ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags39p02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U08135.1|HVU08135 Hordeum vulgare photosystem-I PSI-F subunit precursor mRNA, complete cds Length = 990 Score = 1249 bits (630), Expect = 0.0 Identities = 636/638 (99%) Strand = Plus / Minus Query: 1 ggtaaaatacacacgtgtgaagagagaacacaatagttatacaagattgggttcagtttc 60 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 959 ggtaaaatacacacatgtgaagagagaacacaatagttatacaagattgggttcagtttc 900 Query: 61 ttaaatacaagagaggttccatttctccatgatcctatcagctcctacaccaagcccaca 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 899 ttaaatacaagagaggttccatttctccatgatcctatcagctcctacaccaagcccaca 840 Query: 121 cagatcgacaccacaagccctcatcctccgctgcccatctgacttgggaccgactagcca 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 839 cagatcgacaccacaagccctcatcctccgctgcccatctgacttgggaccgactagcca 780 Query: 181 accacgcacgcatggcagctagttagtagccgatgtcggcgtcgtcgacgacgaggtcgc 240 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 779 accacgcacgcatggcagctacttagtagccgatgtcggcgtcgtcgacgacgaggtcgc 720 Query: 241 cgttgatgagctcgcggtatgcggcgacgggccagatgaagcccctggggatgatcctgg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 719 cgttgatgagctcgcggtatgcggcgacgggccagatgaagcccctggggatgatcctgg 660 Query: 301 cggcgagctcgacgtcgatgatgatctccctcatggcgggcttcttctcgccgctgacgg 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 659 cggcgagctcgacgtcgatgatgatctccctcatggcgggcttcttctcgccgctgacgg 600 Query: 361 cgatgaggtagctgcgtccgacccagccgatccagccggcgatgtagaggaagagcacgc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 599 cgatgaggtagctgcgtccgacccagccgatccagccggcgatgtagaggaagagcacgc 540 Query: 421 cgggggtgatgaactcgccccagtgccgctggtcgccgctgacgatgaggtggggcaggc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 539 cgggggtgatgaactcgccccagtgccgctggtcgccgctgacgatgaggtggggcaggc 480 Query: 481 cgtcggagccgcagagcaggccgaacttgccgtagttctcgaaccggcgcttggtcttgt 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 479 cgtcggagccgcagagcaggccgaacttgccgtagttctcgaaccggcgcttggtcttgt 420 Query: 541 cgatggtggcctggatggcgagcgccggggcggagtcgggcgcgtacttcttgagcgacg 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 419 cgatggtggcctggatggcgagcgccggggcggagtcgggcgcgtacttcttgagcgacg 360 Query: 601 agttgagcttcttgaccgactgcttctcccgcttggcg 638 |||||||||||||||||||||||||||||||||||||| Sbjct: 359 agttgagcttcttgaccgactgcttctcccgcttggcg 322
>ref|NM_184976.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1038 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Minus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 778 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 719 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 718 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 659 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 658 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 599 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 598 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 539 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 538 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 479 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 478 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 419 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 418 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 359 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 358 tctcccgctt 349 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 921 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 867
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Plus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 31969474 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 31969533 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 31969534 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 31969593 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 31969594 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 31969653 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 31969654 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 31969713 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 31969714 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 31969773 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 31969774 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 31969833 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 31969834 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 31969893 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 31969894 tctcccgctt 31969903 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 31969219 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 31969273
>gb|AC084748.11| Oryza sativa chromosome 3 BAC OSJNBa0010I09 genomic sequence, complete sequence Length = 144306 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Plus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 61426 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 61485 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 61486 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 61545 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 61546 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 61605 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 61606 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 61665 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 61666 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 61725 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 61726 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 61785 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 61786 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 61845 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 61846 tctcccgctt 61855 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 61171 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 61225
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Plus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 32059986 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 32060045 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 32060046 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 32060105 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 32060106 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 32060165 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 32060166 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 32060225 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 32060226 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 32060285 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 32060286 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 32060345 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 32060346 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 32060405 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 32060406 tctcccgctt 32060415 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 32059731 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 32059785
>dbj|AK060493.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-D02, full insert sequence Length = 997 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Minus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 777 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 718 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 717 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 658 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 657 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 598 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 597 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 538 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 537 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 478 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 477 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 418 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 417 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 358 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 357 tctcccgctt 348 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 920 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 866
>dbj|AK059890.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-C12, full insert sequence Length = 990 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Minus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 765 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 706 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 705 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 646 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 645 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 586 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 585 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 526 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 525 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 466 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 465 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 406 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 405 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 346 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 345 tctcccgctt 336 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 913 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 859
>gb|AF093634.1|AF093634 Oryza sativa photosystem-1 F subunit precursor (PSI-F) mRNA, complete cds Length = 996 Score = 599 bits (302), Expect = e-168 Identities = 398/430 (92%) Strand = Plus / Minus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 758 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 699 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 698 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 639 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 638 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 579 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 578 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 519 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 518 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 459 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 458 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 399 Query: 565 ccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttgaccgactgct 624 |||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||||| Sbjct: 398 ccggcgcggagtccggcgcgtacttcttgagcgacgactggagcttcttgatggactgct 339 Query: 625 tctcccgctt 634 |||||||||| Sbjct: 338 tctcccgctt 329 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 901 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 847
>gb|AY103687.1| Zea mays PCO106710 mRNA sequence Length = 1242 Score = 579 bits (292), Expect = e-162 Identities = 407/444 (91%), Gaps = 1/444 (0%) Strand = Plus / Minus Query: 195 gcagctagttagtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcg 254 ||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| Sbjct: 802 gcagctagt-agtagccgatgtccttgtcgtcgacgacgaggtctccgttgatgagctcg 744 Query: 255 cggtatgcggcgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacg 314 ||||| || ||||||||||||||||| |||||||||| || | || ||||||||||||| Sbjct: 743 cggtaggccgcgacgggccagatgaaccccctggggaggaggcgggtggcgagctcgacg 684 Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 683 tcgatgatgatctccctcatggcgggcttcttctcgccgctgatggcgatgaggtagctc 624 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | |||||||| |||||||| |||||||||||||||||||||| ||| ||||||| |||| Sbjct: 623 ctgccgacccacccgatccacccggcgatgtagaggaagagcaggcccggggtgacgaac 564 Query: 435 tcgccccagtgccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcag 494 |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 563 tcgccccagtgccgctggtcgccgctgacgatgaggtgcggcaggccgtcggcgccgcag 504 Query: 495 agcaggccgaacttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctgg 554 |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 503 agcaggccgaacttgccgtagttctcgaaccgccgcttggtcttctcgatggtggcgttg 444 Query: 555 atggcgagcgccggggcggagtcgggcgcgtacttcttgagcgacgagttgagcttcttg 614 |||||||| ||||||||| |||||||||||||||||||||||||| | ||||||||||| Sbjct: 443 atggcgagggccggggcgctgtcgggcgcgtacttcttgagcgacgcggtgagcttcttg 384 Query: 615 accgactgcttctcccgcttggcg 638 | ||| | |||||| ||||||||| Sbjct: 383 atcgagttcttctcgcgcttggcg 360
>dbj|AK069791.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023031N02, full insert sequence Length = 967 Score = 507 bits (256), Expect = e-140 Identities = 334/360 (92%) Strand = Plus / Minus Query: 205 agtagccgatgtcggcgtcgtcgacgacgaggtcgccgttgatgagctcgcggtatgcgg 264 ||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||| |||| Sbjct: 742 agtagccgatgtcagcgtcgtcgacgacgaggttgccggtgatgagctcacggtaggcgg 683 Query: 265 cgacgggccagatgaagcccctggggatgatcctggcggcgagctcgacgtcgatgatga 324 |||||||||||||||| ||||| |||| || | || |||||||||||||||||||||||| Sbjct: 682 cgacgggccagatgaaccccctcgggaggagcttgacggcgagctcgacgtcgatgatga 623 Query: 325 tctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctgcgtccgaccc 384 ||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||||||| Sbjct: 622 tctccctcatggccggcttcttctcgccgctgatggcgatgaggtagctcctgccgaccc 563 Query: 385 agccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccccagt 444 ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| Sbjct: 562 agccgatccagccggcgatgtagaggaagagcaagcccggggtgatgaactcgccccagt 503 Query: 445 gccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccgcagagcaggccga 504 |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| Sbjct: 502 gccgctggtcgccgctgacgatgaggtgcgggaggccgtcggcgccgcagagcaggccga 443 Query: 505 acttgccgtagttctcgaaccggcgcttggtcttgtcgatggtggcctggatggcgagcg 564 ||||||||||||||||||| |||||||| ||||| ||||||||||| | ||||||||||| Sbjct: 442 acttgccgtagttctcgaagcggcgcttcgtcttctcgatggtggcgttgatggcgagcg 383 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 57 tttcttaaatacaagagaggttccatttctccatgatcctatcagctcctacacc 111 |||||||| ||||| ||| ||||||| ||||||||||||||||||| ||||||| Sbjct: 890 tttcttaagtacaacagatcttccattcctccatgatcctatcagcttctacacc 836 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 593 gagcgacgagttgagcttcttgaccgactgcttctcccgctt 634 ||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 387 gagcgacgactggagcttcttgatggactgcttctcccgctt 346
>gb|AF139468.2|AF139468 Vigna radiata photosystem I reaction center subunit III (CipPsaF) mRNA, complete cds; nuclear gene for chloroplast product Length = 885 Score = 109 bits (55), Expect = 1e-20 Identities = 184/227 (81%) Strand = Plus / Minus Query: 312 acgtcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtag 371 |||||||||||||||||| |||| | || || ||||| | |||| ||| || |||||| Sbjct: 651 acgtcgatgatgatctccttcatcgtcggttttttctcatccctgatggcaataaggtag 592 Query: 372 ctgcgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatg 431 || || || ||||| |||||||| ||||||||||| ||||| || | || || |||||| Sbjct: 591 ctccgacccacccacccgatccacccggcgatgtacaggaataggaacccaggagtgatg 532 Query: 432 aactcgccccagtgccgctggtcgccgctgacgatgaggtggggcaggccgtcggagccg 491 |||||||||||||||| |||||| ||||| ||||| ||||| || || ||||||| |||| Sbjct: 531 aactcgccccagtgcctctggtccccgctcacgatcaggtgcggtagcccgtcggcgccg 472 Query: 492 cagagcaggccgaacttgccgtagttctcgaaccggcgcttggtctt 538 || || || || ||| ||||||| |||||||| ||||| ||||| Sbjct: 471 cacagaagaccctgcttcgcgtagttgtcgaaccgccgcttcgtctt 425
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 381 acccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaa 433 |||||||| ||||||||||||||||||||||| |||| || |||| ||||||| Sbjct: 346836 acccagccaatccagccggcgatgtagaggaacagcaagctggggatgatgaa 346784
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 381 acccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaa 433 |||||||| ||||||||||||||||||||||| |||| || |||| ||||||| Sbjct: 1273968 acccagccaatccagccggcgatgtagaggaacagcaagctggggatgatgaa 1274020
>emb|BX814457.1|CNS0ADUS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB75ZA08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 411 Score = 63.9 bits (32), Expect = 6e-07 Identities = 113/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || |||| |||||| Sbjct: 212 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctatgaagtagctt 153 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 152 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 93 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 92 tctccccaatgccgctggtc 73
>ref|NM_102871.3| Arabidopsis thaliana unknown protein AT1G31330 mRNA, complete cds Length = 925 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 638 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 579 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 578 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 519 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 518 tctccccaatgccgctggtc 499
>gb|BT000680.1| Arabidopsis thaliana clone RAFL05-09-F03 (R10152) putative photosystem I reaction centre subunit III precursor (At1g31330) mRNA, complete cds Length = 859 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 610 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 551 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 550 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 491 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 490 tctccccaatgccgctggtc 471
>gb|AY051021.1| Arabidopsis thaliana putative photosystem I subunit III precursor (At1g31330) mRNA, complete cds Length = 697 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 566 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 507 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 506 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 447 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 446 tctccccaatgccgctggtc 427
>gb|AF360251.1| Arabidopsis thaliana putative photosystem I subunit III precursor (At1g31330) mRNA, complete cds Length = 821 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 610 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 551 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 550 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 491 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 490 tctccccaatgccgctggtc 471
>gb|AY094015.1| Arabidopsis thaliana At1g31330/T19E23_1 mRNA, complete cds Length = 666 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 566 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 507 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 506 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 447 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 446 tctccccaatgccgctggtc 427
>gb|AY062712.1| Arabidopsis thaliana similar to photosystem I reaction centre subunit III precursor (At1g31330; T19E23.12) mRNA, complete cds Length = 805 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 610 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 551 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 550 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 491 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 490 tctccccaatgccgctggtc 471
>gb|AF424564.1|AF424564 Arabidopsis thaliana At1g31330/T19E23_1 mRNA, complete cds Length = 859 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 610 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 551 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 550 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 491 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 490 tctccccaatgccgctggtc 471
>gb|AY052281.1| Arabidopsis thaliana At1g31330/T19E23_1 mRNA, complete cds Length = 1737 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 1491 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 1432 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 1431 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 1372 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 1371 tctccccaatgccgctggtc 1352
>gb|AY048220.1| Arabidopsis thaliana At1g31330/T19E23_1 mRNA, complete cds Length = 820 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 627 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 568 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 567 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 508 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 507 tctccccaatgccgctggtc 488
>emb|BX818241.1|CNS0AEDF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL69ZD07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 776 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 577 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 518 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 517 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 458 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 457 tctccccaatgccgctggtc 438
>emb|BX814304.1|CNS0AEI0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB67ZC10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 811 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 598 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 539 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 538 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 479 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 478 tctccccaatgccgctggtc 459
>emb|BX815295.1|CNS0ACV1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS4ZF05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 817 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 619 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 560 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 559 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 500 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 499 tctccccaatgccgctggtc 480
>emb|BX814897.1|CNS0ACW2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 824 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 627 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 568 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 567 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 508 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 507 tctccccaatgccgctggtc 488
>gb|AC007654.2|AC007654 Genomic sequence for Arabidopsis thaliana BAC T19E23 from chromosome I, complete sequence Length = 87618 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Plus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 55603 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 55662 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 55663 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 55722 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 55723 tctccccaatgccgctggtc 55742
>gb|BT002099.1| Arabidopsis thaliana similar to photosystem I reaction centre subunit III precursor (At1g31330) mRNA, complete cds Length = 699 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 566 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 507 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| |||||||| || || ||||||||||| || | || || || |||||| Sbjct: 506 cttccaacccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 447 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 446 tctccccaatgccgctggtc 427
>emb|X63765.1|SSPPSAFJ9 Synechococcus sp. genes psaF, psaJ and rp19 for photosystem I subunit III, subunit X and ribosomal protein RL9 Length = 1592 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 381 acccagccgatccagccggcgatgtagaggaagagcac 418 |||||||| |||||||| |||||||| ||||||||||| Sbjct: 512 acccagccaatccagccagcgatgtacaggaagagcac 475
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 382 cccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgcc 439 ||||||| | ||||||||||||||||||||| |||| ||| ||| ||| |||||||| Sbjct: 300301 cccagcccagccagccggcgatgtagaggaaaagcaggccagggatgagaaactcgcc 300358
>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome Length = 2593857 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 381 acccagccgatccagccggcgatgtagaggaagagcac 418 |||||||| |||||||| |||||||| ||||||||||| Sbjct: 2524284 acccagccaatccagccagcgatgtacaggaagagcac 2524247
>emb|AJ245629.1|ATH245629 Arabidopsis thaliana mRNA for photosystem I subunit III precursor (psaF gene) Length = 865 Score = 48.1 bits (24), Expect = 0.036 Identities = 111/140 (79%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 634 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 575 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| || ||||| || || ||||||||||| || | || || || |||||| Sbjct: 574 cttccaacccacccaatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 515 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 514 tctccccaatgccgctggtc 495
>gb|AY088009.1| Arabidopsis thaliana clone 40329 mRNA, complete sequence Length = 803 Score = 48.1 bits (24), Expect = 0.036 Identities = 111/140 (79%) Strand = Plus / Minus Query: 315 tcgatgatgatctccctcatggcgggcttcttctcgccgctgacggcgatgaggtagctg 374 |||||||||||||| |||| ||||| |||||||| || || | || || | |||||| Sbjct: 610 tcgatgatgatctctttcatcgcgggtttcttctcaccactaatagctattaagtagctt 551 Query: 375 cgtccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaac 434 | ||| ||||| || ||||| || || ||||||||||| || | || || || |||||| Sbjct: 550 cttccaacccacccaatccatccagcaatgtagaggaaaagaatccctggagtaatgaac 491 Query: 435 tcgccccagtgccgctggtc 454 || ||||| ||||||||||| Sbjct: 490 tctccccaatgccgctggtc 471
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Minus Query: 382 cccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccc 440 ||||||| | ||| |||||||||||||| || |||| ||||||| ||| ||||||||| Sbjct: 2927256 cccagcccagccaaccggcgatgtagagaaaaagcaagccggggatgagaaactcgccc 2927198
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 381 acccagccgatccagccggcgatgtagaggaagag 415 ||||| |||||||| ||||| |||||||||||||| Sbjct: 111364 acccaaccgatccaaccggcaatgtagaggaagag 111398
>ref|NM_197599.1| Oryza sativa (japonica cultivar-group) mucin-like protein (OSJNBb0015I11.17), mRNA Length = 1110 Score = 44.1 bits (22), Expect = 0.56 Identities = 31/34 (91%) Strand = Plus / Minus Query: 210 ccgatgtcggcgtcgtcgacgacgaggtcgccgt 243 ||||||||||||||| ||||||| ||| |||||| Sbjct: 386 ccgatgtcggcgtcggcgacgacaaggccgccgt 353
>emb|AL590464.1|SCO590464 Streptomyces coelicolor plasmid SCP1; segment 2/2 Length = 178073 Score = 44.1 bits (22), Expect = 0.56 Identities = 31/34 (91%) Strand = Plus / Plus Query: 209 gccgatgtcggcgtcgtcgacgacgaggtcgccg 242 ||||||||| ||| ||||||||||||| |||||| Sbjct: 38032 gccgatgtccgcgccgtcgacgacgagctcgccg 38065
>emb|AL590463.1|SCO590463 Streptomyces coelicolor plasmid SCP1; segment 1/2 Length = 178000 Score = 44.1 bits (22), Expect = 0.56 Identities = 31/34 (91%) Strand = Plus / Minus Query: 209 gccgatgtcggcgtcgtcgacgacgaggtcgccg 242 ||||||||| ||| ||||||||||||| |||||| Sbjct: 127590 gccgatgtccgcgccgtcgacgacgagctcgccg 127557
>gb|BT023413.1| Arabidopsis thaliana At2g47890 gene, complete cds Length = 1470 Score = 44.1 bits (22), Expect = 0.56 Identities = 61/74 (82%) Strand = Plus / Plus Query: 381 acccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactcgccc 440 ||||| |||||||| || || ||||||||||| || | || || || |||||||| ||| Sbjct: 1262 acccacccgatccatccagcaatgtagaggaaaagaatccctggagtaatgaactctccc 1321 Query: 441 cagtgccgctggtc 454 || ||||||||||| Sbjct: 1322 caatgccgctggtc 1335
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Plus Query: 215 gtcggcgtcgtcgacgacgagg 236 |||||||||||||||||||||| Sbjct: 1139192 gtcggcgtcgtcgacgacgagg 1139213
>dbj|AK106264.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-F10, full insert sequence Length = 1488 Score = 44.1 bits (22), Expect = 0.56 Identities = 31/34 (91%) Strand = Plus / Minus Query: 210 ccgatgtcggcgtcgtcgacgacgaggtcgccgt 243 ||||||||||||||| ||||||| ||| |||||| Sbjct: 62 ccgatgtcggcgtcggcgacgacaaggccgccgt 29
>gb|M83119.1|FTRPHOTOI Flaveria trinervia photosystem I subunit III (psaF) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.56 Identities = 55/66 (83%) Strand = Plus / Minus Query: 377 tccgacccagccgatccagccggcgatgtagaggaagagcacgccgggggtgatgaactc 436 ||||||||| |||||||| || |||||||| || || || | ||||||||||| || || Sbjct: 542 tccgacccacccgatccatccagcgatgtacagaaatagaatcccgggggtgataaattc 483 Query: 437 gcccca 442 |||||| Sbjct: 482 gcccca 477
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 477 aggccgtcggagccgcagagcaggccgaa 505 |||||||||| ||||| |||||||||||| Sbjct: 1425635 aggccgtcggtgccgccgagcaggccgaa 1425663
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 409 ggaagagcacgccgggggtga 429 ||||||||||||||||||||| Sbjct: 3154528 ggaagagcacgccgggggtga 3154508
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 217 cggcgtcgtcgacgacgaggt 237 ||||||||||||||||||||| Sbjct: 1949449 cggcgtcgtcgacgacgaggt 1949429
>gb|BT013202.1| Lycopersicon esculentum clone 134366R, mRNA sequence Length = 824 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 426 gtgatgaactcgccccagtgccgctggtc 454 ||||||||||| |||||||||| |||||| Sbjct: 501 gtgatgaactcaccccagtgcctctggtc 473
>emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 10/14 Length = 307550 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 409 ggaagagcacgccgggggtga 429 ||||||||||||||||||||| Sbjct: 299334 ggaagagcacgccgggggtga 299314
>emb|BX842581.1| Mycobacterium tuberculosis H37Rv complete genome; segment 10/13 Length = 348676 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 409 ggaagagcacgccgggggtga 429 ||||||||||||||||||||| Sbjct: 41281 ggaagagcacgccgggggtga 41261
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 cgatgtcggcgtcgtcgacgacgaggtcgccgt 243 |||||||||||||| ||||||| ||| |||||| Sbjct: 107077 cgatgtcggcgtcggcgacgacaaggccgccgt 107045
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 209 gccgatgtcggcgtcgtcgacgacg 233 |||||||||| |||||||||||||| Sbjct: 18403096 gccgatgtcgtcgtcgtcgacgacg 18403072 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 cggcgtcgtcgacgacgagg 236 |||||||||||||||||||| Sbjct: 12249186 cggcgtcgtcgacgacgagg 12249167
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 cgatgtcggcgtcgtcgacgacgaggtcgccgt 243 |||||||||||||| ||||||| ||| |||||| Sbjct: 20705625 cgatgtcggcgtcggcgacgacaaggccgccgt 20705593 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 tcggcgtcgtcgacgacgag 235 |||||||||||||||||||| Sbjct: 21068348 tcggcgtcgtcgacgacgag 21068367
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 224 gtcgacgacgaggtcgccgttgatg 248 |||||||||||||||||||| |||| Sbjct: 1766710 gtcgacgacgaggtcgccgtcgatg 1766734
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 cgatgtcggcgtcgtcgacgacgaggtcgccgt 243 |||||||||||||| ||||||| ||| |||||| Sbjct: 20716897 cgatgtcggcgtcggcgacgacaaggccgccgt 20716865 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 216 tcggcgtcgtcgacgacgag 235 |||||||||||||||||||| Sbjct: 21079612 tcggcgtcgtcgacgacgag 21079631
>emb|AL607003.3|OSJN00130 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0006N15, complete sequence Length = 133413 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 209 gccgatgtcggcgtcgtcgacgacg 233 |||||||||| |||||||||||||| Sbjct: 105019 gccgatgtcgtcgtcgtcgacgacg 104995
>ref|XM_471550.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 837 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 cggcgtcgtcgacgacgagg 236 |||||||||||||||||||| Sbjct: 214 cggcgtcgtcgacgacgagg 195
>ref|NM_197655.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0015J15.29), mRNA Length = 1440 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 tcggcgtcgtcgacgacgag 235 |||||||||||||||||||| Sbjct: 85 tcggcgtcgtcgacgacgag 66
>gb|AF175325.1| Homo sapiens eukaryotic initiation factor 4AI (EIF4A1) gene, partial cds Length = 6732 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 5196 gccggggcggagtcgggcgc 5215
>gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's Hospital Oakland Research Institute) complete sequence Length = 230137 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 tcttaaatacaagagaggtt 78 |||||||||||||||||||| Sbjct: 82654 tcttaaatacaagagaggtt 82673
>ref|XM_359774.1| Magnaporthe grisea 70-15 hypothetical protein (MG05003.4) partial mRNA Length = 1698 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 520 cgaaccggcgcttggtcttgtcgatggt 547 |||||||||||| || |||||||||||| Sbjct: 655 cgaaccggcgctcggccttgtcgatggt 628
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 341 cttcttctcgccgctgacgg 360 |||||||||||||||||||| Sbjct: 3593435 cttcttctcgccgctgacgg 3593454
>gb|AE009291.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 61 of 187 of the complete sequence Length = 12142 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 gaaccggcgcttggtcttgt 540 |||||||||||||||||||| Sbjct: 1197 gaaccggcgcttggtcttgt 1178
>gb|AE008321.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 125 of 187 of the complete sequence Length = 14335 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 gaaccggcgcttggtcttgt 540 |||||||||||||||||||| Sbjct: 14042 gaaccggcgcttggtcttgt 14061
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 347 ctcgccgctgacggcgatga 366 |||||||||||||||||||| Sbjct: 1323852 ctcgccgctgacggcgatga 1323871
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 ccgacccagccgatccagccggcg 401 |||| ||||||||||||||||||| Sbjct: 5065965 ccgaaccagccgatccagccggcg 5065988
>gb|BC032613.1| Homo sapiens cDNA clone IMAGE:5555330, **** WARNING: chimeric clone **** Length = 3530 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 2013 gccggggcggagtcgggcgc 2032
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 214 tgtcggcgtcgtcgacgacg 233 |||||||||||||||||||| Sbjct: 1625246 tgtcggcgtcgtcgacgacg 1625227
>emb|AL445928.8| Human DNA sequence from clone RP11-305E17 on chromosome 1, complete sequence Length = 173580 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 81 atttctccatgatcctatcagctcctac 108 ||||||||||||||| |||| ||||||| Sbjct: 156375 atttctccatgatccaatcacctcctac 156348
>emb|X13495.1|CRPSAF C.reinhardtii mRNA for 17 kd P21 protein of photosystem I Length = 1227 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 468 aggtggggcaggccgtcggagccgcagagcaggccg 503 ||||||||||| |||||| |||||| ||||||||| Sbjct: 416 aggtggggcagaccgtcgttgccgcacagcaggccg 381
>emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete genome; segment 3/16 Length = 346362 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 343 tcttctcgccgctgacggcgatga 366 |||||||||||||||||| ||||| Sbjct: 190124 tcttctcgccgctgacggtgatga 190147
>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14 Length = 348257 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 343 tcttctcgccgctgacggcgatga 366 |||||||||||||||||| ||||| Sbjct: 103960 tcttctcgccgctgacggtgatga 103983
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12 Length = 343243 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 496 gcaggccgaacttgccgtag 515 |||||||||||||||||||| Sbjct: 250220 gcaggccgaacttgccgtag 250239
>emb|BX640411.1| Bordetella pertussis strain Tohama I, complete genome; segment 1/12 Length = 346359 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 343 tcttctcgccgctgacggcgatga 366 |||||||||||||||||| ||||| Sbjct: 179689 tcttctcgccgctgacggtgatga 179712
>emb|BX572593.1| Rhodopseudomonas palustris CGA009 complete genome; segment 1/16 Length = 349315 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 575 gtcgggcgcgtacttcttga 594 |||||||||||||||||||| Sbjct: 215437 gtcgggcgcgtacttcttga 215456
>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7 Length = 349122 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 461 gacgatgaggtggggcaggccgtc 484 |||||| ||||||||||||||||| Sbjct: 13091 gacgatcaggtggggcaggccgtc 13068
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 cggcgtcgtcgacgacgagg 236 |||||||||||||||||||| Sbjct: 228093 cggcgtcgtcgacgacgagg 228112
>emb|AL662955.3|OSJN00158 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019J05, complete sequence Length = 185211 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 cggcgtcgtcgacgacgagg 236 |||||||||||||||||||| Sbjct: 74067 cggcgtcgtcgacgacgagg 74048
>emb|CR388137.8| Zebrafish DNA sequence from clone DKEY-17M13 in linkage group 5, complete sequence Length = 181599 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 549 gcctggatggcgagcgccgg 568 |||||||||||||||||||| Sbjct: 67726 gcctggatggcgagcgccgg 67707
>gb|AC130610.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0478F09, complete sequence Length = 145070 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 215 gtcggcgtcgtcgacgacgaggtcgccg 242 |||| ||||||||||||||| ||||||| Sbjct: 102007 gtcgtcgtcgtcgacgacgacgtcgccg 102034
>gb|AC087698.5| Homo sapiens chromosome 8, clone RP11-25K19, complete sequence Length = 150750 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 caagattgggttcagtttct 61 |||||||||||||||||||| Sbjct: 10979 caagattgggttcagtttct 10998
>gb|AC105282.5| Homo sapiens chromosome 18, clone RP11-452F20, complete sequence Length = 167258 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 ggttcagtttcttaaataca 69 |||||||||||||||||||| Sbjct: 17437 ggttcagtttcttaaataca 17456
>gb|AE012083.1| Xanthomonas axonopodis pv. citri str. 306, section 461 of 469 of the complete genome Length = 10370 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 378 ccgacccagccgatccagccggcg 401 |||| ||||||||||||||||||| Sbjct: 1205 ccgaaccagccgatccagccggcg 1228
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 gaaccggcgcttggtcttgt 540 |||||||||||||||||||| Sbjct: 4040538 gaaccggcgcttggtcttgt 4040519
>gb|AC068327.14| Homo sapiens chromosome 15, clone RP11-394G8, complete sequence Length = 177539 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 437 gccccagtgccgctggtcgc 456 |||||||||||||||||||| Sbjct: 154061 gccccagtgccgctggtcgc 154042
>gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 genomic sequence, complete sequence Length = 144798 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 216 tcggcgtcgtcgacgacgag 235 |||||||||||||||||||| Sbjct: 137358 tcggcgtcgtcgacgacgag 137339
>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence Length = 118755 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 caagattgggttcagtttct 61 |||||||||||||||||||| Sbjct: 14523 caagattgggttcagtttct 14504
>gb|AC026583.10| Homo sapiens chromosome 15, clone RP11-20C17, complete sequence Length = 175472 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 437 gccccagtgccgctggtcgc 456 |||||||||||||||||||| Sbjct: 32945 gccccagtgccgctggtcgc 32926
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 tggcggcgagctcgacgtcg 317 |||||||||||||||||||| Sbjct: 1823593 tggcggcgagctcgacgtcg 1823612
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 gtcggcgtcgtcgacgacga 234 |||||||||||||||||||| Sbjct: 3776403 gtcggcgtcgtcgacgacga 3776422
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 383 ccagccgatccagccggcga 402 |||||||||||||||||||| Sbjct: 655758 ccagccgatccagccggcga 655777
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 215 gtcggcgtcgtcgacgacgaggtcgccg 242 |||| ||||||||||||||| ||||||| Sbjct: 4734002 gtcgtcgtcgtcgacgacgacgtcgccg 4734029
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 382 cccagccgatccagccggcg 401 |||||||||||||||||||| Sbjct: 3034808 cccagccgatccagccggcg 3034827
>emb|AJ338797.1|HSA338797 Homo sapiens genomic sequence surrounding NotI site, clone NR1-TJ14R Length = 728 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ339124.1|HSA339124 Homo sapiens genomic sequence surrounding NotI site, clone NR1-BN20C Length = 680 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ340425.1|HSA340425 Homo sapiens genomic sequence surrounding NotI site, clone NL1-UO9R Length = 846 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ340397.1|HSA340397 Homo sapiens genomic sequence surrounding NotI site, clone NR1-SH13C Length = 621 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ338925.1|HSA338925 Homo sapiens genomic sequence surrounding NotI site, clone NL1-VJ19C Length = 577 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ338981.1|HSA338981 Homo sapiens genomic sequence surrounding NotI site, clone NR1-XM14C Length = 649 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo sapiens (human) Length = 204955 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 caagattgggttcagtttct 61 |||||||||||||||||||| Sbjct: 141244 caagattgggttcagtttct 141225
>gb|AF135791.1|AF135791 Chlamydomonas reinhardtii photosystem I subunit F precursor (psaF) gene, complete cds Length = 2332 Score = 40.1 bits (20), Expect = 8.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 468 aggtggggcaggccgtcggagccgcagagcaggccg 503 ||||||||||| |||||| |||||| ||||||||| Sbjct: 1053 aggtggggcagaccgtcgttgccgcacagcaggccg 1018
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 229 cgacgaggtcgccgttgatgagct 252 ||||||||||| |||||||||||| Sbjct: 1147951 cgacgaggtcgtcgttgatgagct 1147974 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 569 ggcggagtcgggcgcgtact 588 |||||||||||||||||||| Sbjct: 424673 ggcggagtcgggcgcgtact 424692
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome Length = 4096345 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gagaggttccatttctccat 90 |||||||||||||||||||| Sbjct: 418732 gagaggttccatttctccat 418713
>dbj|AB209672.1| Homo sapiens mRNA for Transducin-like enhancer of split 3 splice variant 1 variant protein Length = 7809 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 437 gccccagtgccgctggtcgc 456 |||||||||||||||||||| Sbjct: 1741 gccccagtgccgctggtcgc 1760
>gb|AC135425.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0453H11, complete sequence Length = 187956 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 215 gtcggcgtcgtcgacgacgaggtcgccg 242 |||| ||||||||||||||| ||||||| Sbjct: 6410 gtcgtcgtcgtcgacgacgacgtcgccg 6437
>emb|AJ342453.1|HSA342453 Homo sapiens genomic sequence surrounding NotI site, clone NR1-QJ1C Length = 598 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>emb|AJ342377.1|HSA342377 Homo sapiens genomic sequence surrounding NotI site, clone NR1-QD10R Length = 672 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 420 gccggggcggagtcgggcgc 401
>gb|AC016876.10| Homo sapiens chromosome 17, clone RP11-186B7, complete sequence Length = 60268 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 gccggggcggagtcgggcgc 583 |||||||||||||||||||| Sbjct: 21599 gccggggcggagtcgggcgc 21580 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,203,818 Number of Sequences: 3902068 Number of extensions: 4203818 Number of successful extensions: 88928 Number of sequences better than 10.0: 107 Number of HSP's better than 10.0 without gapping: 90 Number of HSP's successfully gapped in prelim test: 18 Number of HSP's that attempted gapping in prelim test: 86242 Number of HSP's gapped (non-prelim): 2669 length of query: 638 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 615 effective length of database: 17,143,297,704 effective search space: 10543128087960 effective search space used: 10543128087960 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
