to top

>gb|DQ252521.1| Solanum tuberosum clone 111F10 40S ribosomal protein S10-like mRNA,
           complete cds
          Length = 859

 Score =  101 bits (51), Expect = 3e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                       
Query: 194 tccaccagagctcctgaatgatggctggaagtctgcaggagctccgcctttctcaccacc 253
           ||||||||| | |||||| |  |||||| |||| || |||||||| || |||||||| ||
Sbjct: 528 tccaccagaacccctgaaagcaggctggtagtcagctggagctccacccttctcacctcc 469

                                                                       
Query: 254 aaagtcaccaggtgcaccacgaggaccgccacggtaaccatccctgtcgccatatcttgg 313
           ||| |||||||||| ||| | ||| ||  ||||||||||||| ||||||||||| |||||
Sbjct: 468 aaactcaccaggtggacctctaggtccagcacggtaaccatctctgtcgccataccttgg 409

                          
Query: 314 cctgtcaccctcaaa 328
           ||| |||||||||||
Sbjct: 408 cctatcaccctcaaa 394



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 182/227 (80%)
 Strand = Plus / Minus

                                                                       
Query: 450 aggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctcc 509
           ||||||||||||||||| || || |||||||| ||||| |||  ||| | ||| ||||| 
Sbjct: 275 aggaactcaatgccatcatttgtaaggtaccagtagtagtgcatccaagcgaatgtctcg 216

                                                                       
Query: 510 ctgacgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggcaca 569
           |  || || |||||||| |||||||||||||| || ||||| ||||| || || ||||||
Sbjct: 215 cgaacatactccttagatttgaagctctgcatcagtttgataacctgtagatttggcaca 156

                                                                       
Query: 570 tcaatctgcgggtgcttcgccaggttgtagtccttcttggcatacagcaccccctcttgg 629
           || ||   ||| ||||| |||| |||||| |||||||| || ||   ||| |||||||||
Sbjct: 155 tcgattaacggatgcttggccaagttgtaatccttcttcgcgtagcacactccctcttgg 96

                                                          
Query: 630 aagaggtacttgcaaatctcattgcggttcttcttggagatgatcat 676
           |||||||| ||| | |||||  | ||||||||||  ||||| |||||
Sbjct: 95  aagaggtatttggagatctctctacggttcttctctgagataatcat 49



to top

>ref|NM_118706.2| Arabidopsis thaliana structural constituent of ribosome AT4G25740
           transcript variant AT4G25740.1 mRNA, complete cds
          Length = 746

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 246 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 187

                                                 
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatc 575
           |||||||||| ||||| || ||||| || |||||||||
Sbjct: 186 gcatgagcttaatcacttgcaggtttggtacatcaatc 149



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 268 caccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaa 327
           ||||||| || || |||||||| ||||| | ||| ||| |||| || | ||| || ||| 
Sbjct: 453 caccacgtgggcctccacggtatccatcacggtcaccaaatctgggacggtctccatcag 394

                                                 
Query: 328 aacgaggtggccccctcgggcgatcaccaggtgggcca 365
           | |||||||| || ||  ||||||||||||||||||||
Sbjct: 393 agcgaggtggtcctctttggcgatcaccaggtgggcca 356



to top

>ref|NM_001036641.1| Arabidopsis thaliana structural constituent of ribosome AT4G25740
           transcript variant AT4G25740.2 mRNA, complete cds
          Length = 736

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 261 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 202

                                                 
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatc 575
           |||||||||| ||||| || ||||| || |||||||||
Sbjct: 201 gcatgagcttaatcacttgcaggtttggtacatcaatc 164



to top

>gb|AY113926.1| Arabidopsis thaliana putative ribosomal protein S10 (At4g25740)
           mRNA, complete cds
          Length = 565

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 199 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 140

                                                 
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatc 575
           |||||||||| ||||| || ||||| || |||||||||
Sbjct: 139 gcatgagcttaatcacttgcaggtttggtacatcaatc 102



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 268 caccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaa 327
           ||||||| || || |||||||| ||||| | ||| ||| |||| || | ||| || ||| 
Sbjct: 406 caccacgtgggcctccacggtatccatcacggtcaccaaatctgggacggtctccatcag 347

                                                 
Query: 328 aacgaggtggccccctcgggcgatcaccaggtgggcca 365
           | |||||||| || ||  ||||||||||||||||||||
Sbjct: 346 agcgaggtggtcctctttggcgatcaccaggtgggcca 309



to top

>gb|AY035172.1| Arabidopsis thaliana putative ribosomal protein S10 (At4g25740)
           mRNA, complete cds
          Length = 762

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 246 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 187

                                                 
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatc 575
           |||||||||| ||||| || ||||| || |||||||||
Sbjct: 186 gcatgagcttaatcacttgcaggtttggtacatcaatc 149



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 268 caccacgaggaccgccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaa 327
           ||||||| || || |||||||| ||||| | ||| ||| |||| || | ||| || ||| 
Sbjct: 453 caccacgtgggcctccacggtatccatcacggtcaccaaatctgggacggtctccatcag 394

                                                 
Query: 328 aacgaggtggccccctcgggcgatcaccaggtgggcca 365
           | |||||||| || ||  ||||||||||||||||||||
Sbjct: 393 agcgaggtggtcctctttggcgatcaccaggtgggcca 356



to top

>emb|AL161563.2|ATCHRIV63 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 63
          Length = 198777

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                          
Query: 478    accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
              ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 190298 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 190357

                                                    
Query: 538    gcatgagcttgatcacctggaggttcggcacatcaatc 575
              |||||||||| ||||| || ||||| || |||||||||
Sbjct: 190358 gcatgagcttaatcacttgcaggtttggtacatcaatc 190395



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    ggcgatcaccaggtgggcca 365
              ||||||||||||||||||||
Sbjct: 190169 ggcgatcaccaggtgggcca 190188



to top

>emb|AL050400.1|ATL73G19 Arabidopsis thaliana DNA chromosome 4, cosmid clone L73G19 (ESSA
             project)
          Length = 42446

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                         
Query: 478   accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
             ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 38791 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 38850

                                                   
Query: 538   gcatgagcttgatcacctggaggttcggcacatcaatc 575
             |||||||||| ||||| || ||||| || |||||||||
Sbjct: 38851 gcatgagcttaatcacttgcaggtttggtacatcaatc 38888



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 346   ggcgatcaccaggtgggcca 365
             ||||||||||||||||||||
Sbjct: 38662 ggcgatcaccaggtgggcca 38681



to top

>emb|AL049480.1|ATF14M19 Arabidopsis thaliana DNA chromosome 4, BAC clone F14M19 (ESSA
            project)
          Length = 91228

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                        
Query: 478  accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
            ||||||| ||||||  |||||  || |||||||| ||||| ||||| |||||||| ||||
Sbjct: 5442 accaataataatgcatccacgcaaatgtctccctaacgtactccttggacttgaaactct 5501

                                                  
Query: 538  gcatgagcttgatcacctggaggttcggcacatcaatc 575
            |||||||||| ||||| || ||||| || |||||||||
Sbjct: 5502 gcatgagcttaatcacttgcaggtttggtacatcaatc 5539



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 346  ggcgatcaccaggtgggcca 365
            ||||||||||||||||||||
Sbjct: 5313 ggcgatcaccaggtgggcca 5332



to top

>gb|DQ226795.1| Boechera divaricarpa isolate SLW-B-C05 mRNA sequence
          Length = 448

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 ccacggtaaccatccctgtcgccatatcttggcctgtcaccctcaaaacgaggtggcccc 341
           |||||||| ||||| | ||| |||||||| || | ||| || ||||| |||||||| || 
Sbjct: 232 ccacggtatccatcacggtcaccatatctgggacggtctccttcaaagcgaggtggtcct 173

                                   
Query: 342 ctcgggcgatcaccaggtgggcca 365
           ||||||||||||||||||||||||
Sbjct: 172 ctcgggcgatcaccaggtgggcca 149



to top

>emb|AJ538899.1|NTA538899 Nicotiana tabacum cDNA-AFLP-fragment BT2-M33-002
          Length = 447

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 450 aggaactcaatgccatcgttggtgaggtaccaatagtaatgctgccacgagaaggtctcc 509
           |||||||||||||| || ||||| || ||||||||||| |||  ||| |  |||||||| 
Sbjct: 142 aggaactcaatgccgtcattggtcagataccaatagtagtgcatccaagcaaaggtctca 83

                                           
Query: 510 ctgacgtattccttagacttgaagctctgcat 541
           |  ||||||||||| |||||||| ||||||||
Sbjct: 82  cgcacgtattccttcgacttgaaactctgcat 51



to top

>emb|CT025844.1| Medicago truncatula chromosome 5 clone mte1-41h18, COMPLETE SEQUENCE
          Length = 103321

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                         
Query: 507   tccctgacgtattccttagacttgaagctctgcatgagcttgatcacctggaggttcggc 566
             ||||| || |||||| |||| |||||||||||||| ||||| ||||| || || || |||
Sbjct: 79241 tccctcacatattccctagatttgaagctctgcatcagcttaatcacttgcagatttggc 79182

                                                            
Query: 567   acatcaatctgcgggtgcttcgccaggttgtagtccttcttggcata 613
             |||||||| |  |||||||| ||||  ||| | |||||||| |||||
Sbjct: 79181 acatcaatttctgggtgcttagccaaattgaaatccttctttgcata 79135



to top

>gb|DQ066194.1| Ixodes scapularis isolate ISUFL81 40S ribosomal protein S10 mRNA,
           complete cds
          Length = 471

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 402 ttgagcgtggcaggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatg 461
           ||||| ||||| ||||||||||| |  ||||||| ||||||||  |||||| |||  |||
Sbjct: 278 ttgagggtggccggcacaatctcggggggcaggtggaggaagtcccgcaggtactggatg 219

                                     
Query: 462 ccatcgttggtgaggtaccaatagta 487
           || |||||||| |||||||| |||||
Sbjct: 218 ccctcgttggtcaggtaccagtagta 193



to top

>gb|AY961467.1| Phytophthora infestans clone MY-06-E-07 ribosomal protein S10 mRNA,
           complete cds
          Length = 546

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 536 ctgcatgagcttgatcacctggaggttcggcacatc 571
           ||||||||||||||| ||||||||||| ||||||||
Sbjct: 165 ctgcatgagcttgatgacctggaggttgggcacatc 130



to top

>ref|NM_124643.2| Arabidopsis thaliana structural constituent of ribosome AT5G52650
           mRNA, complete cds
          Length = 778

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 271 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 212

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || ||||| || ||||| |||  ||| ||||| || || ||| 
Sbjct: 211 gcataagcttaatcacttgtaggttggggacatcgatcaacggatgcttagcaagattga 152

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 151 aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 92

            
Query: 658 t 658
           |
Sbjct: 91  t 91



to top

>gb|AY122932.1| Arabidopsis thaliana unknown protein (At5g52650) mRNA, complete cds
          Length = 571

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 199 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 140

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || ||||| || ||||| |||  ||| ||||| || || ||| 
Sbjct: 139 gcataagcttaatcacttgtaggttggggacatcgatcaacggatgcttagcaagattga 80

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 79  aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 20

            
Query: 658 t 658
           |
Sbjct: 19  t 19



to top

>gb|AY065217.1| Arabidopsis thaliana unknown protein (At5g52650) mRNA, complete cds
          Length = 778

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 264 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 205

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || ||||| || ||||| |||  ||| ||||| || || ||| 
Sbjct: 204 gcataagcttaatcacttgtaggttggggacatcgatcaacggatgcttagcaagattga 145

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 144 aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 85

            
Query: 658 t 658
           |
Sbjct: 84  t 84



to top

>emb|BX830280.1|CNS0A19J Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZC05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 247 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 188

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || ||||| || ||||| |||  ||| ||||| || || ||| 
Sbjct: 187 gcataagcttaatcacttgtaggttggggacatcgatcaacggatgcttagcaagattga 128

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 127 aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 68

            
Query: 658 t 658
           |
Sbjct: 67  t 67



to top

>emb|BX830062.1|CNS0A1D6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZA08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 750

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 245 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 186

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || ||||| || ||||| |||  ||| ||||| || || ||| 
Sbjct: 185 gcataagcttaatcacttgtaggttggggacatcgatcaacggatgcttagcaagattga 126

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 125 aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 66

            
Query: 658 t 658
           |
Sbjct: 65  t 65



to top

>gb|AY088678.1| Arabidopsis thaliana clone 91769 mRNA, complete sequence
          Length = 768

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 142/181 (78%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || ||||| || || || ||||| || ||||| ||||
Sbjct: 273 accaatagtaatgcatccaggcaaatgtctctctaacatactccttggatttgaaactct 214

                                                                       
Query: 538 gcatgagcttgatcacctggaggttcggcacatcaatctgcgggtgcttcgccaggttgt 597
           |||| ||||| ||||| || |||||||| ||||| |||  ||| ||||| || || ||| 
Sbjct: 213 gcataagcttaatcacttgtaggttcgggacatcgatcaacggatgcttagcaagattga 154

                                                                       
Query: 598 agtccttcttggcatacagcaccccctcttggaagaggtacttgcaaatctcattgcggt 657
           | |||||||| ||| |    || || |||| ||||||||||||||| || || |||||||
Sbjct: 153 aatccttcttcgcaaagcaaactccttctttgaagaggtacttgcagatttctttgcggt 94

            
Query: 658 t 658
           |
Sbjct: 93  t 93



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 213 gatggctggaagtctgcaggagctccgcctttctcaccaccaaagtcacca 263
           ||||||||| | |||||||||||||| || || ||||| ||||| ||||||
Sbjct: 532 gatggctggtaatctgcaggagctccacccttttcacctccaaactcacca 482



to top

>ref|NM_123516.2| Arabidopsis thaliana structural constituent of ribosome AT5G41520
           mRNA, complete cds
          Length = 807

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 287 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 228

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 227 aaactctgcatcaacttgat 208



to top

>gb|AF375440.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, complete cds
          Length = 780

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 287 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 228

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 227 aaactctgcatcaacttgat 208



to top

>gb|AY060539.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, complete cds
          Length = 543

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 209 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 150

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 149 aaactctgcatcaacttgat 130



to top

>gb|AY037240.1| Arabidopsis thaliana AT5g41520/MBK23_4 mRNA, complete cds
          Length = 781

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 287 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 228

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 227 aaactctgcatcaacttgat 208



to top

>emb|BX830030.1|CNS0A1DV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 828

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 297 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 238

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 237 aaactctgcatcaacttgat 218



to top

>emb|BX832280.1|CNS0A13B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 783

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 471 gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
           |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 281 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 222

                               
Query: 531 aagctctgcatgagcttgat 550
           || |||||||| | ||||||
Sbjct: 221 aaactctgcatcaacttgat 202



to top

>dbj|AB005233.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK23
          Length = 79837

 Score = 48.1 bits (24), Expect = 0.040
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 471  gtgaggtaccaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttg 530
            |||||| |||| |||||||||  ||| |  |||||||| || || ||||||||||| |||
Sbjct: 5088 gtgaggaaccagtagtaatgcatccaagcaaaggtctctctcacatattccttagatttg 5147

                                
Query: 531  aagctctgcatgagcttgat 550
            || |||||||| | ||||||
Sbjct: 5148 aaactctgcatcaacttgat 5167



to top

>emb|AJ538646.1|NTA538646 Nicotiana tabacum cDNA-AFLP-fragment BC32-M2-013
          Length = 257

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 231 ggagctccgcctttctcaccaccaaagtcaccagg 265
           |||||||| ||||| ||||||||||| ||||||||
Sbjct: 201 ggagctccacctttttcaccaccaaactcaccagg 167



to top

>emb|AJ538565.1|NTA538565 Nicotiana tabacum cDNA-AFLP-fragment BC3-M22-025
          Length = 233

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 231 ggagctccgcctttctcaccaccaaagtcaccagg 265
           |||||||| ||||| ||||||||||| ||||||||
Sbjct: 29  ggagctccacctttttcaccaccaaactcaccagg 63



to top

>dbj|D88764.1| Rana catesbeiana mRNA for alpha 2 type I collagen, complete cds
          Length = 4692

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 258  tcaccaggtgcaccacgaggacc 280
            |||||||||||||||||||||||
Sbjct: 2238 tcaccaggtgcaccacgaggacc 2216



to top

>gb|AY070896.1| Drosophila melanogaster LP04958 full insert cDNA
          Length = 1020

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 414 ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
           ||||| ||||| | |||||||| |||| || |||||||   ||| || || |||||||||
Sbjct: 621 ggcacgatctcgggcggcaggtggaggtagctgcgcagctcctcgattccctcgttggtg 562

                         
Query: 474 aggtaccaatagta 487
           |||||||| |||||
Sbjct: 561 aggtaccagtagta 548



to top

>ref|NM_167668.1| Drosophila melanogaster Ribosomal protein S10b CG14206-RB,
           transcript variant B (RpS10b), mRNA
          Length = 746

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 414 ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
           ||||| ||||| | |||||||| |||| || |||||||   ||| || || |||||||||
Sbjct: 367 ggcacgatctcgggcggcaggtggaggtagctgcgcagctcctcgattccctcgttggtg 308

                         
Query: 474 aggtaccaatagta 487
           |||||||| |||||
Sbjct: 307 aggtaccagtagta 294



to top

>ref|NM_134480.2| Drosophila melanogaster Ribosomal protein S10b CG14206-RC,
           transcript variant C (RpS10b), mRNA
          Length = 731

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 414 ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
           ||||| ||||| | |||||||| |||| || |||||||   ||| || || |||||||||
Sbjct: 352 ggcacgatctcgggcggcaggtggaggtagctgcgcagctcctcgattccctcgttggtg 293

                         
Query: 474 aggtaccaatagta 487
           |||||||| |||||
Sbjct: 292 aggtaccagtagta 279



to top

>dbj|AK045503.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230207K24
           product:hypothetical protein, full insert sequence
          Length = 2338

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 542 gagcttgatcacctggaggttcggca 567
           |||||||||||||||||||| |||||
Sbjct: 377 gagcttgatcacctggaggtacggca 352



to top

>gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, region 18D-18D, BAC clone
              BACR10M08, complete sequence
          Length = 180213

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 414    ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
              ||||| ||||| | |||||||| |||| || |||||||   ||| || || |||||||||
Sbjct: 139849 ggcacgatctcgggcggcaggtggaggtagctgcgcagctcctcgattccctcgttggtg 139790

                            
Query: 474    aggtaccaatagta 487
              |||||||| |||||
Sbjct: 139789 aggtaccagtagta 139776



to top

>dbj|AB025606.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F6N7
          Length = 74282

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                         
Query: 478   accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
             ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 35831 accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 35890

                                               
Query: 538   gcatgagcttgatcacctggaggttcggcacatc 571
             |||| ||||| ||||| || ||||| || |||||
Sbjct: 35891 gcataagcttaatcacttgtaggttggggacatc 35924



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
              sequence
          Length = 346474

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 414    ggcacaatctcagacggcaggttgaggaagttgcgcaggaactcaatgccatcgttggtg 473
              ||||| ||||| | |||||||| |||| || |||||||   ||| || || |||||||||
Sbjct: 245615 ggcacgatctcgggcggcaggtggaggtagctgcgcagctcctcgattccctcgttggtg 245556

                            
Query: 474    aggtaccaatagta 487
              |||||||| |||||
Sbjct: 245555 aggtaccagtagta 245542



to top

>emb|CR376839.12| Zebrafish DNA sequence from clone DKEY-75G22 in linkage group 2,
             complete sequence
          Length = 127371

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   tcactccattgggctagcgcc 127
             |||||||||||||||||||||
Sbjct: 50352 tcactccattgggctagcgcc 50372



to top

>gb|AC105075.6| Mus musculus chromosome 1, clone RP23-366P11, complete sequence
          Length = 195511

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 32     ttgcaaacatcactacataaa 52
              |||||||||||||||||||||
Sbjct: 186359 ttgcaaacatcactacataaa 186379



to top

>emb|AL627248.7| Zebrafish DNA sequence from clone RP71-1G18 in linkage group 2 Contains
             three novel genes, a novel gene similar to human CASQ1
             (calsequestrin 1), six novel genes similar to vertebrate
             C1Q (gliacolin), a novel gene similar to human HNRPC
             (heterogeneous nuclear ribonucleoprotein C (C1/C2)), a
             novel gene for a protein similar to human H326 protein,
             two novel genes for proteins similar to human
             apolipoproteins, a novel gene similar to human TEP1
             (telomerase-associated protein 1) and a CpG island,
             complete sequence
          Length = 143586

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   tcactccattgggctagcgcc 127
             |||||||||||||||||||||
Sbjct: 57477 tcactccattgggctagcgcc 57457



to top

>emb|BX829499.1|CNS0A1BF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZG05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 592

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 478 accaatagtaatgctgccacgagaaggtctccctgacgtattccttagacttgaagctct 537
           ||||||||||||||  ||| |  || |||||||| || || ||||| || ||||| ||||
Sbjct: 96  accaatagtaatgcatccaggcaaatgtctccctaacatactccttggatttgaaactct 37

                                    
Query: 538 gcatgagcttgatcacctggaggtt 562
           |||| ||||| ||||| || |||||
Sbjct: 36  gcataagcttaatcacttgtaggtt 12



to top

>dbj|AB049721.2| Pisum sativum ssa-11 mRNA for putative senescence-associated
           protein, complete cds
          Length = 1000

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 321 ccctcaaaacgaggtggccccctcgggcgatcaccaggtgg 361
           ||||| || |||||||| || || |||||||||||||||||
Sbjct: 345 ccctcgaatcgaggtgggcctctagggcgatcaccaggtgg 385



to top

>gb|BC101918.1| Rattus norvegicus cytochrome P450, family 4, subfamily f, polypeptide
            18, mRNA (cDNA clone MGC:124833 IMAGE:7935301), complete
            cds
          Length = 2811

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 578  cgggtgcttcgccaggttgta 598
            |||||||||||||||||||||
Sbjct: 1070 cgggtgcttcgccaggttgta 1050



to top

>ref|NM_001033686.1| Rattus norvegicus cytochrome P450, family 4, subfamily f, polypeptide
            18 (Cyp4f18), mRNA
          Length = 2811

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 578  cgggtgcttcgccaggttgta 598
            |||||||||||||||||||||
Sbjct: 1070 cgggtgcttcgccaggttgta 1050



to top

>emb|AL845366.6| Zebrafish DNA sequence from clone CH211-167C22 in linkage group 20,
              complete sequence
          Length = 149189

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    tcactccattgggctagcgcc 127
              |||||||||||||||||||||
Sbjct: 110914 tcactccattgggctagcgcc 110934



to top

>gb|AC154142.24| Mus musculus chromosome 1, clone RP23-187M7, complete sequence
          Length = 237824

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 197   accagagctcctgaatgatggctgg 221
             |||||||| ||||||||||||||||
Sbjct: 35614 accagagcacctgaatgatggctgg 35638



to top

>gb|BC081808.1| Rattus norvegicus cytochrome P450, family 4, subfamily F, polypeptide
            2, mRNA (cDNA clone MGC:93476 IMAGE:7109036), complete
            cds
          Length = 2119

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 579  gggtgcttcgccaggttgta 598
            ||||||||||||||||||||
Sbjct: 1173 gggtgcttcgccaggttgta 1154



to top

>ref|XM_521903.1| PREDICTED: Pan troglodytes cholinergic receptor, muscarinic 4
            (LOC466504), mRNA
          Length = 1719

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1561 gcgtggcaggcacaatctca 1542



to top

>gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 10, complete
              sequence
          Length = 1085720

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 268    caccacgaggaccgccacgg 287
              ||||||||||||||||||||
Sbjct: 176680 caccacgaggaccgccacgg 176661



to top

>gb|AE017130.1| Yersinia pestis biovar Medievalis str. 91001 section 4 of 16 of the
              complete genome
          Length = 290510

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 437    gaggaagttgcgcaggaact 456
              ||||||||||||||||||||
Sbjct: 197336 gaggaagttgcgcaggaact 197317



to top

>ref|XM_322656.1| Neurospora crassa OR74A predicted protein (NCU03399.1) partial mRNA
          Length = 1416

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  caccacgaggaccgccacgg 287
            ||||||||||||||||||||
Sbjct: 1366 caccacgaggaccgccacgg 1347



to top

>ref|XM_951753.1| Neurospora crassa OR74A hypothetical protein (NCU03399.1) partial
            mRNA
          Length = 1416

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  caccacgaggaccgccacgg 287
            ||||||||||||||||||||
Sbjct: 1366 caccacgaggaccgccacgg 1347



to top

>ref|NM_000741.2| Homo sapiens cholinergic receptor, muscarinic 4 (CHRM4), mRNA
          Length = 1468

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1090 gcgtggcaggcacaatctca 1071



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 348     cgatcaccaggtgggccaga 367
               ||||||||||||||||||||
Sbjct: 3107713 cgatcaccaggtgggccaga 3107732



to top

>ref|XM_567314.1| Cryptococcus neoformans var. neoformans JEC21 Argonaute-like protein
            (CNJ00610) partial mRNA
          Length = 3162

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  caccacgaggaccgccacgg 287
            ||||||||||||||||||||
Sbjct: 1042 caccacgaggaccgccacgg 1023



to top

>gb|AC090681.13| Homo sapiens 12 BAC RP11-369C14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 93582

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 530   gaagctctgcatgagcttga 549
             ||||||||||||||||||||
Sbjct: 45206 gaagctctgcatgagcttga 45225



to top

>emb|CR974458.2| Pig DNA sequence from clone CH242-29M17 on chromosome 17, complete
              sequence
          Length = 177939

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     atcactacataaaaccatca 59
              ||||||||||||||||||||
Sbjct: 137335 atcactacataaaaccatca 137316



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 601     ccttcttggcatacagcacc 620
               ||||||||||||||||||||
Sbjct: 1853845 ccttcttggcatacagcacc 1853864



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 318     tcaccctcaaaacgaggtgg 337
               ||||||||||||||||||||
Sbjct: 1074928 tcaccctcaaaacgaggtgg 1074909



to top

>emb|AL356501.6| Human DNA sequence from clone RP5-1159G19 on chromosome 1, complete
             sequence
          Length = 69026

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    gatacttgcaaacatcacta 46
             ||||||||||||||||||||
Sbjct: 36850 gatacttgcaaacatcacta 36831



to top

>emb|CR788255.6| Zebrafish DNA sequence from clone DKEY-9C18 in linkage group 2, complete
              sequence
          Length = 210464

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 110    ctccattgggctagcgccaa 129
              ||||||||||||||||||||
Sbjct: 124234 ctccattgggctagcgccaa 124253



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 110   ctccattgggctagcgccaa 129
             ||||||||||||||||||||
Sbjct: 92047 ctccattgggctagcgccaa 92066



to top

>gb|AC123178.4| Rattus norvegicus 7 BAC CH230-20I17 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 221236

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 245    ctcaccaccaaagtcaccag 264
              ||||||||||||||||||||
Sbjct: 119937 ctcaccaccaaagtcaccag 119918



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 437     gaggaagttgcgcaggaact 456
               ||||||||||||||||||||
Sbjct: 1428749 gaggaagttgcgcaggaact 1428768



to top

>emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II BAC clone B19C19
          Length = 61082

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   caccacgaggaccgccacgg 287
             ||||||||||||||||||||
Sbjct: 22696 caccacgaggaccgccacgg 22715



to top

>emb|AJ414146.1| Yersinia pestis strain CO92 complete genome; segment 6/20
          Length = 210050

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 437    gaggaagttgcgcaggaact 456
              ||||||||||||||||||||
Sbjct: 197746 gaggaagttgcgcaggaact 197765



to top

>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence
          Length = 223809

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     tcactacataaaaccatcat 60
              ||||||||||||||||||||
Sbjct: 112770 tcactacataaaaccatcat 112751



to top

>emb|BX469889.7| Zebrafish DNA sequence from clone DKEY-156P3 in linkage group 18,
              complete sequence
          Length = 177975

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    ggctggaagtctgcaggagc 235
              ||||||||||||||||||||
Sbjct: 118345 ggctggaagtctgcaggagc 118364



to top

>gb|AC117467.3| Homo sapiens 3 BAC RP11-669C7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 90000

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 631   agaggtacttgcaaatctca 650
             ||||||||||||||||||||
Sbjct: 84463 agaggtacttgcaaatctca 84444



to top

>gb|AC116021.5| Homo sapiens chromosome 11, clone CTD-2589M5, complete sequence
          Length = 167757

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 406    gcgtggcaggcacaatctca 425
              ||||||||||||||||||||
Sbjct: 151979 gcgtggcaggcacaatctca 151998



to top

>gb|AF498918.1| Homo sapiens muscarinic acetylcholine receptor M4 (CHRM4) mRNA,
            complete cds
          Length = 1440

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1090 gcgtggcaggcacaatctca 1071



to top

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     gtccgatacttgcaaacatc 42
              ||||||||||||||||||||
Sbjct: 299883 gtccgatacttgcaaacatc 299902



to top

>gb|AC079789.7| Homo sapiens BAC clone RP11-475B2 from 4, complete sequence
          Length = 198586

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 203    gctcctgaatgatggctgga 222
              ||||||||||||||||||||
Sbjct: 138534 gctcctgaatgatggctgga 138515



to top

>gb|AC073917.19| Homo sapiens 12q BAC RP11-415D21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 163836

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 386   aggcctggcagattttttga 405
             ||||||||||||||||||||
Sbjct: 86179 aggcctggcagattttttga 86198



to top

>gb|BC102416.1| Bos taurus similar to 40S ribosomal protein S10, mRNA (cDNA clone
           MGC:127433 IMAGE:7951311), complete cds
          Length = 643

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 459 atgccatcgttggtgaggtaccaatagtaatg 490
           ||||| ||||||||||||||||| ||| ||||
Sbjct: 266 atgccctcgttggtgaggtaccagtagaaatg 235



to top

>gb|AC024293.18| Homo sapiens chromosome 11, clone RP11-425L10, complete sequence
          Length = 70106

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 3811 gcgtggcaggcacaatctca 3830



to top

>gb|AF385590.1|AF385590 Homo sapiens m4 muscarinic cholinergic receptor (CHRM4) mRNA,
            complete cds
          Length = 1476

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1090 gcgtggcaggcacaatctca 1071



to top

>gb|AC008102.18| Homo sapiens chromosome 11 clone bac41i21 map 11q13, complete sequence
          Length = 126787

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 622   cctcttggaagaggtacttgcaaa 645
             ||||||||||||||||||| ||||
Sbjct: 70824 cctcttggaagaggtacttacaaa 70847



to top

>gb|BC095546.1| Homo sapiens cholinergic receptor, muscarinic 4, mRNA (cDNA clone
            IMAGE:6519223), partial cds
          Length = 1440

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1091 gcgtggcaggcacaatctca 1072



to top

>gb|AC073532.18|AC073532 Homo sapiens 12 BAC RP11-150F20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 143759

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 386   aggcctggcagattttttga 405
             ||||||||||||||||||||
Sbjct: 69183 aggcctggcagattttttga 69202



to top

>dbj|AP003516.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0047D12
          Length = 145981

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 433   ggttgaggaagttgcgcagg 452
             ||||||||||||||||||||
Sbjct: 30856 ggttgaggaagttgcgcagg 30837



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     cggccaggaggcctggcaga 397
               ||||||||||||||||||||
Sbjct: 3193612 cggccaggaggcctggcaga 3193631



to top

>ref|XM_578642.1| PREDICTED: Rattus norvegicus similar to Cyp4f15 protein (LOC503122),
            mRNA
          Length = 2772

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 579  gggtgcttcgccaggttgta 598
            ||||||||||||||||||||
Sbjct: 2243 gggtgcttcgccaggttgta 2224



to top

>gb|M16405.2|HUMACHRM4 Homo sapiens muscarinic acetylcholine receptor m4 (CHRM4) gene,
            complete cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1890 gcgtggcaggcacaatctca 1871



to top

>emb|BX470166.11| Zebrafish DNA sequence from clone CH211-238N5 in linkage group 18,
             complete sequence
          Length = 117241

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   ggctggaagtctgcaggagc 235
             ||||||||||||||||||||
Sbjct: 29412 ggctggaagtctgcaggagc 29393



to top

>gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 152539

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    aaacttataactcaaaaaca 83
             ||||||||||||||||||||
Sbjct: 89429 aaacttataactcaaaaaca 89410



to top

>dbj|AP000822.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-675B4, complete
            sequence
          Length = 94501

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 622  cctcttggaagaggtacttgcaaa 645
            ||||||||||||||||||| ||||
Sbjct: 9001 cctcttggaagaggtacttacaaa 8978



to top

>dbj|AB098806.1| Bos taurus mRNA for similar to ribosomal protein S10, partial cds,
           clone: ORCS12838
          Length = 614

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 459 atgccatcgttggtgaggtaccaatagtaatg 490
           ||||| ||||||||||||||||| ||| ||||
Sbjct: 318 atgccctcgttggtgaggtaccagtagaaatg 349



to top

>ref|NM_019623.2| Rattus norvegicus cytochrome P450, family 4, subfamily F, polypeptide
            2 (Cyp4f2), mRNA
          Length = 2119

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 579  gggtgcttcgccaggttgta 598
            ||||||||||||||||||||
Sbjct: 1173 gggtgcttcgccaggttgta 1154



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 580     ggtgcttcgccaggttgtag 599
               ||||||||||||||||||||
Sbjct: 1837679 ggtgcttcgccaggttgtag 1837660



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 217     gctggaagtctgcaggagct 236
               ||||||||||||||||||||
Sbjct: 2577266 gctggaagtctgcaggagct 2577285



to top

>ref|NM_001034716.1| Bos taurus similar to 40S ribosomal protein S10 (MGC127433), mRNA
          Length = 643

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 459 atgccatcgttggtgaggtaccaatagtaatg 490
           ||||| ||||||||||||||||| ||| ||||
Sbjct: 266 atgccctcgttggtgaggtaccagtagaaatg 235



to top

>emb|AL929314.9| Zebrafish DNA sequence from clone CH211-155E19 in linkage group 5,
             complete sequence
          Length = 176048

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    ataactcaaaaacatcacat 89
             ||||||||||||||||||||
Sbjct: 50013 ataactcaaaaacatcacat 49994



to top

>gb|AC138221.23| Mus musculus chromosome 15, clone RP23-204C16, complete sequence
          Length = 239740

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 382    caggaggcctggcagatttt 401
              ||||||||||||||||||||
Sbjct: 173232 caggaggcctggcagatttt 173251



to top

>emb|X15265.1|HSACM4 Homo sapiens gene for muscarinic acetylcholine receptor M4
          Length = 1703

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 406  gcgtggcaggcacaatctca 425
            ||||||||||||||||||||
Sbjct: 1190 gcgtggcaggcacaatctca 1171



to top

>dbj|AB065585.1| Homo sapiens gene for seven transmembrane helix receptor, complete
           cds, isolate:CBRC7TM_148
          Length = 913

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 406 gcgtggcaggcacaatctca 425
           ||||||||||||||||||||
Sbjct: 411 gcgtggcaggcacaatctca 392


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,614,040
Number of Sequences: 3902068
Number of extensions: 4614040
Number of successful extensions: 81841
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 108
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 81260
Number of HSP's gapped (non-prelim): 590
length of query: 705
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 682
effective length of database: 17,143,297,704
effective search space: 11691729034128
effective search space used: 11691729034128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top