ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal2i07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ234562.1|HVU234562 Hordeum vulgare genomic DNA fragment; c... 1108 0.0
2emb|AJ234450.1|HVU234450 Hordeum vulgare partial mRNA; clone cMW... 1084 0.0
3ref|XM_450593.1| Oryza sativa (japonica cultivar-group), mRNA 206 7e-50
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
5dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic D... 206 7e-50
6dbj|AK071395.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 7e-50
7gb|BT018115.1| Zea mays clone EL01N0553H03.c mRNA sequence 163 9e-37
8gb|AY107736.1| Zea mays PCO090313 mRNA sequence 147 6e-32
9ref|XM_546550.2| PREDICTED: Canis familiaris similar to Matrilys... 44 0.59
10gb|AC012470.16| Homo sapiens chromosome 10 clone RP11-506P9, com... 44 0.59
11emb|AL732567.8| Zebrafish DNA sequence from clone CH211-263A23 i... 44 0.59
12ref|XM_507654.1| PREDICTED: Pan troglodytes similar to enoyl Coe... 42 2.3
13gb|BC001091.1| Homo sapiens enoyl Coenzyme A hydratase domain co... 42 2.3
14ref|NM_024693.2| Homo sapiens enoyl Coenzyme A hydratase domain ... 42 2.3
15emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on ch... 42 2.3
16emb|BX294152.1| Pirellula sp. strain 1 complete genome; segment ... 42 2.3
17gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, com... 42 2.3
18gb|BC009617.1| Homo sapiens enoyl Coenzyme A hydratase domain co... 42 2.3
19gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, com... 42 2.3
20emb|CR624346.1| full-length cDNA clone CS0DC010YB03 of Neuroblas... 42 2.3
21emb|CR621986.1| full-length cDNA clone CS0DI005YJ06 of Placenta ... 42 2.3
22emb|CR614444.1| full-length cDNA clone CS0DK012YK14 of HeLa cell... 42 2.3
23emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblas... 42 2.3
24gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, com... 42 2.3
25emb|CR601232.1| full-length cDNA clone CS0DD007YE07 of Neuroblas... 42 2.3
26emb|CR599557.1| full-length cDNA clone CS0DI068YK20 of Placenta ... 42 2.3
27gb|AF275677.1|AF275677 Homo sapiens PP1494 protein mRNA, complet... 42 2.3
28gb|AF289604.1|AF289604 Homo sapiens clone pp8332 unknown mRNA 42 2.3
29gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 1... 42 2.3
30dbj|AK222511.1| Homo sapiens mRNA for enoyl Coenzyme A hydratase... 42 2.3
31dbj|AK024562.1| Homo sapiens cDNA: FLJ20909 fis, clone ADSE00425 42 2.3
32emb|CR450834.5| Zebrafish DNA sequence from clone CH211-237B9 in... 42 2.3
33gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete... 42 2.3
34gb|AC122789.8| Mus musculus chromosome 5, clone RP24-258A20, com... 40 9.2
35gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosom... 40 9.2
36gb|AC137942.6| Mus musculus chromosome 10, clone RP24-502K6, com... 40 9.2
37gb|AC147049.2| Pan troglodytes BAC clone RP43-131M1 from 3, comp... 40 9.2
38gb|AC131723.1| Mus musculus BAC clone RP23-144E24 from 1, comple... 40 9.2
39gb|AC145856.2| Pan troglodytes BAC clone RP43-5P12 from 7, compl... 40 9.2
40gb|AC006333.3| Homo sapiens BAC clone RP11-390E23 from 7, comple... 40 9.2
41gb|AC143357.1| Pan troglodytes BAC clone RP43-171L24 from 7, com... 40 9.2
42gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 9.2
43emb|AL356127.8| Human DNA sequence from clone RP11-368P1 on chro... 40 9.2
44emb|AL159151.56| Human DNA sequence from clone RP11-156O2 on chr... 40 9.2
45emb|AL034451.26|HS191E19 Human DNA sequence from clone RP1-191E1... 40 9.2
46emb|X58831.1|CSGDHANC C.sorokiniana gdhANC gene for NADP-specifi... 40 9.2
47emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in... 40 9.2
48gb|AC164315.2| Mus musculus BAC clone RP23-18J12 from chromosome... 40 9.2
49gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete s... 40 9.2
50gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, compl... 40 9.2
51gb|AC022150.6| Homo sapiens chromosome 19 clone CTD-3099C6, comp... 40 9.2
52gb|AC009898.6| Homo sapiens chromosome 8, clone RP11-138H14, com... 40 9.2
53gb|AF306554.1|AF306554 Orseolia oryzae mitotype 2 12S ribosomal ... 40 9.2
54gb|AC092405.2| Papio anubis clone RP41-170F23, complete sequence 40 9.2
55dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 40 9.2
56emb|BX321870.12| Zebrafish DNA sequence from clone RP71-42A14 in... 40 9.2
57emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, c... 40 9.2
58dbj|AP001303.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 9.2
59emb|BX255891.5| Zebrafish DNA sequence from clone DKEY-263P20 in... 40 9.2
60gb|AC006571.12|AC006571 Homo sapiens, clone hRPK.23_A_1, complet... 40 9.2
61emb|BX294008.8| Mouse DNA sequence from clone RP23-28K9 on chrom... 40 9.2
62gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Can... 40 9.2 
>emb|AJ234562.1|HVU234562 Hordeum vulgare genomic DNA fragment; clone MWG0803
          Length = 598

 Score = 1108 bits (559), Expect = 0.0
 Identities = 575/579 (99%), Gaps = 2/579 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atactgttgataggtttttctttctcggctatttgcc-ccaaacacttgacaacagnacc 59
           ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||
Sbjct: 586 atactgttgataggtttttctttctcggctatttgccaccaaacacttgacaacag-acc 528

                                                                       
Query: 60  gacagtaatatgcacagataaataaagttttacaattttacccagaagaaaacacaggcc 119
           ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 527 gacagkaatatgcacagataaawaaagttttacaattttacccagaagaaaacacaggcc 468

                                                                       
Query: 120 cacaaaggttacacagtatcttgacaaagcaacagactaagcaggagaggagtgacaaac 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467 cacaaaggttacacagtatcttgacaaagcaacagactaagcaggagaggagtgacaaac 408

                                                                       
Query: 180 ataagacattgcttatagcatataacaggctatggagggtgggggttaaattgaatagtc 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 ataagacattgcttatagcatataacaggctatggagggtgggggttaaattgaatagtc 348

                                                                       
Query: 240 ctacttgatcggtgacgacagccatctcgcggccagttctttctttcactggatatgctg 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 ctacttgatcggtgacgacagccatctcgcggccagttctttctttcactggatatgctg 288

                                                                       
Query: 300 ttcttccagtttgtcccttcactggatgtgcatgctgttcttccatctctgtgtagcagc 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 ttcttccagtttgtcccttcactggatgtgcatgctgttcttccatctctgtgtagcagc 228

                                                                       
Query: 360 actgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgttt 419
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 actgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgttt 168

                                                                       
Query: 420 gaagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccc 479
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 167 gaagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccc 108

                                                                       
Query: 480 tgatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaag 539
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 tgatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaag 48

                                                  
Query: 540 accgccgagttcttgggctgcgtcaaccctgggtttcct 578
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 47  accgccgagttcttgggctgcgtcaaccctgggtttcct 9
to top
>emb|AJ234450.1|HVU234450 Hordeum vulgare partial mRNA; clone cMWG0770
          Length = 594

 Score = 1084 bits (547), Expect = 0.0
 Identities = 576/581 (99%), Gaps = 4/581 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atactgttgataggtttttctttctcggctatttgcc-ccaaacacttgacaacagnacc 59
           ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||
Sbjct: 582 atactgttgataggtttttctttctcggctatttgccaccaaacacttgacaacag-acc 524

                                                                       
Query: 60  gacagtaatatgcacagataaataaagttttacaattttacccagaagaaaacacaggcc 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 gacagtaatatgcacagataaataaagttttacaattttacccagaagaaaacacaggcc 464

                                                                       
Query: 120 cacaaaggttacacagtatcttgacaaagcaacagactaagcaggagaggagtgacaaac 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 463 cacaaaggttacacagtatcttgacaaagcaacagactaagcaggagaggagtgacaaac 404

                                                                       
Query: 180 ataagacattgcttatagcatataacaggctatggagggtgggggttaaattgaatagtc 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 ataagacattgcttatagcatataacaggctatggagggtgggggttaaattgaatagtc 344

                                                                       
Query: 240 ctacttgatcggtgacga-cagccatctcgcggccagttctttcttt-cactggatatgc 297
           |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||
Sbjct: 343 ctacttgatcggtgacgaacagccatctcgcggccagttctttcttttcactggatatgc 284

                                                                       
Query: 298 tgttcttccagtttgtcccttcactggatgtgcatgctgttcttccatctctgtgtagca 357
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 tgtkcttccagtttgtcccttcactggatgtgcatgctgttcttccatctctgtgtagca 224

                                                                       
Query: 358 gcactgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgt 417
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 223 gcactgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgt 164

                                                                       
Query: 418 ttgaagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccac 477
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 ttgaagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccac 104

                                                                       
Query: 478 cctgatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaa 537
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103 cctgatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaa 44

                                                    
Query: 538 agaccgccgagttcttgggctgcgtcaaccctgggtttcct 578
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 43  agaccgccgagttcttgggctgcgtcaaccctgggtttcct 3
to top
>ref|XM_450593.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1102

 Score =  206 bits (104), Expect = 7e-50
 Identities = 255/304 (83%), Gaps = 1/304 (0%)
 Strand = Plus / Minus

                                                                       
Query: 372 gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 431
           ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 771 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 712

                                                                       
Query: 432 ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 491
           ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 711 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 652

                                                                       
Query: 492 tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 551
            |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 651 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 592

                                                                       
Query: 552 ttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatggttgctggctg 611
           |||| ||||  ||| ||||  |||||||| ||||||||| | |  ||||| |||||||| 
Sbjct: 591 ttggactgcaccaatcctgtatttcctagcgcaaataagtttggtgatggctgctggctc 532

                                                                       
Query: 612 cttgtgttgggcatatgcacggtagccctgagtgctttggcttgcatattgtgatcttgg 671
            |||||||||| ||| |||| |||| | |||||||||||||||||||  |||||||||||
Sbjct: 531 attgtgttgggaataggcactgtag-cttgagtgctttggcttgcatgctgtgatcttgg 473

               
Query: 672 agag 675
           ||||
Sbjct: 472 agag 469



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 220 gggggttaaattgaatagtcctac 243
           ||||||||||||||||||||||||
Sbjct: 881 gggggttaaattgaatagtcctac 858
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  206 bits (104), Expect = 7e-50
 Identities = 255/304 (83%), Gaps = 1/304 (0%)
 Strand = Plus / Minus

                                                                            
Query: 372      gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 431
                ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 11686135 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 11686076

                                                                            
Query: 432      ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 491
                ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 11686075 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 11686016

                                                                            
Query: 492      tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 551
                 |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 11686015 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 11685956

                                                                            
Query: 552      ttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatggttgctggctg 611
                |||| ||||  ||| ||||  |||||||| ||||||||| | |  ||||| |||||||| 
Sbjct: 11685955 ttggactgcaccaatcctgtatttcctagcgcaaataagtttggtgatggctgctggctc 11685896

                                                                            
Query: 612      cttgtgttgggcatatgcacggtagccctgagtgctttggcttgcatattgtgatcttgg 671
                 |||||||||| ||| |||| |||| | |||||||||||||||||||  |||||||||||
Sbjct: 11685895 attgtgttgggaataggcactgtag-cttgagtgctttggcttgcatgctgtgatcttgg 11685837

                    
Query: 672      agag 675
                ||||
Sbjct: 11685836 agag 11685833



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 220      gggggttaaattgaatagtcctac 243
                ||||||||||||||||||||||||
Sbjct: 11686245 gggggttaaattgaatagtcctac 11686222
to top
>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0711F01
          Length = 193091

 Score =  206 bits (104), Expect = 7e-50
 Identities = 255/304 (83%), Gaps = 1/304 (0%)
 Strand = Plus / Minus

                                                                          
Query: 372    gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 431
              ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 120769 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 120710

                                                                          
Query: 432    ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 491
              ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 120709 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 120650

                                                                          
Query: 492    tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 551
               |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 120649 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 120590

                                                                          
Query: 552    ttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatggttgctggctg 611
              |||| ||||  ||| ||||  |||||||| ||||||||| | |  ||||| |||||||| 
Sbjct: 120589 ttggactgcaccaatcctgtatttcctagcgcaaataagtttggtgatggctgctggctc 120530

                                                                          
Query: 612    cttgtgttgggcatatgcacggtagccctgagtgctttggcttgcatattgtgatcttgg 671
               |||||||||| ||| |||| |||| | |||||||||||||||||||  |||||||||||
Sbjct: 120529 attgtgttgggaataggcactgtag-cttgagtgctttggcttgcatgctgtgatcttgg 120471

                  
Query: 672    agag 675
              ||||
Sbjct: 120470 agag 120467



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 220    gggggttaaattgaatagtcctac 243
              ||||||||||||||||||||||||
Sbjct: 120879 gggggttaaattgaatagtcctac 120856
to top
>dbj|AK071395.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023095O09, full
           insert sequence
          Length = 1102

 Score =  206 bits (104), Expect = 7e-50
 Identities = 255/304 (83%), Gaps = 1/304 (0%)
 Strand = Plus / Minus

                                                                       
Query: 372 gagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtggga 431
           ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| |  
Sbjct: 771 gagtcatgagctgggctgtctgaatgcatgtccatggatgaatcgttcgaagccgtcgag 712

                                                                       
Query: 432 ttcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccctgatccagatgg 491
           ||  | ||||||   | |||||| || ||||| || ||||| |||||||| ||||| |||
Sbjct: 711 ttttgatcgcggttaacgccgtttgcgaagtaccccgcatcgccaccctgctccaggtgg 652

                                                                       
Query: 492 tatggttgcaggccccggcgcacggggctggatagtgcgttggaaaagaccgccgagttc 551
            |||||||||||| |||||| |||||||| |||||||| || ||||||||||| ||||||
Sbjct: 651 aatggttgcaggctccggcgaacggggctagatagtgcatttgaaaagaccgctgagttc 592

                                                                       
Query: 552 ttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatggttgctggctg 611
           |||| ||||  ||| ||||  |||||||| ||||||||| | |  ||||| |||||||| 
Sbjct: 591 ttggactgcaccaatcctgtatttcctagcgcaaataagtttggtgatggctgctggctc 532

                                                                       
Query: 612 cttgtgttgggcatatgcacggtagccctgagtgctttggcttgcatattgtgatcttgg 671
            |||||||||| ||| |||| |||| | |||||||||||||||||||  |||||||||||
Sbjct: 531 attgtgttgggaataggcactgtag-cttgagtgctttggcttgcatgctgtgatcttgg 473

               
Query: 672 agag 675
           ||||
Sbjct: 472 agag 469



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 220 gggggttaaattgaatagtcctac 243
           ||||||||||||||||||||||||
Sbjct: 881 gggggttaaattgaatagtcctac 858
to top
>gb|BT018115.1| Zea mays clone EL01N0553H03.c mRNA sequence
          Length = 1357

 Score =  163 bits (82), Expect = 9e-37
 Identities = 217/262 (82%)
 Strand = Plus / Minus

                                                                        
Query: 361  ctgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttg 420
            |||||||| ||||||| ||||||||||||||||| |||||||||||||| || || || |
Sbjct: 1120 ctgctcagtaggagtcatgagctgggctgtccgagtgcatgtccatggacgaatcattcg 1061

                                                                        
Query: 421  aagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccct 480
            |||||||||| |||   ||||||      |||||||| ||||| |||||||||||  |||
Sbjct: 1060 aagccgtggggttcacatcgcggcttgcaccgttcgcgaagtaccctgcatccccgtcct 1001

                                                                        
Query: 481  gatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaaga 540
            | || || ||||| |||||||||| ||| || | ||||||||||| |||| | |||||||
Sbjct: 1000 gctctaggtggtaaggttgcaggctccgccggatggggctggataatgcgcttgaaaaga 941

                                                                        
Query: 541  ccgccgagttcttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatg 600
            ||   || ||||||| ||| |||||||| ||||||||| | ||||||||||| |  ||||
Sbjct: 940  ccatggaattcttggactgtgtcaacccagggtttcctggagcaaataagcttggcgatg 881

                                  
Query: 601  gttgctggctgcttgtgttggg 622
            |||||||| |||||||||||||
Sbjct: 880  gttgctggttgcttgtgttggg 859
to top
>gb|AY107736.1| Zea mays PCO090313 mRNA sequence
          Length = 1090

 Score =  147 bits (74), Expect = 6e-32
 Identities = 215/262 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 ctgctcaggaggagtcgtgagctgggctgtccgaatgcatgtccatggatgagtcgtttg 420
           |||||||| ||||||| ||||||||||||||||| |||||||||||||| || || || |
Sbjct: 828 ctgctcagtaggagtcatgagctgggctgtccgagtgcatgtccatggacgaatcattcg 769

                                                                       
Query: 421 aagccgtgggattcggctcgcgggccaagccgttcgcaaagtagcctgcatccccaccct 480
           |||||||||| |||   ||||||      |||||||| ||||| |||||||||||  |||
Sbjct: 768 aagccgtggggttcacatcgcggcttgcaccgttcgcgaagtaccctgcatccccgtcct 709

                                                                       
Query: 481 gatccagatggtatggttgcaggccccggcgcacggggctggatagtgcgttggaaaaga 540
           | || || ||||| ||| |||||| ||| || | ||||||||||| |||| | |||||||
Sbjct: 708 gctctaggtggtaaggtggcaggctccgccggatggggctggataatgcgcttgaaaaga 649

                                                                       
Query: 541 ccgccgagttcttgggctgcgtcaaccctgggtttcctagtgcaaataagctcgcagatg 600
           ||   || ||||||| ||| |||||||| |||||||||   ||||||||||| |  ||||
Sbjct: 648 ccatggaattcttggactgtgtcaacccagggtttcctgaagcaaataagcttggcgatg 589

                                 
Query: 601 gttgctggctgcttgtgttggg 622
           |||||||| |||||||||||||
Sbjct: 588 gttgctggttgcttgtgttggg 567



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 62   cagtaatatgcacagataaat 82
            |||||||||||||||||||||
Sbjct: 1064 cagtaatatgcacagataaat 1044
to top
>ref|XM_546550.2| PREDICTED: Canis familiaris similar to Matrilysin precursor (Pump-1
            protease) (Uterine metalloproteinase) (Matrix
            metalloproteinase-7) (MMP-7) (Matrin) (LOC489432), mRNA
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 69   atgcacagataaataaagtttt 90
            ||||||||||||||||||||||
Sbjct: 1015 atgcacagataaataaagtttt 1036
to top
>gb|AC012470.16| Homo sapiens chromosome 10 clone RP11-506P9, complete sequence
          Length = 122543

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 109   aaacacaggcccacaaaggtta 130
             ||||||||||||||||||||||
Sbjct: 31975 aaacacaggcccacaaaggtta 31996
to top
>emb|AL732567.8| Zebrafish DNA sequence from clone CH211-263A23 in linkage group 6,
             complete sequence
          Length = 152840

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 89    ttacaattttacccagaagaaa 110
             ||||||||||||||||||||||
Sbjct: 60018 ttacaattttacccagaagaaa 59997
to top
>ref|XM_507654.1| PREDICTED: Pan troglodytes similar to enoyl Coenzyme A hydratase
           domain containing 3 (LOC450300), mRNA
          Length = 1401

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 858 cccagaagaaaacacaggccc 838
to top
>gb|BC001091.1| Homo sapiens enoyl Coenzyme A hydratase domain containing 3, mRNA
           (cDNA clone IMAGE:3505013), partial cds
          Length = 1407

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 271 cccagaagaaaacacaggccc 251
to top
>ref|NM_024693.2| Homo sapiens enoyl Coenzyme A hydratase domain containing 3
           (ECHDC3), mRNA
          Length = 1648

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 512 cccagaagaaaacacaggccc 492
to top
>emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on chromosome 10 Contains
             gene FLJ20909, the gene for a novel protein (MGC35403), a
             novel gene (LOC219731), the 3' end of the UPF2 gene for
             UPF2 regulator of nonsense transcripts homolog (yeast)
             (FLJ38872) and four CpG islands, complete sequence
          Length = 206587

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 100   cccagaagaaaacacaggccc 120
             |||||||||||||||||||||
Sbjct: 26307 cccagaagaaaacacaggccc 26287
to top
>emb|BX294152.1| Pirellula sp. strain 1 complete genome; segment 20/24
          Length = 304250

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 241    tacttgatcggtgacgacagc 261
              |||||||||||||||||||||
Sbjct: 301986 tacttgatcggtgacgacagc 301966
to top
>gb|AC135995.7| Homo sapiens chromosome 15, clone RP13-608F4, complete sequence
          Length = 157246

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 100  cccagaagaaaacacaggccc 120
            |||||||||||||||||||||
Sbjct: 8301 cccagaagaaaacacaggccc 8281
to top
>gb|BC009617.1| Homo sapiens enoyl Coenzyme A hydratase domain containing 3, mRNA
           (cDNA clone MGC:16831 IMAGE:3893103), complete cds
          Length = 1609

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 460 cccagaagaaaacacaggccc 440
to top
>gb|AC126605.4| Homo sapiens chromosome 15, clone RP11-606M5, complete sequence
          Length = 169125

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 100   cccagaagaaaacacaggccc 120
             |||||||||||||||||||||
Sbjct: 79871 cccagaagaaaacacaggccc 79851
to top
>emb|CR624346.1| full-length cDNA clone CS0DC010YB03 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1597

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 509 cccagaagaaaacacaggccc 489
to top
>emb|CR621986.1| full-length cDNA clone CS0DI005YJ06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1569

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 479 cccagaagaaaacacaggccc 459
to top
>emb|CR614444.1| full-length cDNA clone CS0DK012YK14 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1065

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 25  cccagaagaaaacacaggccc 5
to top
>emb|CR612555.1| full-length cDNA clone CS0DA002YJ22 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1877

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 100  cccagaagaaaacacaggccc 120
            |||||||||||||||||||||
Sbjct: 1703 cccagaagaaaacacaggccc 1683
to top
>gb|AC110291.6| Homo sapiens chromosome 15, clone RP11-379H8, complete sequence
          Length = 186812

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 100   cccagaagaaaacacaggccc 120
             |||||||||||||||||||||
Sbjct: 81974 cccagaagaaaacacaggccc 81994
to top
>emb|CR601232.1| full-length cDNA clone CS0DD007YE07 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1540

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 458 cccagaagaaaacacaggccc 438
to top
>emb|CR599557.1| full-length cDNA clone CS0DI068YK20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1545

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 462 cccagaagaaaacacaggccc 442
to top
>gb|AF275677.1|AF275677 Homo sapiens PP1494 protein mRNA, complete cds
          Length = 1648

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 512 cccagaagaaaacacaggccc 492
to top
>gb|AF289604.1|AF289604 Homo sapiens clone pp8332 unknown mRNA
          Length = 1771

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 494 cccagaagaaaacacaggccc 474
to top
>gb|AC010724.6|AC010724 Homo sapiens BAC clone RP11-152F13 from 15, complete sequence
          Length = 157200

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 100   cccagaagaaaacacaggccc 120
             |||||||||||||||||||||
Sbjct: 21464 cccagaagaaaacacaggccc 21444
to top
>dbj|AK222511.1| Homo sapiens mRNA for enoyl Coenzyme A hydratase domain containing
           3 variant, clone: adSE01048
          Length = 1615

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 477 cccagaagaaaacacaggccc 457
to top
>dbj|AK024562.1| Homo sapiens cDNA: FLJ20909 fis, clone ADSE00425
          Length = 1588

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 100 cccagaagaaaacacaggccc 120
           |||||||||||||||||||||
Sbjct: 451 cccagaagaaaacacaggccc 431
to top
>emb|CR450834.5| Zebrafish DNA sequence from clone CH211-237B9 in linkage group 11,
             complete sequence
          Length = 137302

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    aaagttttacaattttaccca 103
             |||||||||||||||||||||
Sbjct: 65499 aaagttttacaattttaccca 65519
to top
>gb|M18000.1|HUMRPS17A Human ribosomal protein S17 gene, complete cds
          Length = 4029

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 100  cccagaagaaaacacaggccc 120
            |||||||||||||||||||||
Sbjct: 3662 cccagaagaaaacacaggccc 3642
to top
>gb|AC122789.8| Mus musculus chromosome 5, clone RP24-258A20, complete sequence
          Length = 182866

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 340    ttccatctctgtgtagcagc 359
              ||||||||||||||||||||
Sbjct: 128746 ttccatctctgtgtagcagc 128727
to top
>gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosome 14, complete sequence
          Length = 227936

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 141    tgacaaagcaacagactaagcagg 164
              ||||||||||||||| ||||||||
Sbjct: 192176 tgacaaagcaacagaataagcagg 192199
to top
>gb|AC137942.6| Mus musculus chromosome 10, clone RP24-502K6, complete sequence
          Length = 173848

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   ttctttctttcactggatat 295
             ||||||||||||||||||||
Sbjct: 43543 ttctttctttcactggatat 43562
to top
>gb|AC147049.2| Pan troglodytes BAC clone RP43-131M1 from 3, complete sequence
          Length = 185806

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 30     tatttgccccaaacacttgacaac 53
              ||||||||||||| ||||||||||
Sbjct: 133662 tatttgccccaaagacttgacaac 133639
to top
>gb|AC131723.1| Mus musculus BAC clone RP23-144E24 from 1, complete sequence
          Length = 200656

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 653    ttgcatattgtgatcttgga 672
              ||||||||||||||||||||
Sbjct: 112051 ttgcatattgtgatcttgga 112070
to top
>gb|AC145856.2| Pan troglodytes BAC clone RP43-5P12 from 7, complete sequence
          Length = 185183

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    tatttgccccaaacacttgacaac 53
             ||||||||||||| ||||||||||
Sbjct: 27422 tatttgccccaaagacttgacaac 27399
to top
>gb|AC006333.3| Homo sapiens BAC clone RP11-390E23 from 7, complete sequence
          Length = 187532

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      gttgataggtttttctttct 25
              ||||||||||||||||||||
Sbjct: 170948 gttgataggtttttctttct 170929
to top
>gb|AC143357.1| Pan troglodytes BAC clone RP43-171L24 from 7, complete sequence
          Length = 181482

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     gttgataggtttttctttct 25
             ||||||||||||||||||||
Sbjct: 60069 gttgataggtttttctttct 60050
to top
>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 493    atggttgcaggccccggcgcacgg 516
              |||| |||||||||||||||||||
Sbjct: 715507 atgggtgcaggccccggcgcacgg 715484
to top
>emb|AL356127.8| Human DNA sequence from clone RP11-368P1 on chromosome 6, complete
             sequence
          Length = 139086

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    taaagttttacaattttacc 101
             ||||||||||||||||||||
Sbjct: 44423 taaagttttacaattttacc 44442
to top
>emb|AL159151.56| Human DNA sequence from clone RP11-156O2 on chromosome 13, complete
             sequence
          Length = 59116

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 334   ctgttcttccatctctgtgt 353
             ||||||||||||||||||||
Sbjct: 45267 ctgttcttccatctctgtgt 45286
to top
>emb|AL034451.26|HS191E19 Human DNA sequence from clone RP1-191E19 on chromosome 6q23.2-24.2,
            complete sequence
          Length = 110885

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 77   ataaataaagttttacaattttac 100
            |||||||||| |||||||||||||
Sbjct: 2492 ataaataaagctttacaattttac 2515
to top
>emb|X58831.1|CSGDHANC C.sorokiniana gdhANC gene for NADP-specific glutamate dehydrogenase
            (ANC=Ammonium-inducible, Nuclear encoded, Chloroplastic
            isoenzyme)
          Length = 9872

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 397  gcatgtccatggatgagtcg 416
            ||||||||||||||||||||
Sbjct: 9356 gcatgtccatggatgagtcg 9375
to top
>emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in linkage group 8,
             complete sequence
          Length = 168402

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aaataaagttttacaatttt 98
             ||||||||||||||||||||
Sbjct: 39721 aaataaagttttacaatttt 39702
to top
>gb|AC164315.2| Mus musculus BAC clone RP23-18J12 from chromosome 14, complete sequence
          Length = 204011

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 141    tgacaaagcaacagactaagcagg 164
              ||||||||||||||| ||||||||
Sbjct: 136596 tgacaaagcaacagaataagcagg 136573
to top
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
          Length = 104879

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   tgggggttaaattgaatagt 238
             ||||||||||||||||||||
Sbjct: 88195 tgggggttaaattgaatagt 88214
to top
>gb|AC022039.7| Homo sapiens chromosome 8, clone RP11-3G21, complete sequence
          Length = 176815

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    acataagacattgcttatag 197
              ||||||||||||||||||||
Sbjct: 155089 acataagacattgcttatag 155070
to top
>gb|AC022150.6| Homo sapiens chromosome 19 clone CTD-3099C6, complete sequence
          Length = 228156

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   cccttcactggatgtgcatg 333
             ||||||||||||||||||||
Sbjct: 29161 cccttcactggatgtgcatg 29142
to top
>gb|AC009898.6| Homo sapiens chromosome 8, clone RP11-138H14, complete sequence
          Length = 168539

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   acataagacattgcttatag 197
             ||||||||||||||||||||
Sbjct: 22008 acataagacattgcttatag 21989
to top
>gb|AF306554.1|AF306554 Orseolia oryzae mitotype 2 12S ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 414

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 78  taaataaagttttacaattt 97
           ||||||||||||||||||||
Sbjct: 302 taaataaagttttacaattt 283
to top
>gb|AC092405.2| Papio anubis clone RP41-170F23, complete sequence
          Length = 182902

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   actaagcaggagaggagtga 174
             ||||||||||||||||||||
Sbjct: 14739 actaagcaggagaggagtga 14720
to top
>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 67      atatgcacagataaataaagtttt 90
               ||||||||||||| ||||||||||
Sbjct: 1104352 atatgcacagatatataaagtttt 1104329
to top
>emb|BX321870.12| Zebrafish DNA sequence from clone RP71-42A14 in linkage group 22,
            complete sequence
          Length = 165445

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 76   gataaataaagttttacaat 95
            ||||||||||||||||||||
Sbjct: 3625 gataaataaagttttacaat 3644
to top
>emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, complete sequence
          Length = 183614

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aaataaagttttacaatttt 98
             ||||||||||||||||||||
Sbjct: 19006 aaataaagttttacaatttt 18987
to top
>dbj|AP001303.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K24M9
          Length = 45292

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   gttcttccagtttgtccctt 318
             ||||||||||||||||||||
Sbjct: 17465 gttcttccagtttgtccctt 17446
to top
>emb|BX255891.5| Zebrafish DNA sequence from clone DKEY-263P20 in linkage group 20,
             complete sequence
          Length = 104855

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    aataaagttttacaatttta 99
             ||||||||||||||||||||
Sbjct: 25058 aataaagttttacaatttta 25039
to top
>gb|AC006571.12|AC006571 Homo sapiens, clone hRPK.23_A_1, complete sequence
          Length = 134896

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 77    ataaataaagttttacaattttac 100
             |||||||||| |||||||||||||
Sbjct: 83539 ataaataaagctttacaattttac 83562
to top
>emb|BX294008.8| Mouse DNA sequence from clone RP23-28K9 on chromosome X, complete
             sequence
          Length = 136485

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   gccagttctttctttcactg 290
             ||||||||||||||||||||
Sbjct: 27867 gccagttctttctttcactg 27848
to top
>gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 173453

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 276    ttctttctttcactggatat 295
              ||||||||||||||||||||
Sbjct: 123254 ttctttctttcactggatat 123273


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,463,405
Number of Sequences: 3902068
Number of extensions: 7463405
Number of successful extensions: 121248
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 62
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 121074
Number of HSP's gapped (non-prelim): 160
length of query: 675
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 652
effective length of database: 17,143,297,704
effective search space: 11177430103008
effective search space used: 11177430103008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top