>gb|AY105616.1| Zea mays PCO125437 mRNA sequence
          Length = 968

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 231 gccctgtcacagtactccccatgaacttnccagctttaccaaggcc 276
           ||||||||||||| || ||||||||||| || ||||||||||||||
Sbjct: 742 gccctgtcacagtcctgcccatgaacttcccggctttaccaaggcc 697

>ref|XM_477665.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1962

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 148  tcactgtacatcaagttatgcagaaggctggtcaggttggggaacagtggagctgctacc 207
            |||||||||||||||| | |||||||| || ||||  |||||| |||| |||||||||||
Sbjct: 1703 tcactgtacatcaagtcacgcagaaggttgttcagcctggggagcagttgagctgctacc 1644

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 148      tcactgtacatcaagttatgcagaaggctggtcaggttggggaacagtggagctgctacc 207
                |||||||||||||||| | |||||||| || ||||  |||||| |||| |||||||||||
Sbjct: 12706815 tcactgtacatcaagtcacgcagaaggttgttcagcctggggagcagttgagctgctacc 12706756

>dbj|AP004305.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0492E07
          Length = 143794

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 148   tcactgtacatcaagttatgcagaaggctggtcaggttggggaacagtggagctgctacc 207
             |||||||||||||||| | |||||||| || ||||  |||||| |||| |||||||||||
Sbjct: 81285 tcactgtacatcaagtcacgcagaaggttgttcagcctggggagcagttgagctgctacc 81226

>dbj|AK060230.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H02, full
            insert sequence
          Length = 1967

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                        
Query: 148  tcactgtacatcaagttatgcagaaggctggtcaggttggggaacagtggagctgctacc 207
            |||||||||||||||| | |||||||| || ||||  |||||| | || |||||||||||
Sbjct: 1701 tcactgtacatcaagtcacgcagaaggttgttcagcctggggagccgttgagctgctacc 1642

>gb|BC106195.1| Mus musculus cDNA sequence BC055004, mRNA (cDNA clone MGC:118496
           IMAGE:6396133), complete cds
          Length = 3378

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 444 agaaggctggtcaggttgggga 423

>ref|NM_001013773.1| Mus musculus cDNA sequence BC055004 (BC055004), mRNA
          Length = 2596

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 262 agaaggctggtcaggttgggga 241

>gb|AC159257.2| Mus musculus BAC clone RP24-86H20 from chromosome 5, complete sequence
          Length = 202099

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 169    agaaggctggtcaggttgggga 190
              ||||||||||||||||||||||
Sbjct: 145959 agaaggctggtcaggttgggga 145938



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 169    agaaggctggtcaggttgggga 190
              ||||||||||||||||||||||
Sbjct: 110631 agaaggctggtcaggttgggga 110652

>gb|BC055004.1| Mus musculus cDNA sequence BC055004, mRNA (cDNA clone MGC:57066
           IMAGE:6478735), complete cds
          Length = 2596

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 262 agaaggctggtcaggttgggga 241

>ref|XM_979444.1| PREDICTED: Mus musculus gene model 454, (NCBI) (Gm454), mRNA
          Length = 1387

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 317 agaaggctggtcaggttgggga 296

>ref|XM_984193.1| PREDICTED: Mus musculus gene model 454, (NCBI) (Gm454), mRNA
          Length = 1183

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 164 agaaggctggtcaggttgggga 143

>ref|XM_001000527.1| PREDICTED: Mus musculus gene model 454, (NCBI) (Gm454), mRNA
          Length = 1183

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 164 agaaggctggtcaggttgggga 143

>gb|AC157588.8| Mus musculus BAC clone RP24-95J4 from chromosome 5, complete sequence
          Length = 220137

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 169    agaaggctggtcaggttgggga 190
              ||||||||||||||||||||||
Sbjct: 191512 agaaggctggtcaggttgggga 191491



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 169    agaaggctggtcaggttgggga 190
              ||||||||||||||||||||||
Sbjct: 156184 agaaggctggtcaggttgggga 156205

>dbj|AK138922.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
           enriched library, clone:A530006K22 product:hypothetical
           protein, full insert sequence
          Length = 754

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 317 agaaggctggtcaggttgggga 296

>dbj|AK156114.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830008F20 product:hypothetical protein,
           full insert sequence
          Length = 2381

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 169 agaaggctggtcaggttgggga 190
           ||||||||||||||||||||||
Sbjct: 648 agaaggctggtcaggttgggga 627

>dbj|AK154713.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F630104E04
            product:hypothetical protein, full insert sequence
          Length = 1554

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 169  agaaggctggtcaggttgggga 190
            ||||||||||||||||||||||
Sbjct: 1255 agaaggctggtcaggttgggga 1234

>dbj|AK171365.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
            full-length enriched library, clone:F730044C15
            product:hypothetical protein, full insert sequence
          Length = 1554

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 169  agaaggctggtcaggttgggga 190
            ||||||||||||||||||||||
Sbjct: 1255 agaaggctggtcaggttgggga 1234

>gb|AC092440.5| Homo sapiens BAC clone RP11-453O5 from 4, complete sequence
          Length = 164781

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 217    agatatgcccaagtgccctgt 237
              |||||||||||||||||||||
Sbjct: 141115 agatatgcccaagtgccctgt 141095

>emb|CR933526.10| Zebrafish DNA sequence from clone DKEY-208P7 in linkage group 8,
             complete sequence
          Length = 100082

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 32    aatacaataaagtaaccaacaaat 55
             ||||||||||| ||||||||||||
Sbjct: 99778 aatacaataaaataaccaacaaat 99755

>gb|AC104655.4| Homo sapiens BAC clone RP11-383P6 from 2, complete sequence
          Length = 95616

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   aacagtggagctgctaccac 209
             ||||||||||||||||||||
Sbjct: 87779 aacagtggagctgctaccac 87760


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,800,638
Number of Sequences: 3902068
Number of extensions: 1800638
Number of successful extensions: 33820
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33783
Number of HSP's gapped (non-prelim): 37
length of query: 277
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 255
effective length of database: 17,147,199,772
effective search space: 4372535941860
effective search space used: 4372535941860
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)