ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags39p07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 797 0.0
2emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 702 0.0
3emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 567 e-158
4emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 472 e-130
5emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 440 e-120
6gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 440 e-120
7emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 335 8e-89
8emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 319 5e-84
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 303 3e-79
10gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 299 5e-78
11gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 299 5e-78
12emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 293 3e-76
13emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 289 5e-75
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 252 1e-63
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 214 2e-52
16gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 214 2e-52
17gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 206 5e-50
18gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 196 5e-47
19gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 190 3e-45
20gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 186 5e-44
21emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 186 5e-44
22gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 170 3e-39
23emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 139 1e-29
24emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 129 1e-26
25gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 115 1e-22
26dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
27dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
28dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
29gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 115 1e-22
30emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 113 6e-22
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 111 2e-21
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 111 2e-21
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 111 2e-21
36gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 103 6e-19
37emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 103 6e-19
38emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 103 6e-19
39emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 103 6e-19
40dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
41dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 6e-19
42emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 103 6e-19
43gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 103 6e-19
44emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 100 9e-18
45gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 96 1e-16
46emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 96 1e-16
47emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 96 1e-16
48dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
49dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
50gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 96 1e-16
51gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 96 1e-16
52gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 96 1e-16
53gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 96 1e-16
54gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 96 1e-16
55gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 96 1e-16
56gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 96 1e-16
57gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 96 1e-16
58gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 96 1e-16
59gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 96 1e-16
60gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 96 1e-16
61gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 96 1e-16
62gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 96 1e-16
63gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 96 1e-16
64gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 96 1e-16
65gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 96 1e-16
66gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 96 1e-16
67gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 96 1e-16
68gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 96 1e-16
69gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 96 1e-16
70gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 96 1e-16
71gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 96 1e-16
72gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 96 1e-16
73gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 96 1e-16
74gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 96 1e-16
75gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 96 1e-16
76gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 96 1e-16
77gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 96 1e-16
78gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 96 1e-16
79gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 96 1e-16
80gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 96 1e-16
81gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 96 1e-16
82gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 92 2e-15
83gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 88 3e-14
84gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 88 3e-14
85gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 88 3e-14
86gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 88 3e-14
87gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 88 3e-14
88gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 88 3e-14
89gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 88 3e-14
90gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 88 3e-14
91gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 88 3e-14
92gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 88 3e-14
93gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 88 3e-14
94gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 88 3e-14
95gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 88 3e-14
96gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 88 3e-14
97gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 88 3e-14
98dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
99dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
100dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 84 5e-13
101gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 80 8e-12
102gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 80 8e-12
103gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 80 8e-12
104dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
105dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
106dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
107dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
108gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 68 3e-08
109dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 62 2e-06
110gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 58 3e-05
111dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
112dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
113gb|AF114829.1| Oryza sativa lipid transfer protein gene, complet... 52 0.002
114gb|DQ083190.1| Oryza sativa (indica cultivar-group) clone 5S5B08... 48 0.029
115dbj|AK119681.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
116dbj|AK104005.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
117dbj|AK072917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
118dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
119dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
120dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
121dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
122dbj|AK060340.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
123dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
124dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.029
125gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein... 48 0.029
126gb|U29176.1|OSU29176 Oryza sativa lipid transfer protein precurs... 48 0.029
127emb|X96979.1|HVLTP7A2B H.vulgare mRNA for lipid transfer protein... 46 0.11
128gb|AY226580.1| Triticum aestivum lipid transfer protein 3 (LTP3)... 46 0.11
129emb|X60292.1|HVLTP1G Hordeum vulgare gene for LTP 1 46 0.11
130emb|X83433.1|OSLTPB21 O.sativa mRNA for lipid transfer protein, b21 46 0.11
131emb|X59253.1|HVLTP1 H.vulgare rearranged Ltp1 gene for lipid tra... 46 0.11
132emb|X05168.1|TAMYR1 Hordeum vulgare mRNA for putative amylase or... 46 0.11
133emb|AJ852561.1| Triticum aestivum mRNA for type 1 non specific l... 46 0.11
134emb|AJ852548.1| Triticum aestivum ltp9.4b gene for type 1 non sp... 46 0.11
135gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 46 0.11
136gb|M15207.1|BLYPAPI Barley (H.vulgare) probable amylase/protease... 46 0.11
137ref|XM_753742.1| Ustilago maydis 521 hypothetical protein (UM026... 44 0.45
138gb|AC121244.13| Medicago truncatula clone mth2-31b9, complete se... 44 0.45
139gb|AC149636.14| Medicago truncatula clone mth2-180a12, complete ... 44 0.45
140gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 ... 44 0.45
141gb|AY103916.1| Zea mays PCO094104 mRNA sequence 44 0.45
142gb|AY954904.1| Tadarida brasiliensis clone TabrE9 microsatellite... 42 1.8
143gb|AC124041.3| Oryctolagus cuniculus clone LB1-44O5, complete se... 42 1.8
144emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 1.8
145emb|AL133284.13| Human DNA sequence from clone RP11-67K19 on chr... 42 1.8
146emb|AL031769.1|HS194O8 Human DNA sequence from clone RP1-194O8 o... 42 1.8
147dbj|BS000564.1| Pan troglodytes chromosome Y clone:PTFY-001A01, ... 42 1.8
148gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 42 1.8
149gb|AC073433.9|AC073433 Arabidopsis thaliana chromosome 1 BAC F19... 42 1.8
150emb|AL928707.5| Zebrafish DNA sequence from clone CH211-207M2 in... 42 1.8
151ref|NM_183706.1| Oryza sativa (japonica cultivar-group), predic... 40 7.0
152gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.0
153emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on ch... 40 7.0
154emb|AL365185.11| Human DNA sequence from clone RP11-416C17 on ch... 40 7.0
155emb|AL133283.9| Human DNA sequence from clone RP11-31M2 on chrom... 40 7.0
156emb|AJ431709.1|BMU431709 Bungarus multicinctus a1 chain gene for... 40 7.0
157emb|AJ431708.1|BMU431708 Bungarus multicinctus a8 chain gene for... 40 7.0
158gb|AC125496.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.0
159gb|AC025039.7| Homo sapiens chromosome 10 clone RP11-457M15, com... 40 7.0
160dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 40 7.0
161gb|AC018508.9| Homo sapiens chromosome 10 clone RP11-123L21, com... 40 7.0
162gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mR... 40 7.0
163gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, co... 40 7.0
164gb|AC007304.11| Homo sapiens chromosome 13 clone 168l22 map 13q1... 40 7.0
165emb|AL929345.15| Zebrafish DNA sequence from clone DKEY-211H10 i... 40 7.0
166dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
167dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
168gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, r... 40 7.0
169gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 o... 40 7.0
170gb|AF198168.1|AF198168 Aerides japonica phospholipid transfer pr... 40 7.0
171dbj|AP003722.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
172dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
173dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.0
174emb|AJ431710.1|BMU431710 Bungarus multicinctus a1a chain gene fo... 40 7.0
175emb|AJ431707.1|BMU431707 Bungarus multicinctus a2 chain gene for... 40 7.0
176gb|AF178571.1|AF178571 Lycopersicon esculentum phytochrome E (PH... 40 7.0
177gb|AY109327.1| Zea mays CL468_1 mRNA sequence 40 7.0
178emb|AL954838.14| Zebrafish DNA sequence from clone DKEY-12B15 in... 40 7.0
179gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96... 40 7.0

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  797 bits (402), Expect = 0.0
 Identities = 414/419 (98%)
 Strand = Plus / Minus

                                                                       
Query: 99  gttgtgtaaatatcctcaacgtactcagcgtctcagcatcgatagctggagctataggca 158
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 517 gttgtgtaaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggca 458

                                                                       
Query: 159 gaaacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgat 218
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 457 gaaacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgat 398

                                                                       
Query: 219 ggagtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaa 278
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 397 ggagtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaa 338

                                                                       
Query: 279 cccagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgc 338
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 337 cccagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgc 278

                                                                       
Query: 339 tgcgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgcc 398
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 277 tgcgccggccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgcc 218

                                                                       
Query: 399 gctggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgc 458
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 gctggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgc 158

                                                                      
Query: 459 gtcggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
           |||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 157 gtcggcggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctg 99



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                             
Query: 43  ggagataatatatgagatcatttattcatatata 76
           ||||||||||||||||||||||||||||||||||
Sbjct: 573 ggagataatatatgagatcatttattcatatata 540



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  702 bits (354), Expect = 0.0
 Identities = 402/419 (95%)
 Strand = Plus / Minus

                                                                       
Query: 99  gttgtgtaaatatcctcaacgtactcagcgtctcagcatcgatagctggagctataggca 158
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 446 gttgtgtaaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggca 387

                                                                       
Query: 159 gaaacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgat 218
           | || || | |||||||||||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 386 gcaaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgat 327

                                                                       
Query: 219 ggagtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaa 278
           || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| 
Sbjct: 326 ggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttag 267

                                                                       
Query: 279 cccagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgc 338
           |||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 266 cccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgc 207

                                                                       
Query: 339 tgcgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgcc 398
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 206 tgcgccggccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgcc 147

                                                                       
Query: 399 gctggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgc 458
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 146 gctggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgc 87

                                                                      
Query: 459 gtcggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
           |||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 86  gtcggcggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctg 28



 Score =  143 bits (72), Expect = 7e-31
 Identities = 75/76 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   gctggctcaacgtacgtacttctctctctttttctcccacatggagataatatatgagat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 546 gctggctcaacgtacgtacttctctctctttttctcccacatggagataatatatgagag 487

                           
Query: 61  catttattcatatata 76
           ||||||||||||||||
Sbjct: 486 catttattcatatata 471



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  567 bits (286), Expect = e-158
 Identities = 385/419 (91%)
 Strand = Plus / Minus

                                                                        
Query: 99   gttgtgtaaatatcctcaacgtactcagcgtctcagcatcgatagctggagctataggca 158
            |||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||
Sbjct: 1461 gttgtgtaaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggca 1402

                                                                        
Query: 159  gaaacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgat 218
            | || || | |||||||||||||||||| |||||||||||||||||||||||| ||||||
Sbjct: 1401 gcaaggatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgat 1342

                                                                        
Query: 219  ggagtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaa 278
            || |||||||||||||||||||||| |||||||||| |||||||||||||||||||||| 
Sbjct: 1341 ggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttag 1282

                                                                        
Query: 279  cccagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgc 338
            |||| | |||||||||||||||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 1281 cccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggc 1222

                                                                        
Query: 339  tgcgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgcc 398
            ||||||||||| ||||||||||||||||||||| |||  |||| |  || ||||||||||
Sbjct: 1221 tgcgccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgcc 1162

                                                                        
Query: 399  gctggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgc 458
            || ||||||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||
Sbjct: 1161 gcgggcataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgc 1102

                                                                       
Query: 459  gtcggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
            ||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 1101 gtcggtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctg 1043



 Score =  109 bits (55), Expect = 9e-21
 Identities = 74/80 (92%), Gaps = 4/80 (5%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggctcaacgtacgtacttctctctct----ttttctcccacatggagataatatatg 56
            |||||||||||||||||||||||||||||    || ||||||||||||||||||||||||
Sbjct: 1552 gctggctcaacgtacgtacttctctctctctctttctctcccacatggagataatatatg 1493

                                
Query: 57   agatcatttattcatatata 76
            ||| ||||||||||||||||
Sbjct: 1492 agagcatttattcatatata 1473



to top

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  472 bits (238), Expect = e-130
 Identities = 317/344 (92%)
 Strand = Plus / Minus

                                                                       
Query: 167 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 226
           ||||||||||||| |||||| |||||||||||||||||||||||| |||||||| |||||
Sbjct: 423 ggcagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagg 364

                                                                       
Query: 227 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 286
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| | |
Sbjct: 363 ggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccag 304

                                                                       
Query: 287 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 346
           ||||||||||||||||||||||| ||||||| ||||||||||||||||| || |||||||
Sbjct: 303 cagcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccgg 244

                                                                       
Query: 347 ccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcat 406
           ||| ||||||||||||||||||||| |||| |||| |  || |||||||||||| |||||
Sbjct: 243 ccagtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcat 184

                                                                       
Query: 407 aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 466
           |||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 183 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcgg 124

                                                       
Query: 467 ctacnaggagcatagcggncaccatggcgaccagcacgagctga 510
           |||| |||||||| |||| ||||| |||||||||||||||||||
Sbjct: 123 ctacgaggagcatggcggccaccagggcgaccagcacgagctga 80



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/42 (90%), Gaps = 2/42 (4%)
 Strand = Plus / Minus

                                                     
Query: 35  tcccacatggagataatatatgagatcatttattcatatata 76
           ||||||||| |||||||||  |||| ||||||||||||||||
Sbjct: 513 tcccacatgaagataatat--gagagcatttattcatatata 474



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  440 bits (222), Expect = e-120
 Identities = 318/351 (90%)
 Strand = Plus / Minus

                                                                        
Query: 167  ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 226
            ||||||||||||| |||||| |||||||||||||||| |||||||  ||||||| |||||
Sbjct: 1028 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 969

                                                                        
Query: 227  ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 286
            ||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | |
Sbjct: 968  ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 909

                                                                        
Query: 287  cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 346
            ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct: 908  cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 849

                                                                        
Query: 347  ccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcat 406
            ||| ||||||||| ||||||||||| |||  |||| |  || |||||||||||| |||||
Sbjct: 848  ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 789

                                                                        
Query: 407  aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 466
            |||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||  |
Sbjct: 788  aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 729

                                                               
Query: 467  ctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
            |||| | |||||| |||| |||||||||||||||||||||||||||| |||
Sbjct: 728  ctacgatgagcatggcggccaccatggcgaccagcacgagctgagtagctg 678



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  440 bits (222), Expect = e-120
 Identities = 318/351 (90%)
 Strand = Plus / Minus

                                                                        
Query: 167  ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 226
            ||||||||||||| |||||| |||||||||||||||| |||||||  ||||||| |||||
Sbjct: 2424 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 2365

                                                                        
Query: 227  ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 286
            ||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | |
Sbjct: 2364 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 2305

                                                                        
Query: 287  cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 346
            ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct: 2304 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 2245

                                                                        
Query: 347  ccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcat 406
            ||| ||||||||| ||||||||||| |||  |||| |  || |||||||||||| |||||
Sbjct: 2244 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 2185

                                                                        
Query: 407  aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 466
            |||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||  |
Sbjct: 2184 aggagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtag 2125

                                                               
Query: 467  ctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
            |||| | |||||| |||| |||||||||||||||||||||||||||| |||
Sbjct: 2124 ctacgatgagcatggcggccaccatggcgaccagcacgagctgagtagctg 2074



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  335 bits (169), Expect = 8e-89
 Identities = 305/351 (86%)
 Strand = Plus / Minus

                                                                        
Query: 161  aacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatgg 220
            ||||| ||||||||||| |||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 1627 aacgatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatgg 1568

                                                                        
Query: 221  agtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacc 280
             |||||||||||| ||||||||||| | |||||||||||||||||||||||| || | ||
Sbjct: 1567 cgtaggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcc 1508

                                                                        
Query: 281  cagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctg 340
            |||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||
Sbjct: 1507 cagcagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctg 1448

                                                                        
Query: 341  cgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgc 400
             || ||| |  ||| | |||||||||||||| |||| ||   || || ||||||||||||
Sbjct: 1447 agctggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgc 1388

                                                                        
Query: 401  tggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgt 460
              |||||||| |||||||||| |||||||||||||||||||||||| || | ||| || |
Sbjct: 1387 gtgcataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcct 1328

                                                               
Query: 461  cggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgag 511
            | | | || | ||||||||||||| ||||| |||||| ||||||| |||||
Sbjct: 1327 ccgtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgag 1277



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 52   atatgagatcatttattcatatata 76
            |||||||| ||||||||||||||||
Sbjct: 1733 atatgagagcatttattcatatata 1709



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  319 bits (161), Expect = 5e-84
 Identities = 303/351 (86%)
 Strand = Plus / Minus

                                                                        
Query: 161  aacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatgg 220
            ||||| ||||||||||| |||||||| ||||||||||||||||||| |||| ||||||||
Sbjct: 1639 aacgatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatgg 1580

                                                                        
Query: 221  agtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacc 280
             |||||||||||| ||||||||||| | ||||||||||||||||||||||||||| | ||
Sbjct: 1579 cgtaggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcc 1520

                                                                        
Query: 281  cagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctg 340
            |||| |||||||||||||||||||||||| ||||||||||||||||||||||| | ||||
Sbjct: 1519 cagcagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctg 1460

                                                                        
Query: 341  cgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgc 400
             || ||| |  ||| | |||||||||||||| |||| ||   || || ||||||||||||
Sbjct: 1459 agctggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgc 1400

                                                                        
Query: 401  tggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgt 460
              |||||||| |||||||||| |||||||||||||||||||||||| || |  || || |
Sbjct: 1399 gtgcataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcct 1340

                                                               
Query: 461  cggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgag 511
            | | | || | ||||||||||||| ||||| |||||| ||||||| |||||
Sbjct: 1339 ccgtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgag 1289



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  303 bits (153), Expect = 3e-79
 Identities = 301/351 (85%)
 Strand = Plus / Minus

                                                                       
Query: 161 aacgacggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatgg 220
           ||||| ||||||| ||| |||||||| ||||||||||||||||||| |||| ||||||||
Sbjct: 436 aacgatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatgg 377

                                                                       
Query: 221 agtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacc 280
            |||||||| ||| ||||||||||| | ||||||||||||||||||||||||||| | ||
Sbjct: 376 cgtaggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcc 317

                                                                       
Query: 281 cagcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctg 340
           |||| |||||||||||||| ||||||||| ||||||||||||||||||||||| | ||||
Sbjct: 316 cagcagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctg 257

                                                                       
Query: 341 cgccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgc 400
            || ||| |  ||| | |||||||||||||| |||| || | || || ||||||||||||
Sbjct: 256 agctggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgc 197

                                                                       
Query: 401 tggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgt 460
             |||||||| |||||||||| |||||||||||||||||||||||| || |  || || |
Sbjct: 196 gtgcataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcct 137

                                                              
Query: 461 cggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgag 511
           | | | || | ||||||||||||| ||||| |||||| ||||||| |||||
Sbjct: 136 ccgtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgag 86



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 50  atatatgagatcatttattcatatata 76
           |||||||||| ||||||||||||||||
Sbjct: 542 atatatgagagcatttattcatatata 516



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  299 bits (151), Expect = 5e-78
 Identities = 284/329 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||| ||||||||||||||||||| |||| |||||||| |||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           ||| | ||||||||| ||||||||||||||||| | |||||| |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           ||||||| ||||||||||||||||||||||| | |||| || ||| |  ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
           ||||||||| |||| || | || || ||||||||||||  |||||||| |||||||||| 
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagcatagc 482
           |||||||||||||||||||||||| || | ||| || || | |||| | |||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 483 ggncaccatggcgaccagcacgagctgag 511
           || ||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  299 bits (151), Expect = 5e-78
 Identities = 284/329 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||| ||||||||||||||||||| |||| |||||||| |||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           ||| | ||||||||| ||||||||||||||||| | |||||| |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           ||||||| ||||||||||||||||||||||| | |||| || ||| |  ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
           ||||||||| |||| || | || || ||||||||||||  |||||||| |||||||||| 
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagcatagc 482
           |||||||||||||||||||||||| || | ||| || || | |||| | |||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 483 ggncaccatggcgaccagcacgagctgag 511
           || ||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  293 bits (148), Expect = 3e-76
 Identities = 247/280 (88%)
 Strand = Plus / Minus

                                                                       
Query: 167 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 226
           ||||||||||| |||||||| ||||||||||||||||||| |||| |||||||| ||| |
Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270

                                                                       
Query: 227 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 286
           ||||||| ||||||||||| | ||||||||||||||||||||||||||| | |||||| |
Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 210

                                                                       
Query: 287 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 346
           ||||||||||||||||||||||| ||||||||||||||||||||||| | |||| || ||
Sbjct: 209 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 150

                                                                       
Query: 347 ccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcat 406
           | |  ||| | |||||||||||||| |||| ||   || || ||||||||||||  ||||
Sbjct: 149 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 90

                                                   
Query: 407 aggaaatgcaggggcgcaaggcagagctcacctgaccgca 446
           |||| |||||||||| ||||||||||||||||||||||||
Sbjct: 89  aggagatgcaggggctcaaggcagagctcacctgaccgca 50



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 52  atatgagatcatttattcatatata 76
           |||||||| ||||||||||||||||
Sbjct: 437 atatgagagcatttattcatatata 413



to top

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  289 bits (146), Expect = 5e-75
 Identities = 206/227 (90%)
 Strand = Plus / Minus

                                                                       
Query: 291 gctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaa 350
           |||||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 351 tctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcatagga 410
           ||||||||||||||||||||| |||  |||| |  || |||||||||||| |||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 411 aatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctac 470
            ||||| |||| ||||||||||||||||||||||||||||||||| ||||||| ||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106

                                                          
Query: 471 naggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
            ||||||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctg 59



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 212 tgctgatggagtaggggacgctgacgccgcacttg 246
           ||||||||| | |||| ||||||||||||||||||
Sbjct: 373 tgctgatggggaagggcacgctgacgccgcacttg 339



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  252 bits (127), Expect = 1e-63
 Identities = 241/279 (86%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||| |||||||||||||||| ||||| | ||| |||| |||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           ||||||||||||||| |||||||| |||||||| | |||| | ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           ||||||| ||||||||||||||||||||||| |||||||||||||||  ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
            |||||||| |||| |||  || ||  |||| ||||||  |||||||| |||||||||| 
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                  
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtc 461
           |||||||||||||||||| || |||||||| || |||||
Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtc 70



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  214 bits (108), Expect = 2e-52
 Identities = 274/330 (83%)
 Strand = Plus / Minus

                                                                        
Query: 179  tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
            |||||||||| |||||||||||||| ||||| | ||||||||||||||||| ||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149

                                                                        
Query: 239  cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
            |||||||||||||||| |  || ||||| || | ||| | |||| ||||||| |||||||
Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089

                                                                        
Query: 299  tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
            ||||| ||||  ||||||||||||| ||||||||| |||||  ||||||||||||| | |
Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029

                                                                        
Query: 359  cgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcagg 418
            | |||   ||||| |||  |||| || || | ||| ||||  | || ||||| | |||||
Sbjct: 3028 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 2969

                                                                        
Query: 419  ggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagca 478
             |  || ||||||| ||||||||||||||||||| || ||||||| |||||| |||||||
Sbjct: 2968 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 2909

                                          
Query: 479  tagcggncaccatggcgaccagcacgagct 508
            | || | ||||| |||||||||||||||||
Sbjct: 2908 ttgccgccaccagggcgaccagcacgagct 2879



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  214 bits (108), Expect = 2e-52
 Identities = 274/330 (83%)
 Strand = Plus / Minus

                                                                       
Query: 179 tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
           |||||||||| |||||||||||||| ||||| | ||||||||||||||||| ||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353

                                                                       
Query: 239 cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
           |||||||||||||||| |  || ||||| || | ||| | |||| ||||||| |||||||
Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293

                                                                       
Query: 299 tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
           ||||| ||||  ||||||||||||| ||||||||| |||||  ||||||||||||| | |
Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233

                                                                       
Query: 359 cgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcagg 418
           | |||   ||||| |||  |||| || || | ||| ||||  | || ||||| | |||||
Sbjct: 232 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 173

                                                                       
Query: 419 ggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagca 478
            |  || ||||||| ||||||||||||||||||| || ||||||| |||||| |||||||
Sbjct: 172 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 113

                                         
Query: 479 tagcggncaccatggcgaccagcacgagct 508
           | || | ||||| |||||||||||||||||
Sbjct: 112 ttgccgccaccagggcgaccagcacgagct 83



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  206 bits (104), Expect = 5e-50
 Identities = 270/326 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||||| |||||||||||||| ||||| | ||||||||||||||||| ||||||||||||
Sbjct: 348 tcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           |||||||||||| |  || ||||| || | ||| | |||| ||||||| |||||||||||
Sbjct: 288 cttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           | ||||  ||||||||||||| ||||||||| |||||  ||||||||||||| | || ||
Sbjct: 228 cctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactcc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
           |   ||||| |||  |||| || || | ||| ||||  | || ||||| | ||||| |  
Sbjct: 168 ggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggc 109

                                                                       
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagcatagc 482
           || ||||||| ||||||||||||||||||| || ||||||| |||||| |||||||| ||
Sbjct: 108 cagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgc 49

                                     
Query: 483 ggncaccatggcgaccagcacgagct 508
            | ||||| |||||||||||||||||
Sbjct: 48  cgccaccagggcgaccagcacgagct 23



to top

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  196 bits (99), Expect = 5e-47
 Identities = 246/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 222 gtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaaccc 281
           ||||||||||||||||| |||||||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 282 agcggcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgc 341
           | ||||||| ||||||||||||  |||| |||||| |||||||||||   ||||| ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 342 gccggccaatctcttgacgccgctgcagcaagccggaggcaggatgccgccgttgccgct 401
           ||||||||||||| |||||||||||||||| |||| || | || || |||||||||||| 
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 402 ggcataggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtc 461
            |||||||||| ||| ||||  | ||| ||||||||||| ||||||||||| || |||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70

                                                                   
Query: 462 ggcggctacnaggagcatagcggncaccatggcgaccagcacgagctgagtanctg 517
           || |||||| ||||| |  || | ||||| ||||||||||||||||| |||| |||
Sbjct: 69  ggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctg 14



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  190 bits (96), Expect = 3e-45
 Identities = 268/326 (82%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||||| ||||||||||| || ||||| | ||||||||||||||||| ||||||||||||
Sbjct: 348 tcagtggatcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           |||||||||||| |  || ||||| || | ||| | |||| ||||||| |||||||||||
Sbjct: 288 cttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           | ||||  ||||||||||||| ||||||||| |||||  ||||||||||||| | || ||
Sbjct: 228 cctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactcc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
           |   ||||| |||  |||| || || | ||| ||||  | || ||||| | ||||| |  
Sbjct: 168 ggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggc 109

                                                                       
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagcatagc 482
           || ||||||| ||||||||||||||| ||| || ||||||| |||||| |||||||| ||
Sbjct: 108 cagggcagagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgc 49

                                     
Query: 483 ggncaccatggcgaccagcacgagct 508
            | ||||| |||||||||||||||||
Sbjct: 48  cgccaccagggcgaccagcacgagct 23



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  186 bits (94), Expect = 5e-44
 Identities = 277/339 (81%)
 Strand = Plus / Minus

                                                                       
Query: 179 tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
           |||||||||| |||||||||||||| ||||| | |||||| | |||||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372

                                                                       
Query: 239 cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
           ||||||||||||| ||||| |||||||||   | ||| | |||  ||||| | |||||||
Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312

                                                                       
Query: 299 tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
            |||| ||||    ||||||||||| ||||||||| |||||  |||||||||| || |||
Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252

                                                                       
Query: 359 cgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcagg 418
           ||||||||||||| |||  || | || ||   ||| ||||  | |||||||  | |||||
Sbjct: 251 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 192

                                                                       
Query: 419 ggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagca 478
           ||  |||||||||||||||||| ||||||  |||||| ||||||| |||| | |||| ||
Sbjct: 191 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 132

                                                  
Query: 479 tagcggncaccatggcgaccagcacgagctgagtanctg 517
           | || | ||||| ||||||||||||||||| |||| |||
Sbjct: 131 ttgccgccaccagggcgaccagcacgagcttagtagctg 93



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  186 bits (94), Expect = 5e-44
 Identities = 277/339 (81%)
 Strand = Plus / Minus

                                                                       
Query: 179 tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
           |||||||||| |||||||||||||| ||||| | |||||| | |||||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313

                                                                       
Query: 239 cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
           ||||||||||||| ||||| |||||||||   | ||| | |||  ||||| | |||||||
Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253

                                                                       
Query: 299 tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
            |||| ||||    ||||||||||| ||||||||| |||||  |||||||||| || |||
Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193

                                                                       
Query: 359 cgccgctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcagg 418
           ||||||||||||| |||  || | || ||   ||| ||||  | |||||||  | |||||
Sbjct: 192 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 133

                                                                       
Query: 419 ggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagca 478
           ||  |||||||||||||||||| ||||||  |||||| ||||||| |||| | |||| ||
Sbjct: 132 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 73

                                                  
Query: 479 tagcggncaccatggcgaccagcacgagctgagtanctg 517
           | || | ||||| ||||||||||||||||| |||| |||
Sbjct: 72  ttgccgccaccagggcgaccagcacgagcttagtagctg 34



to top

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  170 bits (86), Expect = 3e-39
 Identities = 264/324 (81%)
 Strand = Plus / Minus

                                                                       
Query: 183 tcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgca 242
           |||||| |||||||||||||| ||||| | |||||| | |||||||||||||||||||||
Sbjct: 348 tcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgca 289

                                                                       
Query: 243 cttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttgatgca 302
           ||||||||| ||||| |||||||||   | ||| | |||  ||||| | ||||||| |||
Sbjct: 288 cttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggca 229

                                                                       
Query: 303 cttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttgacgcc 362
           | ||||    ||||||||||| ||||||||| |||||  |||||||||| || |||||||
Sbjct: 228 cctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgcc 169

                                                                       
Query: 363 gctgcagcaagccggaggcaggatgccgccgttgccgctggcataggaaatgcaggggcg 422
           ||||||||| |||  || | || ||   ||| ||||  | |||||||  | |||||||  
Sbjct: 168 gctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggt 109

                                                                       
Query: 423 caaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnaggagcatagc 482
           |||||||||||||||||| ||||||  |||||| ||||||| |||| | |||| ||| ||
Sbjct: 108 caaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgc 49

                                   
Query: 483 ggncaccatggcgaccagcacgag 506
            | ||||| |||||||||||||||
Sbjct: 48  cgccaccagggcgaccagcacgag 25



to top

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  139 bits (70), Expect = 1e-29
 Identities = 170/202 (84%), Gaps = 1/202 (0%)
 Strand = Plus / Minus

                                                                       
Query: 170 agcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagggga 229
           |||| ||| |||||||||| |||||||||||||||||    | |||||| | ||||||||
Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372

                                                                       
Query: 230 cgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcag 289
           |||||||||||||| ||||||||||||| |||||| |||| |||||  || |  ||||| 
Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313

                                                                       
Query: 290 cgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggcca 349
           | ||||||| |||| |||||   ||||||||||| ||||||||| |||||  ||||||||
Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253

                                 
Query: 350 atctcttgacgccgctgcagca 371
           |||||||||| ||||| |||||
Sbjct: 252 atctcttgactccgctacagca 231



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 81/95 (85%), Gaps = 2/95 (2%)
 Strand = Plus / Minus

                                                                       
Query: 414 gcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnag 473
           |||||||| |||||||||||||||||| ||||||| ||||   |||||||||||||| ||
Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgag 132

                                              
Query: 474 gagcatagcggncaccatggcgaccagcacgagct 508
           |||||| || | ||||| ||  |||||| ||||||
Sbjct: 131 gagcattgccgccaccaggggcaccagcgcgagct 97



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  129 bits (65), Expect = 1e-26
 Identities = 161/193 (83%)
 Strand = Plus / Minus

                                                                       
Query: 179 tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
           |||||||||| ||||| |||||||||||    | |||||| | |||||||||||||||||
Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295

                                                                       
Query: 239 cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
           ||||| ||||||||||||| |||||| |||| |||||  || |  ||||  | |||||||
Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235

                                                                       
Query: 299 tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
            |||| |||||   ||||||||||| ||||||||| |||||  |||||||||||||||||
Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175

                        
Query: 359 cgccgctgcagca 371
           | ||||| |||||
Sbjct: 174 ctccgctacagca 162



 Score =  113 bits (57), Expect = 6e-22
 Identities = 85/95 (89%)
 Strand = Plus / Minus

                                                                       
Query: 414 gcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnag 473
           |||||||| |||||||||||||||||| ||||||| |||||| |||||||||||||| ||
Sbjct: 119 gcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgag 60

                                              
Query: 474 gagcatagcggncaccatggcgaccagcacgagct 508
           |||||| || | ||||| |||||||||| ||||||
Sbjct: 59  gagcattgccgccaccagggcgaccagcgcgagct 25



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  115 bits (58), Expect = 1e-22
 Identities = 76/82 (92%)
 Strand = Plus / Plus

                                                                         
Query: 194   tagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggagggga 253
             |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                   
Query: 254   tgccggcggccttgccagcgtt 275
             ||| |||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgtt 94102



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  115 bits (58), Expect = 1e-22
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                            
Query: 194      tagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggagggga 253
                |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                      
Query: 254      tgccggcggccttgccagcgtt 275
                ||| |||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgtt 13089978



 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgtt 702362



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||  ||||| |||||||| |||||||| | ||||| |||||||||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 256    ccggcg 261
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |||||||
Sbjct: 684221 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctggggatg 684162

                            
Query: 256    ccggcggccttgcc 269
                |||||| |||||
Sbjct: 684161 gaggcggcgttgcc 684148



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 228    gacgctgacgccgcacttggaggggatgccggcggc 263
              |||| ||||||||||||||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  115 bits (58), Expect = 1e-22
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                       
Query: 194 tagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggagggga 253
           |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                 
Query: 254 tgccggcggccttgccagcgtt 275
           ||| |||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgtt 378



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  115 bits (58), Expect = 1e-22
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                       
Query: 194 tagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggagggga 253
           |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                 
Query: 254 tgccggcggccttgccagcgtt 275
           ||| |||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgtt 377



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  115 bits (58), Expect = 1e-22
 Identities = 76/82 (92%)
 Strand = Plus / Minus

                                                                            
Query: 194      tagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggagggga 253
                |||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                      
Query: 254      tgccggcggccttgccagcgtt 275
                ||| |||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgtt 13170157



 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgtt 702362



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||  ||||| |||||||| |||||||| | ||||| |||||||||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 256    ccggcg 261
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |||||||
Sbjct: 684221 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctggggatg 684162

                            
Query: 256    ccggcggccttgcc 269
                |||||| |||||
Sbjct: 684161 gaggcggcgttgcc 684148



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 228    gacgctgacgccgcacttggaggggatgccggcggc 263
              |||| ||||||||||||||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  113 bits (57), Expect = 6e-22
 Identities = 159/193 (82%)
 Strand = Plus / Minus

                                                                       
Query: 179 tcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgc 238
           |||||||||| ||||| |||||||||||    | |||||| | ||||||||||||||| |
Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366

                                                                       
Query: 239 cgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgctcttga 298
           ||||| ||||||||||||| |||||| | || |||||  || |  ||||  | |||||||
Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306

                                                                       
Query: 299 tgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatctcttga 358
            |||| |||||   ||||||||||| ||||||||| |||||  |||||||||||||||||
Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246

                        
Query: 359 cgccgctgcagca 371
           | ||||| |||||
Sbjct: 245 ctccgctacagca 233



 Score =  113 bits (57), Expect = 6e-22
 Identities = 85/95 (89%)
 Strand = Plus / Minus

                                                                       
Query: 414 gcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacnag 473
           |||||||| |||||||||||||||||| ||||||| |||||| |||||||||||||| ||
Sbjct: 190 gcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgag 131

                                              
Query: 474 gagcatagcggncaccatggcgaccagcacgagct 508
           |||||| || | ||||| |||||||||| ||||||
Sbjct: 130 gagcattgccgccaccagggcgaccagcgcgagct 96



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  111 bits (56), Expect = 2e-21
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgtt 736664



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 256    ccggcg 261
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 228    gacgctgacgccgcacttggaggggatgccggcggc 263
              |||| ||||||||||||||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |||||||
Sbjct: 727244 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctggggatg 727185

                            
Query: 256    ccggcggccttgcc 269
                |||||| |||||
Sbjct: 727184 gaggcggcgttgcc 727171



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  111 bits (56), Expect = 2e-21
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgtt 334



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  111 bits (56), Expect = 2e-21
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgtt 591



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  111 bits (56), Expect = 2e-21
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgtt 736664



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 256    ccggcggccttgccagcgtt 275
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 256    ccggcg 261
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 228    gacgctgacgccgcacttggaggggatgccggcggc 263
              |||| ||||||||||||||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 196    gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
              |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |||||||
Sbjct: 727244 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctggggatg 727185

                            
Query: 256    ccggcggccttgcc 269
                |||||| |||||
Sbjct: 727184 gaggcggcgttgcc 727171



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  111 bits (56), Expect = 2e-21
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                 
Query: 256   ccggcggccttgccagcgtt 275
             | |||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgtt 42470



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 256   ccggcggccttgccagcgtt 275
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 256   ccggcg 261
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 228   gacgctgacgccgcacttggaggggatgccggcggc 263
             |||| ||||||||||||||  |||||||||||||||
Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |||||||
Sbjct: 51890 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctggggatg 51949

                           
Query: 256   ccggcggccttgcc 269
               |||||| |||||
Sbjct: 51950 gaggcggcgttgcc 51963



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgtt 347



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 430 gagctcacctgaccgcaggagatggc 455
           ||||||||||| ||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggc 29



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 430 gagctcacctgaccgcaggagatggc 455
           ||||||||||| ||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggc 729



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           ||||| |||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgtt 359



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                        
Query: 196  gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
            |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                
Query: 256  ccggcggccttgccagcgtt 275
            | |||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgtt 2366



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgtt 243



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                 
Query: 256   ccggcggccttgccagcgtt 275
             | |||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgtt 40610



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 256   ccggcggccttgccagcgtt 275
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||  ||||| |||||||| |||||||| | ||||| |||||||||||||||||
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 256   ccggcg 261
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |||||||
Sbjct: 58751 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctggggatg 58810

                           
Query: 256   ccggcggccttgcc 269
               |||||| |||||
Sbjct: 58811 gaggcggcgttgcc 58824



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 228   gacgctgacgccgcacttggaggggatgccggcggc 263
             |||| ||||||||||||||  |||||||||||||||
Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score =  103 bits (52), Expect = 6e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           ||||| |||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgtt 359



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 68/74 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 256 ccggcggccttgcc 269
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           ||||||| || ||||| |||||||| |||||||||||||||||||||||| |||||||||
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgtt 294



to top

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 73/80 (91%), Gaps = 1/80 (1%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||||| |||||||| |||||| |||||||||||||||||||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgtt 334



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ctcttgacgccgctgcagca 371
           ||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagca 141



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ctcttgacgccgctgcagca 371
           ||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagca 141



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ctcttgacgccgctgcagca 371
           ||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagca 267



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 64/70 (91%)
 Strand = Plus / Minus

                                                                       
Query: 208 gaagtgctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggccttg 267
           |||| |||||||| |||||||| |||||||||||||||||||||||||| |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                     
Query: 268 ccagcgttta 277
           || |||||||
Sbjct: 265 ccggcgttta 256



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 374 ctggcggc 367



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| ||||||||||||||||||||| |||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 356 ctggcggc 349



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 281 ctggcggc 274



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 380 ctggcggc 373



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 395 ctggcggc 388



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 204 ctggcggc 197



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 391 ctggcggc 384



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 213 gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggccttgccagc 272
           |||||||| |||||||| |||||||||||||||||||||||||| |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 273 gtt 275
           |||
Sbjct: 157 gtt 159



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 196      gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
                |||||||||  ||||| |||||||| |||||||| | |||||||||||||||||||||||
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 256      ccggcg 261
                ||||||
Sbjct: 14437004 ccggcg 14436999



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       cttctctctctttttctccc 38
                ||||||||||||||||||||
Sbjct: 34293411 cttctctctctttttctccc 34293392



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 21       tctctctctttttctcccac 40
                ||||||||||||||||||||
Sbjct: 30935988 tctctctctttttctcccac 30936007



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 196   gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
             |||||||||  ||||| |||||||| |||||||| | |||||||||||||||||||||||
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 256   ccggcg 261
             ||||||
Sbjct: 45502 ccggcg 45497



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||| ||| | |||||||| ||||||||   |||||||||||||||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 256 ccggcggccttgccagcgtt 275
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| ||||||||||  ||||||| |||||||||||||||||||||||||
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 259 ctggcggc 252



to top

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||| |||||||||| |||||||| ||||||||| |||||||||||||||
Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261

                   
Query: 256 ccggcggc 263
           | ||||||
Sbjct: 260 ctggcggc 253



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 352 ctcttgacgccgctgcagca 371
           ||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagca 136



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 256 ccggcg 261
           ||||||
Sbjct: 370 ccggcg 365



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 196  gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
            |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 256  ccggcg 261
            ||||||
Sbjct: 3456 ccggcg 3451



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||||| |||||| | |||||||| | |||||||||||||||||||||||
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 256 ccggcg 261
           ||||||
Sbjct: 372 ccggcg 367



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||||| |||||||| |||||||| | ||||| |||||||||||||||||
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 256 ccggcg 261
           ||||||
Sbjct: 374 ccggcg 369



to top

>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||||| |||||| | |||||||| | |||| ||||||||||||||||||
Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325

                 
Query: 256 ccggcg 261
           ||||||
Sbjct: 324 ccggcg 319



to top

>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||  ||||| |||||||  |||||||| | ||||| |||||||||||||||||
Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82

              
Query: 256 ccg 258
           |||
Sbjct: 81  ccg 79



to top

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 213  gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcg 261
            |||||||| |||||||| | ||||||||||||||  |||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722



to top

>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctg 390

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 389 gggatggaggcggcgttgcc 370



to top

>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctg 390

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 389 gggatggaggcggcgttgcc 370



to top

>gb|AF114829.1| Oryza sativa lipid transfer protein gene, complete cds
          Length = 1802

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggaggggatg 255
           |||||||||||||| |||||||||| | ||| ||||  ||||||||| |||  |||||||
Sbjct: 913 gagcagtcgacggaggtgctgatggggaaggcgacggagacgccgcatttgctggggatg 854

                         
Query: 256 ccggcggccttgcc 269
             |||||| |||||
Sbjct: 853 gaggcggcgttgcc 840



to top

>gb|DQ083190.1| Oryza sativa (indica cultivar-group) clone 5S5B08 mRNA sequence
          Length = 220

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 114 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 55

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 54  gggatggaggcggcgttgcc 35



to top

>dbj|AK119681.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H12, full
           insert sequence
          Length = 653

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 390

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 389 gggatggaggcggcgttgcc 370



to top

>dbj|AK104005.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-F05, full
           insert sequence
          Length = 668

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 390

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 389 gggatggaggcggcgttgcc 370



to top

>dbj|AK072917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023148L05, full
           insert sequence
          Length = 669

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 450 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 391

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 390 gggatggaggcggcgttgcc 371



to top

>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full
           insert sequence
          Length = 760

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 228 gacgctgacgccgcacttggaggggatgccggcggc 263
           |||| ||||||||||||||  |||||||||||||||
Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365



to top

>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full
            insert sequence
          Length = 2914

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 228  gacgctgacgccgcacttggaggggatgccggcggc 263
            |||| ||||||||||||||  |||||||||||||||
Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452



to top

>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full
           insert sequence
          Length = 646

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 228 gacgctgacgccgcacttggaggggatgccggcggc 263
           |||| ||||||||||||||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359



to top

>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full
           insert sequence
          Length = 928

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 228 gacgctgacgccgcacttggaggggatgccggcggc 263
           |||| ||||||||||||||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364



to top

>dbj|AK060340.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D02, full
           insert sequence
          Length = 669

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 390

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 389 gggatggaggcggcgttgcc 370



to top

>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full
           insert sequence
          Length = 853

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 228 gacgctgacgccgcacttggaggggatgccggcggc 263
           |||| ||||||||||||||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359



to top

>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full
           insert sequence
          Length = 773

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 228 gacgctgacgccgcacttggaggggatgccggcggc 263
           |||| ||||||||||||||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364



to top

>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA,
           complete cds
          Length = 650

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 222 gtaggggacgctgacgccgcacttggaggggatgccggcg 261
           |||||||| | ||||||||||||||  |||||||||||||
Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcg 310



to top

>gb|U29176.1|OSU29176 Oryza sativa lipid transfer protein precursor, mRNA, partial cds
          Length = 466

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 190 atcttagagcagtcgacggaagtgctgatggagtaggggacgctgacgccgcacttggag 249
           ||||| |||||||||||||| |||||||||| | ||| ||||  |||||| || |||  |
Sbjct: 295 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccacatttgctg 236

                               
Query: 250 gggatgccggcggccttgcc 269
           ||||||  |||||| |||||
Sbjct: 235 gggatggaggcggcgttgcc 216



to top

>emb|X96979.1|HVLTP7A2B H.vulgare mRNA for lipid transfer protein 7a2b
          Length = 755

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 212 tgctgatggagtaggggacgctgacgccgcacttg 246
           ||||||||| | |||| ||||||||||||||||||
Sbjct: 435 tgctgatggggaagggcacgctgacgccgcacttg 401



to top

>gb|AY226580.1| Triticum aestivum lipid transfer protein 3 (LTP3) mRNA, complete
           cds
          Length = 555

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 212 tgctgatggagtaggggacgctgacgccgcacttg 246
           ||||||||| | |||| ||||||||||||||||||
Sbjct: 416 tgctgatggggaagggcacgctgacgccgcacttg 382



to top

>emb|X60292.1|HVLTP1G Hordeum vulgare gene for LTP 1
          Length = 2874

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 213  gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggc 263
            |||||||| ||| |||||| ||||   ||||||||||||||||| ||||||
Sbjct: 2071 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 2021



to top

>emb|X83433.1|OSLTPB21 O.sativa mRNA for lipid transfer protein, b21
          Length = 509

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 190 atcttagagcagtcgacggaagtgctgatgg 220
           ||||| |||||||||||||| ||||||||||
Sbjct: 281 atcttggagcagtcgacggaggtgctgatgg 251



to top

>emb|X59253.1|HVLTP1 H.vulgare rearranged Ltp1 gene for lipid transfer protein
          Length = 1487

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 213  gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggc 263
            |||||||| ||| |||||| ||||   ||||||||||||||||| ||||||
Sbjct: 1111 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 1061



to top

>emb|X05168.1|TAMYR1 Hordeum vulgare mRNA for putative amylase or protease inhibitor
          Length = 650

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 213 gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggc 263
           |||||||| ||| |||||| ||||   ||||||||||||||||| ||||||
Sbjct: 390 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 340



to top

>emb|AJ852561.1| Triticum aestivum mRNA for type 1 non specific lipid transfer
           protein precursor (ltp9.4b gene)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 212 tgctgatggagtaggggacgctgacgccgcacttg 246
           ||||||||| | |||| ||||||||||||||||||
Sbjct: 408 tgctgatggggaagggcacgctgacgccgcacttg 374



to top

>emb|AJ852548.1| Triticum aestivum ltp9.4b gene for type 1 non specific lipid transfer
            protein precursor, exons 1-2
          Length = 2000

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 212  tgctgatggagtaggggacgctgacgccgcacttg 246
            ||||||||| | |||| ||||||||||||||||||
Sbjct: 1344 tgctgatggggaagggcacgctgacgccgcacttg 1310



to top

>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 215 tgatggagtaggggacgctgacgccgcacttggaggggatgccggcg 261
           |||||| ||||||||   ||||||||||||||  |||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355



to top

>gb|M15207.1|BLYPAPI Barley (H.vulgare) probable amylase/protease inhibitor (PAPI) gene,
           complete cds
          Length = 650

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 213 gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcggc 263
           |||||||| ||| |||||| ||||   ||||||||||||||||| ||||||
Sbjct: 390 gctgatggtgtatgggacgttgacattgcacttggaggggatgctggcggc 340



to top

>ref|XM_753742.1| Ustilago maydis 521 hypothetical protein (UM02688.1) partial mRNA
          Length = 3291

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 224  aggggacgctgacgccgcacttggag 249
            ||||||||||||||||||| ||||||
Sbjct: 2865 aggggacgctgacgccgcaattggag 2840



to top

>gb|AC121244.13| Medicago truncatula clone mth2-31b9, complete sequence
          Length = 146189

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 45    agataatatatgagatcattta 66
             ||||||||||||||||||||||
Sbjct: 11111 agataatatatgagatcattta 11132



to top

>gb|AC149636.14| Medicago truncatula clone mth2-180a12, complete sequence
          Length = 139348

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 45     agataatatatgagatcattta 66
              ||||||||||||||||||||||
Sbjct: 126466 agataatatatgagatcattta 126487



to top

>gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 sequence, complete sequence
          Length = 115721

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 41    atggagataatatatgagatcattta 66
             ||||||||||||||| ||||||||||
Sbjct: 79807 atggagataatatattagatcattta 79782



to top

>gb|AY103916.1| Zea mays PCO094104 mRNA sequence
          Length = 914

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 234 gacgccgcacttggaggggatg 255
           ||||||||||||||||||||||
Sbjct: 424 gacgccgcacttggaggggatg 403



to top

>gb|AY954904.1| Tadarida brasiliensis clone TabrE9 microsatellite sequence
          Length = 657

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 21  tctctctctttttctcccacatgga 45
           ||||||||| |||||||||||||||
Sbjct: 277 tctctctctctttctcccacatgga 301



to top

>gb|AC124041.3| Oryctolagus cuniculus clone LB1-44O5, complete sequence
          Length = 106159

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 20    ttctctctctttttctcccac 40
             |||||||||||||||||||||
Sbjct: 28349 ttctctctctttttctcccac 28369



to top

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the 3'
              end of the PRKCZ gene for protein kinase C zeta, a novel
              gene, a novel gene (FLJ31031), the SKI gene for v-ski
              sarcoma viral oncogene homolog (avian) and five CpG
              islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 428    cagagctcacctgaccgcagg 448
              |||||||||||||||||||||
Sbjct: 113726 cagagctcacctgaccgcagg 113706



to top

>emb|AL133284.13| Human DNA sequence from clone RP11-67K19 on chromosome 9q33.1-34.11
             Contains part of the ASTN2 gene for astrotactin 2
             (KIAA0634), the TRIM32 gene for tripartite
             motif-containing 32, and a novel gene, complete sequence
          Length = 155466

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    acttctctctctttttctccc 38
             |||||||||||||||||||||
Sbjct: 68653 acttctctctctttttctccc 68633



to top

>emb|AL031769.1|HS194O8 Human DNA sequence from clone RP1-194O8 on chromosome 6q24.1-25.3,
             complete sequence
          Length = 126839

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 155   ggcagaaacgacggcagcaag 175
             |||||||||||||||||||||
Sbjct: 48331 ggcagaaacgacggcagcaag 48311



to top

>dbj|BS000564.1| Pan troglodytes chromosome Y clone:PTFY-001A01, complete sequences
          Length = 31614

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 19    cttctctctctttttctccca 39
             |||||||||||||||||||||
Sbjct: 26881 cttctctctctttttctccca 26861



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 20     ttctctctctttttctcccac 40
              |||||||||||||||||||||
Sbjct: 759097 ttctctctctttttctcccac 759117



to top

>gb|AC073433.9|AC073433 Arabidopsis thaliana chromosome 1 BAC F19C17 genomic sequence, complete
             sequence
          Length = 117055

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    tacttctctctctttttctcc 37
             |||||||||||||||||||||
Sbjct: 15375 tacttctctctctttttctcc 15395



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    tacttctctctctttttctcc 37
             |||||||||||||||||||||
Sbjct: 13203 tacttctctctctttttctcc 13223



to top

>emb|AL928707.5| Zebrafish DNA sequence from clone CH211-207M2 in linkage group 21,
             complete sequence
          Length = 206304

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 20    ttctctctctttttctcccac 40
             |||||||||||||||||||||
Sbjct: 64904 ttctctctctttttctcccac 64924



to top

>ref|NM_183706.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 813

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 19 cttctctctctttttctccc 38
          ||||||||||||||||||||
Sbjct: 42 cttctctctctttttctccc 61



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 19       cttctctctctttttctccc 38
                ||||||||||||||||||||
Sbjct: 12410564 cttctctctctttttctccc 12410583



to top

>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 128843

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     cacatggagataatatatga 57
              ||||||||||||||||||||
Sbjct: 114026 cacatggagataatatatga 114007



to top

>emb|AL365185.11| Human DNA sequence from clone RP11-416C17 on chromosome 10 Contains
             part of gene FLJ11218, complete sequence
          Length = 150635

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    cttctctctctttttctccc 38
             ||||||||||||||||||||
Sbjct: 51645 cttctctctctttttctccc 51626



to top

>emb|AL133283.9| Human DNA sequence from clone RP11-31M2 on chromosome 9p23-24.3
             Contains the 5' end of the gene for a novel GLI Kruppel
             family member zinc finger protein (FLJ90578) and two CpG
             islands, complete sequence
          Length = 158602

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    agataatatatgagatcatt 64
             ||||||||||||||||||||
Sbjct: 64508 agataatatatgagatcatt 64489



to top

>emb|AJ431709.1|BMU431709 Bungarus multicinctus a1 chain gene for A1 chain of
            beta-bungarotoxin, exons 1-4
          Length = 3753

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   cttctctctctttttctccc 38
            ||||||||||||||||||||
Sbjct: 1231 cttctctctctttttctccc 1212



to top

>emb|AJ431708.1|BMU431708 Bungarus multicinctus a8 chain gene for A8 chain of
            beta-bungarotoxin, exons 1-4
          Length = 3747

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   cttctctctctttttctccc 38
            ||||||||||||||||||||
Sbjct: 1236 cttctctctctttttctccc 1217



to top

>gb|AC125496.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0098H14, complete sequence
          Length = 132560

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    cttctctctctttttctccc 38
             ||||||||||||||||||||
Sbjct: 69582 cttctctctctttttctccc 69601



to top

>gb|AC025039.7| Homo sapiens chromosome 10 clone RP11-457M15, complete sequence
          Length = 172790

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aatatatgagatcatttatt 68
             ||||||||||||||||||||
Sbjct: 40608 aatatatgagatcatttatt 40589



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 21      tctctctctttttctcccac 40
               ||||||||||||||||||||
Sbjct: 3942422 tctctctctttttctcccac 3942403



to top

>gb|AC018508.9| Homo sapiens chromosome 10 clone RP11-123L21, complete sequence
          Length = 149901

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aatatatgagatcatttatt 68
             ||||||||||||||||||||
Sbjct: 35422 aatatatgagatcatttatt 35441



to top

>gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mRNA, complete cds
          Length = 851

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 234 gacgccgcacttggaggggatgccggcg 261
           |||||||||||||  |||||||||||||
Sbjct: 381 gacgccgcacttgccggggatgccggcg 354



to top

>gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, complete sequence
          Length = 211177

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     cttctctctctttttctccc 38
              ||||||||||||||||||||
Sbjct: 112403 cttctctctctttttctccc 112384



to top

>gb|AC007304.11| Homo sapiens chromosome 13 clone 168l22 map 13q14, complete sequence
          Length = 120205

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 102   gtgtaaatatcctcaacgta 121
             ||||||||||||||||||||
Sbjct: 63988 gtgtaaatatcctcaacgta 63969



to top

>emb|AL929345.15| Zebrafish DNA sequence from clone DKEY-211H10 in linkage group 23,
              complete sequence
          Length = 222615

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     gagataatatatgagatcat 63
              ||||||||||||||||||||
Sbjct: 123346 gagataatatatgagatcat 123365



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 19       cttctctctctttttctccc 38
                ||||||||||||||||||||
Sbjct: 12407327 cttctctctctttttctccc 12407346



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       cttctctctctttttctccc 38
                ||||||||||||||||||||
Sbjct: 11736242 cttctctctctttttctccc 11736223



to top

>gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, region 97C-97D, BAC clone
             BACR24O14, complete sequence
          Length = 170356

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    tctctctctttttctcccac 40
             ||||||||||||||||||||
Sbjct: 56898 tctctctctttttctcccac 56917



to top

>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete
            genome
          Length = 10201

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 246  ggaggggatgccggcggccttgcc 269
            |||| |||||||||||||||||||
Sbjct: 4301 ggagaggatgccggcggccttgcc 4278



to top

>gb|AF198168.1|AF198168 Aerides japonica phospholipid transfer protein (PLTP3) mRNA,
           complete cds
          Length = 697

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 211 gtgctgatggagtaggggacgctgacgccgca 242
           ||||||||||  || |||||||||||||||||
Sbjct: 399 gtgctgatgggatatgggacgctgacgccgca 368



to top

>dbj|AP003722.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1011A07
          Length = 150590

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    cttctctctctttttctccc 38
             ||||||||||||||||||||
Sbjct: 75410 cttctctctctttttctccc 75391



to top

>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0689B12
          Length = 154745

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     cttctctctctttttctccc 38
              ||||||||||||||||||||
Sbjct: 128684 cttctctctctttttctccc 128665



to top

>dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0684F11
          Length = 147731

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     tctctctctttttctcccac 40
              ||||||||||||||||||||
Sbjct: 119565 tctctctctttttctcccac 119584



to top

>emb|AJ431710.1|BMU431710 Bungarus multicinctus a1a chain gene for A1a chain beta-bungarotoxin,
            exons 1-4
          Length = 3744

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   cttctctctctttttctccc 38
            ||||||||||||||||||||
Sbjct: 1229 cttctctctctttttctccc 1210



to top

>emb|AJ431707.1|BMU431707 Bungarus multicinctus a2 chain gene for A2 chain of
            beta-bungarotoxin, exons 1-3
          Length = 3882

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   cttctctctctttttctccc 38
            ||||||||||||||||||||
Sbjct: 1235 cttctctctctttttctccc 1216



to top

>gb|AF178571.1|AF178571 Lycopersicon esculentum phytochrome E (PHYE) gene, complete cds
          Length = 6189

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 16   gtacttctctctctttttct 35
            ||||||||||||||||||||
Sbjct: 4404 gtacttctctctctttttct 4385



to top

>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 352  ctcttgacgccgctgcagca 371
            ||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagca 2786



to top

>emb|AL954838.14| Zebrafish DNA sequence from clone DKEY-12B15 in linkage group 23,
              complete sequence
          Length = 268324

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     gagataatatatgagatcat 63
              ||||||||||||||||||||
Sbjct: 126341 gagataatatatgagatcat 126360



to top

>gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96 of 118 of the
             complete sequence
          Length = 228635

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    tctctctctttttctcccac 40
             ||||||||||||||||||||
Sbjct: 10414 tctctctctttttctcccac 10433


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,738,293
Number of Sequences: 3902068
Number of extensions: 3738293
Number of successful extensions: 94547
Number of sequences better than 10.0: 179
Number of HSP's better than 10.0 without gapping: 182
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93689
Number of HSP's gapped (non-prelim): 838
length of query: 517
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 494
effective length of database: 17,143,297,704
effective search space: 8468789065776
effective search space used: 8468789065776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top