ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags39o05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY106135.1| Zea mays PCO154542 mRNA sequence Length = 944 Score = 145 bits (73), Expect = 2e-31 Identities = 187/225 (83%) Strand = Plus / Minus Query: 162 gagctccttgaccaaggcgaccaccttggccgtatcaaccgtccacgccaccgagatcgg 221 ||||||||| || || ||||||||||||| | ||| |||||||| || ||||| ||||| Sbjct: 766 gagctccttcacaaacgcgaccaccttgggcacatcgaccgtccatgcgaccgaaatcgg 707 Query: 222 cgtgtagcccgaccacgcgttctctgaattgaacttcttgagccccatgtccatggatgt 281 | |||||| | ||||| ||||||||| || ||||||| ||| |||||||||||| || Sbjct: 706 tgagtagccagtccacgggttctctgagttccacttcttcagcaacatgtccatggaagt 647 Query: 282 gtggcctctgcagatgccctgggtctccacccgcaccacgcccttcctgaacgtgaagag 341 || || |||||||||||| |||||||||| ||||||||||||| |||||||||| || Sbjct: 646 atgcccgacgcagatgccctgcgtctccaccctcaccacgcccttcttgaacgtgaacag 587 Query: 342 ctccggccggaccagcgccgcgaagctcaccgggtcgtggaggaa 386 |||||| || || ||||| || ||||| ||||| ||||||||||| Sbjct: 586 ctccggacgaactagcgcggcaaagctgaccggatcgtggaggaa 542 Score = 73.8 bits (37), Expect = 6e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 499 tctgtgaagctcacctgggtggtgatgttgaggccgaccacggcgatatccgcgccggag 558 ||||||||||| || || || |||||||||||||| || ||| ||| ||||| || || Sbjct: 429 tctgtgaagctgacttgcgttgtgatgttgaggccaacgacgtagatgtccgccccagaa 370 Query: 559 gtgaacacgatgtccgccgcctccgggtcgctgtggatgtttgcttcagctgaaggggtg 618 ||||| || ||||| || |||||||| || |||||||| |||||||||| ||||| ||| Sbjct: 369 gtgaaaaccatgtcggctgcctccggatcactgtggatatttgcttcagtggaaggagtg 310 Query: 619 gcatt 623 ||||| Sbjct: 309 gcatt 305
>dbj|AK061415.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-D09, full insert sequence Length = 1329 Score = 113 bits (57), Expect = 7e-22 Identities = 123/145 (84%) Strand = Plus / Minus Query: 195 atcaaccgtccacgccaccgagatcggcgtgtagcccgaccacgcgttctctgaattgaa 254 |||||| ||||| || ||||||||||| | ||| || | ||||| ||| |||||||| | Sbjct: 1051 atcaacagtccaagcaaccgagatcggagagtaaccagtccacgggttgtctgaattcca 992 Query: 255 cttcttgagccccatgtccatggatgtgtggcctctgcagatgccctgggtctccacccg 314 |||||| || |||||||||||||| || || || ||||||||||||||||||| |||| Sbjct: 991 cttcttcagtcccatgtccatggaagtatgccccttgcagatgccctgggtctcaaccct 932 Query: 315 caccacgcccttcctgaacgtgaag 339 ||||||||||||| ||||||||||| Sbjct: 931 caccacgcccttcttgaacgtgaag 907 Score = 105 bits (53), Expect = 2e-19 Identities = 188/233 (80%) Strand = Plus / Minus Query: 400 ccgtacgagtggaggtgccagtcgctgtagaacttgcagatgtcgcagaggaactgcgcc 459 ||||| ||||||| |||||||| |||||||||||||||||||| || ||||| || || Sbjct: 846 ccgtaggagtggacatgccagtctctgtagaacttgcagatgtcacaaaggaattgtgcg 787 Query: 460 tgcttcccgccggagctcctcagctccgacaggtccgcctctgtgaagctcacctgggtg 519 |||||||| ||| |||| |||||| ||| ||| ||||||||| || ||||| Sbjct: 786 tgcttccctttcgagttccttagctccaacatatccttgtctgtgaagtagacttgggtt 727 Query: 520 gtgatgttgaggccgaccacggcgatatccgcgccggaggtgaacacgatgtccgccgcc 579 || ||||| ||||| || ||| |||||| || || || ||||| || ||||| || || Sbjct: 726 gttatgttaaggccaactacgtagatatctgccccagaagtgaaaactatgtcagctgct 667 Query: 580 tccgggtcgctgtggatgtttgcttcagctgaaggggtggcattccccgctgc 632 || |||||||| ||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 666 tctgggtcgctatggatatttgcttcagctgaaggggtggcattcccagctgc 614
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 91.7 bits (46), Expect = 3e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 254 acttcttgagccccatgtccatggatgtgtggcctctgcagatgccctgggtctccaccc 313 ||||||| || |||||||||||||| || || || ||||||||||||||||||| |||| Sbjct: 22376607 acttcttcagtcccatgtccatggaagtatgccccttgcagatgccctgggtctcaaccc 22376666 Query: 314 gcaccacgcccttcctgaacgtgaag 339 ||||||||||||| ||||||||||| Sbjct: 22376667 tcaccacgcccttcttgaacgtgaag 22376692 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Plus Query: 400 ccgtacgagtggaggtgccagtcgctgtagaacttgcagatgtcgcagaggaactgcgcc 459 ||||| ||||||| |||||||| |||||||||||||||||||| || ||||| || || Sbjct: 22376843 ccgtaggagtggacatgccagtctctgtagaacttgcagatgtcacaaaggaattgtgcg 22376902 Query: 460 tgcttccc 467 |||||||| Sbjct: 22376903 tgcttccc 22376910 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 598 tttgcttcagctgaaggggtggcattccccgctgc 632 ||||||||||||||||||||||||||||| ||||| Sbjct: 22377491 tttgcttcagctgaaggggtggcattcccagctgc 22377525
>dbj|AP005558.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1155_H10 Length = 140475 Score = 91.7 bits (46), Expect = 3e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 254 acttcttgagccccatgtccatggatgtgtggcctctgcagatgccctgggtctccaccc 313 ||||||| || |||||||||||||| || || || ||||||||||||||||||| |||| Sbjct: 138615 acttcttcagtcccatgtccatggaagtatgccccttgcagatgccctgggtctcaaccc 138674 Query: 314 gcaccacgcccttcctgaacgtgaag 339 ||||||||||||| ||||||||||| Sbjct: 138675 tcaccacgcccttcttgaacgtgaag 138700 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Plus Query: 400 ccgtacgagtggaggtgccagtcgctgtagaacttgcagatgtcgcagaggaactgcgcc 459 ||||| ||||||| |||||||| |||||||||||||||||||| || ||||| || || Sbjct: 138851 ccgtaggagtggacatgccagtctctgtagaacttgcagatgtcacaaaggaattgtgcg 138910 Query: 460 tgcttccc 467 |||||||| Sbjct: 138911 tgcttccc 138918 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 598 tttgcttcagctgaaggggtggcattccccgctgc 632 ||||||||||||||||||||||||||||| ||||| Sbjct: 139499 tttgcttcagctgaaggggtggcattcccagctgc 139533
>dbj|AP005546.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1003_C09 Length = 124746 Score = 91.7 bits (46), Expect = 3e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 254 acttcttgagccccatgtccatggatgtgtggcctctgcagatgccctgggtctccaccc 313 ||||||| || |||||||||||||| || || || ||||||||||||||||||| |||| Sbjct: 13096 acttcttcagtcccatgtccatggaagtatgccccttgcagatgccctgggtctcaaccc 13155 Query: 314 gcaccacgcccttcctgaacgtgaag 339 ||||||||||||| ||||||||||| Sbjct: 13156 tcaccacgcccttcttgaacgtgaag 13181 Score = 63.9 bits (32), Expect = 6e-07 Identities = 59/68 (86%) Strand = Plus / Plus Query: 400 ccgtacgagtggaggtgccagtcgctgtagaacttgcagatgtcgcagaggaactgcgcc 459 ||||| ||||||| |||||||| |||||||||||||||||||| || ||||| || || Sbjct: 13332 ccgtaggagtggacatgccagtctctgtagaacttgcagatgtcacaaaggaattgtgcg 13391 Query: 460 tgcttccc 467 |||||||| Sbjct: 13392 tgcttccc 13399 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 598 tttgcttcagctgaaggggtggcattccccgctgc 632 ||||||||||||||||||||||||||||| ||||| Sbjct: 13980 tttgcttcagctgaaggggtggcattcccagctgc 14014
>gb|AY109712.1| Zea mays CL31621_2 mRNA sequence Length = 877 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 280 gtgtggcctctgcagatgccctgggtctccacccgcaccacgcccttcctgaacgtgaag 339 |||||||| |||| |||||||||||||| |||| |||||| |||||| |||| |||||| Sbjct: 663 gtgtggccagtgcaaatgccctgggtctctaccctcaccacacccttcttgaatgtgaag 722
>gb|AY588275.1| Zea mays putative inosine-uridine preferring nucleoside hydrolase mRNA, complete cds Length = 1458 Score = 48.1 bits (24), Expect = 0.036 Identities = 51/60 (85%) Strand = Plus / Minus Query: 280 gtgtggcctctgcagatgccctgggtctccacccgcaccacgcccttcctgaacgtgaag 339 |||||||| |||| |||||||||||||| || | |||||| |||||| |||| |||||| Sbjct: 1013 gtgtggccagtgcaaatgccctgggtctctactctcaccacacccttcttgaatgtgaag 954
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 48.1 bits (24), Expect = 0.036 Identities = 27/28 (96%) Strand = Plus / Plus Query: 560 tgaacacgatgtccgccgcctccgggtc 587 |||| ||||||||||||||||||||||| Sbjct: 1793445 tgaagacgatgtccgccgcctccgggtc 1793472
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 44.1 bits (22), Expect = 0.55 Identities = 31/34 (91%) Strand = Plus / Plus Query: 548 ccgcgccggaggtgaacacgatgtccgccgcctc 581 ||||||||| ||||| |||||| ||||||||||| Sbjct: 1235114 ccgcgccgggggtgagcacgatctccgccgcctc 1235147
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome Length = 3147090 Score = 44.1 bits (22), Expect = 0.55 Identities = 22/22 (100%) Strand = Plus / Minus Query: 537 cacggcgatatccgcgccggag 558 |||||||||||||||||||||| Sbjct: 1597313 cacggcgatatccgcgccggag 1597292
>ref|NM_188486.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 573 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 cacccgcaccacgcccttcct 329 ||||||||||||||||||||| Sbjct: 321 cacccgcaccacgcccttcct 301
>gb|AY533503.1| Leishmania tropica strain MHOM/SU/74/SAF-K27 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533501.1| Leishmania major strain MHOM/SU/73/5ASKH nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533500.1| Leishmania infantum strain MHOM/FR/85/LEM716 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533499.1| Leishmania infantum strain MHOM/FR/87/LEM1098 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 902 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533498.1| Leishmania infantum strain MHOM/FR/82/LEM356 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533497.1| Leishmania donovani strain MHOM/CN/00/Wangjie1 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533496.1| Leishmania infantum strain MHOM/ES/81/BCN1 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533495.1| Leishmania infantum strain MHOM/FR/85/LEM663 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 608 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533494.1| Leishmania infantum strain MHOM/MA/67/ITMAP263 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533493.1| Leishmania donovani strain MHOM/ET/67/HU3 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533492.1| Leishmania infantum strain MHOM/FR/78/LEM75 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533491.1| Leishmania donovani strain MHOM/KE/67/MRC(L)3 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 913 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533490.1| Leishmania donovani strain MHOM/SD/82/GILANI nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533489.1| Leishmania donovani strain IMAR/KE/62/LRC-L57 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533488.1| Leishmania infantum strain MHOM/DZ/82/LIPA59 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533487.1| Leishmania donovani chagasi strain MHOM/PA/78/WR285 nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY533486.1| Leishmania donovani strain MHOM/ET/00/Hussen nonspecific nucleoside hydrolase (nsnh) gene, partial cds Length = 915 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 565 tgaacacaatgtgcgccgcctccgggtcg 537
>gb|AY603045.1| Leishmania major nonspecific nucleoside hydrolase gene, partial cds Length = 942 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 541 tgaacacaatgtgcgccgcctccgggtcg 513
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 561 gaacacgatgtccgccgcctccgggtcgc 589 ||||||||||||||| || |||||||||| Sbjct: 2540123 gaacacgatgtccgcggcatccgggtcgc 2540151
>gb|AY007193.1| Leishmania donovani nucleoside hydrolase (NH) gene, complete cds Length = 1101 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 665 tgaacacaatgtgcgccgcctccgggtcg 637
>gb|AY033633.1| Leishmania donovani nonspecific nucleoside hydrolase mRNA, complete cds Length = 2102 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 685 tgaacacaatgtgcgccgcctccgggtcg 657
>ref|XM_685028.1| PREDICTED: Danio rerio similar to sodium bicarbonate cotransporter (LOC561618), mRNA Length = 2880 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 ttgaacttcttgagccccatg 270 ||||||||||||||||||||| Sbjct: 1742 ttgaacttcttgagccccatg 1722
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 cacccgcaccacgcccttcct 329 ||||||||||||||||||||| Sbjct: 6534104 cacccgcaccacgcccttcct 6534084
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 549 cgcgccggaggtgaacacgat 569 ||||||||||||||||||||| Sbjct: 1204967 cgcgccggaggtgaacacgat 1204987
>dbj|AP002745.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0489G09 Length = 148707 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 cacccgcaccacgcccttcct 329 ||||||||||||||||||||| Sbjct: 101584 cacccgcaccacgcccttcct 101564
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 cacccgcaccacgcccttcct 329 ||||||||||||||||||||| Sbjct: 14275 cacccgcaccacgcccttcct 14255
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 532 ccgaccacggcgatatccgcgccgg 556 ||||||||||||||||| ||||||| Sbjct: 4812404 ccgaccacggcgatatcggcgccgg 4812428
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 297 gccctgggtctccacccgcac 317 ||||||||||||||||||||| Sbjct: 3038587 gccctgggtctccacccgcac 3038607
>emb|BX530036.7| Zebrafish DNA sequence from clone DKEY-93M18 in linkage group 21, complete sequence Length = 211643 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 250 ttgaacttcttgagccccatg 270 ||||||||||||||||||||| Sbjct: 30361 ttgaacttcttgagccccatg 30341
>dbj|AK073193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033023K13, full insert sequence Length = 1219 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 cacccgcaccacgcccttcct 329 ||||||||||||||||||||| Sbjct: 494 cacccgcaccacgcccttcct 474
>emb|AJ620721.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IN/1980/DD8 Length = 1050 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 592 tgaacacaatgtgcgccgcctccgggtcg 564
>emb|AJ620720.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/TU/1980/IPT-1 Length = 1062 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 589 tgaacacaatgtgcgccgcctccgggtcg 561
>emb|AJ620719.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IT/1979/FRANCESCA Length = 1022 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 548 tgaacacaatgtgcgccgcctccgggtcg 520
>emb|AJ620718.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/CN/1980/Strain A Length = 1064 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 550 tgaacacaatgtgcgccgcctccgggtcg 522
>emb|AJ620716.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/KE/1954/LRC-L53 Length = 1028 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 550 tgaacacaatgtgcgccgcctccgggtcg 522
>emb|AJ620715.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SA/1981/Jeddah KA Length = 1093 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 580 tgaacacaatgtgcgccgcctccgggtcg 552
>emb|AJ620714.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/KE/1975/Mutinga H9 Length = 1098 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 583 tgaacacaatgtgcgccgcctccgggtcg 555
>emb|AJ620713.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IQ/1977/BUMM3 Length = 1106 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620712.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MCAN/IQ/1981/SUKKAR 2 Length = 1070 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620711.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain IMAR/KE/1962/LRC-L57 Length = 1053 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 593 tgaacacaatgtgcgccgcctccgggtcg 565
>emb|AJ620710.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/KE/1973/MRC74 Length = 1051 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620709.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ET/1967/HU3 (LV9) Length = 1058 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620708.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/CN/0000/Wangjie-1 Length = 1103 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620707.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SD/97/LEM3463 Length = 1052 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 592 tgaacacaatgtgcgccgcctccgggtcg 564
>emb|AJ620706.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SD/97/LEM3429 Length = 1065 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620705.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SD/97/LEM3472 Length = 1051 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620704.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IT/93/ISS800 Length = 1051 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620703.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IT/94/ISS1036 Length = 1051 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620702.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ES/92/LLM373 Length = 1058 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620701.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ES/88/LLM175 Length = 1051 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620700.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SD/62/3S Length = 1071 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620699.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MCAN/SD/00/LEM3946 Length = 1061 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620698.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IN/54/SC23 Length = 1053 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620697.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/MT/1985/BUCK Length = 1054 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 591 tgaacacaatgtgcgccgcctccgggtcg 563
>emb|AJ620696.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/FR/1980/LEM189 Length = 1103 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620695.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ET/0000/HUSSEN Length = 1053 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 593 tgaacacaatgtgcgccgcctccgggtcg 565
>emb|AJ620694.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/SD/1982/GILANI Length = 1043 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620693.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ET/1972/GEBRE 1 Length = 1070 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620692.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IN/1996/THAK35 (LEM3178) Length = 1022 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 542 tgaacacaatgtgcgccgcctccgggtcg 514
>emb|AJ620691.1| Leishmania donovani iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/IN/0000/DEVI (LEM138) Length = 1062 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>emb|AJ620690.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/ES/1991/LEM2298 Length = 1064 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 593 tgaacacaatgtgcgccgcctccgggtcg 565
>emb|AJ620689.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/FR/1996/LEM3249 Length = 1053 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 541 tgaacacaatgtgcgccgcctccgggtcg 513
>emb|AJ620688.1| Leishmania infantum iunh gene for inosine-uridine preferring nucleoside hydrolase, strain MHOM/FR/1978/LEM75 Length = 1049 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 560 tgaacacgatgtccgccgcctccgggtcg 588 ||||||| |||| |||||||||||||||| Sbjct: 590 tgaacacaatgtgcgccgcctccgggtcg 562
>gb|U40940.1| Caenorhabditis elegans cosmid T03G6, complete sequence Length = 25574 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 241 ttctctgaattgaacttctt 260 |||||||||||||||||||| Sbjct: 21083 ttctctgaattgaacttctt 21064
>gb|AF238225.2| Botryotinia fuckeliana DHA14-like major facilitator (Bcmfs1) gene, complete cds Length = 3562 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 ggctgctgcttaattgctga 160 |||||||||||||||||||| Sbjct: 3117 ggctgctgcttaattgctga 3136
>emb|BX321861.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 6/10 Length = 298050 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 307 tccacccgcaccacgccctt 326 |||||||||||||||||||| Sbjct: 169094 tccacccgcaccacgccctt 169075
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 ccacgccaccgagatcggcg 223 |||||||||||||||||||| Sbjct: 2326579 ccacgccaccgagatcggcg 2326598
>gb|AE012441.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 349 of 460 of the complete genome Length = 12660 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 561 gaacacgatgtccgccgcctccgggtcg 588 ||||||||| | |||||||||||||||| Sbjct: 856 gaacacgatatgcgccgcctccgggtcg 883
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 40.1 bits (20), Expect = 8.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 328 ctgaacgtgaagagctccggccggaccagcgc 359 ||||||| |||||||||||||| |||| |||| Sbjct: 1857587 ctgaacgcgaagagctccggcccgacctgcgc 1857556
>gb|AE002160.2| Chlamydia muridarum Nigg, complete genome Length = 1072950 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 gcatgcagtgcgtcgaatgg 44 |||||||||||||||||||| Sbjct: 616413 gcatgcagtgcgtcgaatgg 616394
>gb|S79557.1| hyperthermophilic heat shock protein [Desulfurococcus, SY, Genomic, 1959 nt] Length = 1959 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gctgaggagctccttgacca 175 |||||||||||||||||||| Sbjct: 430 gctgaggagctccttgacca 449
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 561 gaacacgatgtccgccgcctccgggtcg 588 ||||||||| | |||||||||||||||| Sbjct: 1135991 gaacacgatatgcgccgcctccgggtcg 1136018
>dbj|AB001914.2| Homo sapiens genes for PACE4A-I, PACE4A-II, PACE4E-II, PACE4E-I, PACE4C, PACE4CS, PACE4B, PACE4D, complete cds Length = 55640 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 tgtgtggcctctgcagatgccctg 302 |||||||||||||||| ||||||| Sbjct: 40770 tgtgtggcctctgcagctgccctg 40793
>emb|BX005004.12| Zebrafish DNA sequence from clone DKEY-11L18, complete sequence Length = 216131 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 atacaatattagtacaattt 102 |||||||||||||||||||| Sbjct: 10076 atacaatattagtacaattt 10057
>emb|AL935122.10| Zebrafish DNA sequence from clone CH211-197C14 in linkage group 6, complete sequence Length = 198363 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 aatattagtacaatttcaaa 106 |||||||||||||||||||| Sbjct: 37123 aatattagtacaatttcaaa 37104
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 555 ggaggtgaacacgatgtccg 574 |||||||||||||||||||| Sbjct: 2071857 ggaggtgaacacgatgtccg 2071838 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,569,353 Number of Sequences: 3902068 Number of extensions: 4569353 Number of successful extensions: 79095 Number of sequences better than 10.0: 87 Number of HSP's better than 10.0 without gapping: 87 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78005 Number of HSP's gapped (non-prelim): 1089 length of query: 635 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 612 effective length of database: 17,143,297,704 effective search space: 10491698194848 effective search space used: 10491698194848 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
