ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags39m01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_549856.1| Oryza sativa (japonica cultivar-group), mRNA 232 1e-57
2dbj|AK070363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 1e-57
3dbj|AK058708.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 1e-57
4gb|AY107854.1| Zea mays PCO142176 mRNA sequence 196 6e-47
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 109 1e-20
6dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic D... 109 1e-20
7dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic D... 109 1e-20
8gb|AC099011.1| Drosophila melanogaster, chromosome 2L, region 24... 54 5e-04
9gb|AC092240.1|AC092240 Drosophila melanogaster, chromosome 2L, r... 54 5e-04
10gb|AE003578.3| Drosophila melanogaster chromosome 2L, section 13... 54 5e-04
11gb|AC005732.1|AC005732 Drosophila melanogaster DNA sequence (P1s... 54 5e-04
12gb|AC008351.4|AC008351 Drosophila melanogaster, chromosome 2R, r... 52 0.002
13gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66... 52 0.002
14ref|NM_057719.3| Drosophila melanogaster Megator CG8274-RA (Mtor... 50 0.008
15gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48... 50 0.008
16gb|AY050227.1| Drosophila melanogaster SD01380 full length cDNA 50 0.008
17gb|AC005466.5|AC005466 Drosophila melanogaster, chromosome 2R, r... 50 0.008
18gb|AE003824.3| Drosophila melanogaster chromosome 2R, section 26... 50 0.008
19gb|U91980.1|DMU91980 Drosophila melanogaster Tpr homolog mRNA, c... 50 0.008
20gb|AC093547.3| Drosophila melanogaster 3L BAC RP98-2K11 (Roswell... 48 0.032
21gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, r... 48 0.032
22gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, r... 48 0.032
23gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, r... 48 0.032
24gb|AC008187.6|AC008187 Drosophila melanogaster, chromosome 2R, r... 48 0.032
25gb|AE003827.3| Drosophila melanogaster chromosome 2R, section 23... 48 0.032
26gb|AE003598.2| Drosophila melanogaster chromosome 3L, section 79... 48 0.032
27gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 48 0.032
28ref|XM_462353.1| Debaryomyces hansenii CBS767 hypothetical prote... 46 0.13
29ref|XM_751621.1| Ustilago maydis 521 hypothetical protein (UM005... 46 0.13
30emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 46 0.13
31gb|AC010967.3| Homo sapiens BAC clone RP11-7H13 from 2, complete... 46 0.13
32ref|NM_113804.3| Arabidopsis thaliana ATP binding AT3G28830 mRNA... 44 0.49
33gb|AC167815.3| Mus musculus BAC clone RP23-463H10 from chromosom... 44 0.49
34gb|AC010922.10| Drosophila melanogaster clone BACR09H01, complet... 44 0.49
35ref|XM_951809.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.49
36ref|XM_328134.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.49
37gb|DQ491001.1| Chlorella virus MT325 ctg_71 genomic sequence 44 0.49
38ref|NM_025725.2| Mus musculus coiled-coil domain containing 96 (... 44 0.49
39gb|AC138679.10| Mus musculus chromosome 5, clone RP23-177I4, com... 44 0.49
40ref|XM_752057.1| Ustilago maydis 521 hypothetical protein (UM010... 44 0.49
41ref|XM_753970.1| Ustilago maydis 521 hypothetical protein (UM029... 44 0.49
42emb|AJ297289.1|PNI297289 Populus nigra microsatellite DNA, clone... 44 0.49
43emb|AL513408.1|NC61D6 Neurospora crassa DNA linkage group II Cos... 44 0.49
44emb|AL355927.1|NCB1D1 Neurospora crassa DNA linkage group II BAC... 44 0.49
45emb|AL024484.2|DMC96G10 Drosophila melanogaster cosmid clone 96G10 44 0.49
46gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell... 44 0.49
47tpg|BK002579.1| TPA: TPA_inf: Drosophila melanogaster HDC13963 (... 44 0.49
48gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell P... 44 0.49
49gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-6... 44 0.49
50dbj|AK015646.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.49
51dbj|AK014878.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.49
52dbj|AK030023.1| Mus musculus adult male testis cDNA, RIKEN full-... 44 0.49
53gb|AC007947.5|AC007947 Drosophila melanogaster, chromosome 3R, r... 44 0.49
54gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, r... 44 0.49
55gb|AF180942.1|ATRPP5LE2 Arabidopsis thaliana RPP5 disease resist... 44 0.49
56gb|BT004302.1| Arabidopsis thaliana clone RAFL15-45-C21 (R20902)... 44 0.49
57dbj|AP002057.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 44 0.49
58gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51... 44 0.49
59gb|AE003768.2| Drosophila melanogaster chromosome 3R, section 10... 44 0.49
60gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 ... 44 0.49
61gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 ... 44 0.49
62gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 ... 44 0.49
63gb|AC131803.3| Mus musculus BAC clone RP24-549I15 from chromosom... 44 0.49
64ref|NM_184180.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.0
65ref|XM_520821.1| PREDICTED: Pan troglodytes similar to DDX11 pro... 42 2.0
66ref|XM_529479.1| PREDICTED: Pan troglodytes LOC451824 (LOC451824... 42 2.0
67ref|NM_030655.2| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box p... 42 2.0
68ref|NM_030653.2| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box p... 42 2.0
69ref|NM_004399.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box p... 42 2.0
70gb|BC085279.1| Mus musculus RIKEN cDNA 2310040C09 gene, mRNA (cD... 42 2.0
71ref|XM_323946.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.0
72ref|XM_363887.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.0
73gb|BC078152.1| Homo sapiens cDNA clone IMAGE:6061719, containing... 42 2.0
74ref|XM_952832.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.0
75ref|NM_178618.2| Mus musculus RIKEN cDNA 2310040C09 gene (231004... 42 2.0
76ref|XM_755515.1| Ustilago maydis 521 hypothetical protein (UM044... 42 2.0
77ref|XM_757135.1| Ustilago maydis 521 hypothetical protein (UM060... 42 2.0
78ref|XM_381612.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 42 2.0
79gb|BC011264.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 42 2.0
80gb|AY389348.1| Homo sapiens LDL receptor adaptor protein (ARH) g... 42 2.0
81emb|BX321882.7| Zebrafish DNA sequence from clone DKEYP-30F1 in ... 42 2.0
82gb|BC111733.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 42 2.0
83emb|AL139277.7| Human DNA sequence from clone RP11-465E19 on chr... 42 2.0
84emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in ... 42 2.0
85emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cos... 42 2.0
86gb|BC050522.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 42 2.0
87gb|BC047317.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 42 2.0
88ref|NM_182501.2| Homo sapiens MTERF domain containing 2 (MTERFD2... 42 2.0
89gb|BC050069.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box pol... 42 2.0
90emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 42 2.0
91emb|CR615652.1| full-length cDNA clone CS0DF037YL05 of Fetal bra... 42 2.0
92gb|BC053533.1| Homo sapiens MTERF domain containing 2, mRNA (cDN... 42 2.0
93dbj|AK131298.1| Homo sapiens cDNA FLJ16261 fis, clone IMR322007078 42 2.0
94emb|CR622447.1| full-length cDNA clone CS0DC010YC23 of Neuroblas... 42 2.0
95emb|CR617083.1| full-length cDNA clone CS0DI071YA05 of Placenta ... 42 2.0
96emb|CR607675.1| full-length cDNA clone CS0DF022YI07 of Fetal bra... 42 2.0
97emb|CR590225.1| full-length cDNA clone CS0DC003YH23 of Neuroblas... 42 2.0
98dbj|AK021703.1| Homo sapiens cDNA FLJ11641 fis, clone HEMBA10043... 42 2.0
99gb|AC006432.15| Homo sapiens 12p13 PAC RPCI11-726G1 (Roswell Par... 42 2.0
100dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 42 2.0
101ref|XM_927232.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
102ref|XM_931954.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
103ref|XM_931947.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
104ref|XM_931941.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
105ref|XM_931933.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
106ref|XM_931927.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
107ref|XM_495908.2| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
108ref|XM_931918.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
109ref|XM_931915.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
110ref|XM_931895.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
111ref|XM_931891.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
112ref|XM_931887.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
113ref|XM_931883.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
114ref|XM_931876.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
115ref|XM_931872.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
116ref|XM_931867.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
117ref|XM_931845.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
118ref|XM_931839.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
119ref|XM_931836.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
120ref|XM_931833.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp... 42 2.0
121ref|XM_944856.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-... 42 2.0
122ref|XM_944852.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-... 42 2.0
123ref|XM_944851.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-... 42 2.0
124ref|XM_940861.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-... 42 2.0
125ref|XM_944847.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-... 42 2.0
126ref|XM_697070.1| PREDICTED: Danio rerio hypothetical protein LOC... 42 2.0
127ref|XM_689738.1| PREDICTED: Danio rerio similar to peptidylproly... 42 2.0
128emb|BX572623.8| Human DNA sequence from clone XXyac-22CH10 on ch... 42 2.0
129gb|AY007367.1| Lycopersicon esculentum tospovirus resistance pro... 42 2.0
130gb|AC158493.2| Capitella capitata clone JGIAUTO-1A6, complete se... 42 2.0
131dbj|AK028566.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 42 2.0
132gb|AC092821.11| Homo sapiens 12 BAC RP11-525E9 (Roswell Park Can... 42 2.0
133gb|AC007723.5|AC007723 Drosophila melanogaster, chromosome 3R, r... 42 2.0
134gb|AC005237.2|AC005237 Homo sapiens BAC clone RP11-556H17 from 2... 42 2.0
135ref|NM_199890.1| Danio rerio peptidylprolyl isomerase (cyclophil... 42 2.0
136gb|AC009533.10| Homo sapiens 12 BAC RP11-22B23 (Roswell Park Can... 42 2.0
137emb|BX000984.7| Zebrafish DNA sequence from clone CH211-157C7, c... 42 2.0
138gb|BC056814.1| Danio rerio peptidylprolyl isomerase (cyclophilin... 42 2.0
139dbj|AP003233.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
140gb|AY893130.1| Synthetic construct Homo sapiens clone FLH119967.... 42 2.0
141emb|BX648184.1|HSM808332 Homo sapiens mRNA; cDNA DKFZp686L13129 ... 42 2.0
142emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in... 42 2.0
143gb|AC008013.8| Homo sapiens 12 BAC RP11-551L14 (Roswell Park Can... 42 2.0
144gb|AE003700.3| Drosophila melanogaster chromosome 3R, section 38... 42 2.0
145gb|AC132471.4| Mus musculus BAC clone RP23-106E17 from 10, compl... 42 2.0
146gb|U75968.1|HSU75968 Human clone C3 CHL1 protein (CHLR1) mRNA, a... 42 2.0
147gb|U75967.1|HSU75967 Human CHL1 potential helicase (CHLR1), comp... 42 2.0
148gb|U33834.1|HSU33834 Human CHL1-related helicase (CHLR2) mRNA, p... 42 2.0
149gb|U33833.1|HSU33833 Human CHL1-related helicase (CHLR1) mRNA, c... 42 2.0
150emb|X99583.1|HSCHL1 H.sapiens mRNA for CHL1 protein 42 2.0
151dbj|AP002909.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
152ref|NM_127512.2| Arabidopsis thaliana nucleotide binding AT2G195... 40 7.7
153ref|XM_638940.1| Dictyostelium discoideum hypothetical protein (... 40 7.7
154ref|XM_638425.1| Dictyostelium discoideum hypothetical protein (... 40 7.7
155ref|XM_635248.1| Dictyostelium discoideum hypothetical protein (... 40 7.7
156ref|XM_509170.1| PREDICTED: Pan troglodytes amplified in osteosa... 40 7.7
157ref|XM_480116.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.7
158ref|NM_194693.1| Oryza sativa (japonica cultivar-group) unknown ... 40 7.7
159gb|AC154044.2| Drosophila melanogaster clone BACR32E02, complete... 40 7.7
160gb|AC154051.2| Drosophila melanogaster clone BACR17E02, complete... 40 7.7
161ref|XM_469446.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.7
162gb|AE017135.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 7.7
163gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.7
164gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.7
165gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 40 7.7
166gb|AC084046.13| Trypanosoma brucei chromosome 6 clone RPCI93-3D8... 40 7.7
167gb|AC008225.4| Drosophila melanogaster clone BACR03E11, complete... 40 7.7
168gb|AC010124.6| Drosophila melanogaster clone BACR06O03, complete... 40 7.7
169gb|AC012164.12| Drosophila melanogaster clone BACR14D22, complet... 40 7.7
170gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromoso... 40 7.7
171gb|AC150554.1| Drosophila melanogaster clone BACR21O10, complete... 40 7.7
172ref|XM_960622.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
173gb|AC185243.2| Pan troglodytes BAC clone CH251-228E19 from chrom... 40 7.7
174ref|XM_323037.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
175ref|XM_954556.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
176ref|XM_956419.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
177ref|XM_956624.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
178ref|XM_959956.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
179ref|XM_326597.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
180ref|XM_327787.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
181ref|XM_328862.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
182ref|XM_331782.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.7
183ref|NM_006812.2| Homo sapiens amplified in osteosarcoma (OS9), t... 40 7.7
184ref|NM_001017956.1| Homo sapiens amplified in osteosarcoma (OS9)... 40 7.7
185ref|NM_001017957.1| Homo sapiens amplified in osteosarcoma (OS9)... 40 7.7
186ref|NM_001017958.1| Homo sapiens amplified in osteosarcoma (OS9)... 40 7.7
187ref|XM_705666.1| Candida albicans SC5314 putative DNA repair apu... 40 7.7
188ref|XM_705628.1| Candida albicans SC5314 putative DNA repair apu... 40 7.7
189gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 7.7
190ref|XM_654417.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 7.7
191gb|AE009952.1| Yersinia pestis KIM, complete genome 40 7.7
192ref|XM_454170.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E04939g ... 40 7.7
193ref|XM_452424.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C05016g ... 40 7.7
194gb|BT014350.1| Lycopersicon esculentum clone 133626F, mRNA sequence 40 7.7
195ref|NM_024885.2| Homo sapiens TAF7-like RNA polymerase II, TATA ... 40 7.7
196gb|AC122749.9| Mus musculus chromosome 3, clone RP24-175I7, comp... 40 7.7
197gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.7
198ref|XM_994047.1| PREDICTED: Mus musculus hypothetical protein LO... 40 7.7
199ref|XM_987857.1| PREDICTED: Mus musculus hypothetical protein LO... 40 7.7
200gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genom... 40 7.7
201ref|XM_533043.2| PREDICTED: Canis familiaris similar to acidic (... 40 7.7
202ref|XM_746925.1| Aspergillus fumigatus Af293 hypothetical protei... 40 7.7
203ref|XM_388140.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 7.7
204ref|XM_390019.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 40 7.7
205ref|XM_568775.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 7.7
206ref|XM_569780.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 7.7
207gb|AC127344.3| Mus musculus BAC clone RP23-212H18 from chromosom... 40 7.7
208gb|AC025165.27| Homo sapiens 12 BAC RP11-571M6 (Roswell Park Can... 40 7.7
209gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome... 40 7.7
210gb|BC006506.2| Homo sapiens amplified in osteosarcoma, mRNA (cDN... 40 7.7
211ref|XM_760814.1| Theileria parva strain Muguga chromosome 1 hypo... 40 7.7
212ref|XM_672107.1| Plasmodium berghei strain ANKA chaperonin cpn60... 40 7.7
213gb|AY344225.1| Candida glabrata Epa5p (EPA5) and Epa4p (EPA4) ge... 40 7.7
214emb|AJ783221.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
215emb|AJ783220.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
216emb|AJ783219.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
217emb|AJ783218.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
218emb|AJ783217.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
219emb|AJ783216.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
220emb|AJ783214.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
221emb|AJ783213.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
222emb|AJ783212.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
223emb|AJ783211.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
224emb|AJ783210.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
225emb|AJ783209.1| Drosophila melanogaster CG8557 gene intron 1, st... 40 7.7
226ref|XM_784063.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.7
227ref|XM_502000.1| Yarrowia lipolytica CLIB122, YALI0C19129g predi... 40 7.7
228emb|AL353631.17| Human DNA sequence from clone RP11-5N16 on chro... 40 7.7
229emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chr... 40 7.7
230emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on ch... 40 7.7
231emb|AL136080.6| Human DNA sequence from clone RP11-448E12 on chr... 40 7.7
232emb|AL121974.16|HSJ417L20 Human DNA sequence from clone RP3-417L... 40 7.7
233emb|AL109801.14|HSJ738A13 Human DNA sequence from clone RP4-738A... 40 7.7
234gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
235emb|Z97342.2|ATFCA7 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 7.7
236emb|Z36011.1|SCYBR142W S.cerevisiae chromosome II reading frame ... 40 7.7
237emb|X78937.1|SCIRA1 S.cerevisiae (S288C) IRA1, YBR1118 and YBR11... 40 7.7
238emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 7.7
239emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 7.7
240emb|BX883051.1| Rattus norvegicus chromosome 20, major histocomp... 40 7.7
241emb|BX842632.1| Neurospora crassa DNA linkage group I BAC contig... 40 7.7
242emb|BX649606.1| Aspergillus fumigatus BAC pilot project supercon... 40 7.7
243emb|AL663049.8| Mouse DNA sequence from clone RP23-198N8 on chro... 40 7.7
244emb|AL670008.1|NCB13O8 Neurospora crassa DNA linkage group V BAC... 40 7.7
245gb|BC043391.1| Homo sapiens TAF7-like RNA polymerase II, TATA bo... 40 7.7
246emb|AL513444.1|NCB11N2 Neurospora crassa DNA linkage group V BAC... 40 7.7
247emb|AL161545.2|ATCHRIV45 Arabidopsis thaliana DNA chromosome 4, ... 40 7.7
248emb|AJ414152.1| Yersinia pestis strain CO92 complete genome; seg... 40 7.7
249emb|AL137691.1|HSM802119 Homo sapiens mRNA; cDNA DKFZp434P172 (f... 40 7.7
250gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.7
251gb|BC000532.2| Homo sapiens amplified in osteosarcoma, transcrip... 40 7.7
252gb|AY128814.1| Arabidopsis thaliana putative WD-40 repeat protei... 40 7.7
253gb|AC104628.6| Drosophila melanogaster X BAC RP98-18C18 (Roswell... 40 7.7
254gb|AC010063.7| Drosophila melanogaster 3L BAC RP98-16A3 (Roswell... 40 7.7
255gb|AC091222.3| Drosophila melanogaster 3L BAC RP98-11G24 (Roswel... 40 7.7
256gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell... 40 7.7
257gb|AY118875.1| Drosophila melanogaster GM30768 full insert cDNA 40 7.7
258emb|CR621694.1| full-length cDNA clone CS0DK011YE17 of HeLa cell... 40 7.7
259gb|AC091226.3| Drosophila melanogaster 3L BAC RP98-3I13 (Roswell... 40 7.7
260gb|AC069405.6| Drosophila melanogaster 3L BAC RP98-17J20 (Roswel... 40 7.7
261emb|CR613922.1| full-length cDNA clone CS0DG006YH14 of B cells (... 40 7.7
262gb|AF384971.1| Phialophora gregata genotype B DNA marker sequence 40 7.7
263gb|AC110053.3| Homo sapiens chromosome 8, clone CTD-3145H4, comp... 40 7.7
264gb|AC010007.4| Drosophila melanogaster 3L BAC RP98-17K17 (Roswel... 40 7.7
265gb|AC091128.2| Drosophila melanogaster 3L BAC RP98-17O7 (Roswell... 40 7.7
266emb|CR600830.1| full-length cDNA clone CS0DN005YG08 of Adult bra... 40 7.7
267tpg|BK002431.1| TPA: TPA_inf: Drosophila melanogaster HDC12768 (... 40 7.7
268gb|AC107904.6| Homo sapiens chromosome 8, clone RP11-644K4, comp... 40 7.7
269gb|AE012548.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 7.7
270gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell ... 40 7.7
271ref|NM_170168.1| Drosophila melanogaster tolkin CG6863-RB, trans... 40 7.7
272gb|AC016397.6| Homo sapiens chromosome 10 clone RP11-541M12, com... 40 7.7
273ref|NM_141446.1| Drosophila melanogaster CG10055-RA (CG10055), mRNA 40 7.7
274gb|AC005917.3| Arabidopsis thaliana chromosome 2 clone F3P11 map... 40 7.7
275gb|AC025098.5| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
276ref|NM_057531.3| Drosophila melanogaster tolkin CG6863-RA, trans... 40 7.7
277gb|AC023690.3| Drosophila melanogaster X BAC RP98-6M20 (Roswell ... 40 7.7
278gb|U81031.2|HSU81031 Homo sapiens CDK4, SAS, and KIAA0167 genes,... 40 7.7
279emb|CR456791.1| Homo sapiens full open reading frame cDNA clone ... 40 7.7
280dbj|AB168638.1| Macaca fascicularis testis cDNA clone: QtsA-1372... 40 7.7
281ref|XM_628122.1| Cryptosporidium parvum Iowa II oligosaccharide ... 40 7.7
282ref|XM_626746.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 7.7
283gb|AY051585.1| Drosophila melanogaster GH23184 full length cDNA 40 7.7
284gb|AC159623.3| Mus musculus BAC clone RP24-308O7 from chromosome... 40 7.7
285gb|AC026269.26| Homo sapiens chromosome 11, clone RP11-745E9, co... 40 7.7
286gb|AC157098.5| Mus musculus 6 BAC RP24-398G2 (Roswell Park Cance... 40 7.7
287gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 7.7
288gb|AC092493.1|AC092493 Drosophila melanogaster, chromosome X, re... 40 7.7
289gb|AC005719.2|AC005719 Drosophila melanogaster, chromosome 2L, r... 40 7.7
290gb|AC022347.2|AC022347 Drosophila melanogaster, chromosome X, re... 40 7.7
291gb|AC005713.8|AC005713 Drosophila melanogaster, chromosome 2R, r... 40 7.7
292emb|BX932108.2| Gallus gallus finished cDNA, clone ChEST156g20 40 7.7
293emb|BX931734.2| Gallus gallus finished cDNA, clone ChEST751o4 40 7.7
294gb|AF370506.1|AF370506 Arabidopsis thaliana putative WD-40 repea... 40 7.7
295gb|AC007303.7|AC007303 Drosophila melanogaster, chromosome 2R, r... 40 7.7
296dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
297dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
298dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
299gb|BC023513.2| Homo sapiens amplified in osteosarcoma, transcrip... 40 7.7
300gb|BC007254.1| Homo sapiens amplified in osteosarcoma, transcrip... 40 7.7
301emb|BX821712.1|CNS0A801 Arabidopsis thaliana Full-length cDNA Co... 40 7.7
302gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, r... 40 7.7
303gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, r... 40 7.7
304gb|AC007821.4|AC007821 Drosophila melanogaster, chromosome 3R, r... 40 7.7
305gb|AC008205.7|AC008205 Drosophila melanogaster, chromosome 3R, r... 40 7.7
306gb|AC097464.3| Homo sapiens BAC clone RP11-21M10 from 4, complet... 40 7.7
307gb|AC008216.3|AC008216 Drosophila melanogaster, chromosome 3R, r... 40 7.7
308gb|AC009916.5|AC009916 Drosophila melanogaster, chromosome 3R, r... 40 7.7
309gb|AC106901.4| Homo sapiens BAC clone RP11-1178E6 from 2, comple... 40 7.7
310dbj|AB044593.1| Brassica rapa BrTBP gene for Tat binding protein... 40 7.7
311gb|AC115598.2| Dictyostelium discoideum chromosome 2 map 581427-... 40 7.7
312gb|AC117070.2| Dictyostelium discoideum chromosome 2 map 2097701... 40 7.7
313gb|AC160057.2| Pan troglodytes BAC clone CH251-416M4 from chromo... 40 7.7
314dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 7.7
315dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
316dbj|AK130733.1| Homo sapiens cDNA FLJ27223 fis, clone SYN04785 40 7.7
317dbj|AK129781.1| Homo sapiens cDNA FLJ26270 fis, clone DMC06052, ... 40 7.7
318dbj|AK101761.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.7
319dbj|AK061671.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.7
320emb|Z72807.1|SCYGR022C S.cerevisiae chromosome VII reading frame... 40 7.7
321gb|AC004114.1|AC004114 Drosophila melanogaster, chromosome X, re... 40 7.7
322gb|AE003759.3| Drosophila melanogaster chromosome 3R, section 97... 40 7.7
323gb|AE003749.3| Drosophila melanogaster chromosome 3R, section 87... 40 7.7
324emb|CT025735.16| Mouse DNA sequence from clone RP24-338F19 on ch... 40 7.7
325gb|AE003685.5| Drosophila melanogaster chromosome 3R, section 23... 40 7.7
326gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12... 40 7.7
327gb|AE003664.3| Drosophila melanogaster chromosome 2L, section 73... 40 7.7
328gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 40 7.7
329gb|AC007012.1|AC007012 Homo sapiens chromosome 16, clone 185J20,... 40 7.7
330gb|AE003804.4| Drosophila melanogaster chromosome 2R, section 46... 40 7.7
331gb|AE003775.2| Drosophila melanogaster chromosome 3R, section 11... 40 7.7
332gb|AE003537.3| Drosophila melanogaster chromosome 3L, section 48... 40 7.7
333gb|AE003510.5| Drosophila melanogaster chromosome X, section 62 ... 40 7.7
334gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 ... 40 7.7
335gb|AE003488.3| Drosophila melanogaster chromosome X, section 40 ... 40 7.7
336gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 ... 40 7.7
337gb|AE003471.3| Drosophila melanogaster chromosome 3L, section 5 ... 40 7.7
338gb|AE003437.3| Drosophila melanogaster chromosome X, section 21 ... 40 7.7
339gb|AE003428.4| Drosophila melanogaster chromosome X, section 12 ... 40 7.7
340gb|AC005847.1|AC005847 Drosophila melanogaster DNA sequence (P1s... 40 7.7
341gb|U34777.1|DMU34777 Drosophila melanogaster tolkin mRNA, comple... 40 7.7
342gb|U44726.1|PCU44726 Penicillium chrysogenum transcription facto... 40 7.7
343gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.7
344emb|AL132949.2|CEY53F4B Caenorhabditis elegans YAC Y53F4B, compl... 40 7.7
345emb|AL939130.1|SCO939130 Streptomyces coelicolor A3(2) complete ... 40 7.7
346emb|AL513467.1|NC17E5 Neurospora crassa DNA linkage group V Cosm... 40 7.7
347gb|AC122217.4| Mus musculus BAC clone RP23-118J3 from 16, comple... 40 7.7
348emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 7.7
349gb|U41635.1|HSU41635 Human OS-9 precurosor mRNA, complete cds 40 7.7
350gb|U12634.1|DMU12634 Drosophila melanogaster tolloid related-1 (... 40 7.7
351emb|AL024454.1|DMC121E7 Drosophila melanogaster cosmid 121E7 40 7.7
352dbj|D38572.1|HROHRLIM Halocynthia rorentzi Hrlim mRNA for homeop... 40 7.7
353dbj|AB036794.1| Drosophila melanogaster genomic DNA, chromosome ... 40 7.7
354dbj|AB002806.1| Homo sapiens OS-9 mRNA, complete cds 40 7.7

>ref|XM_549856.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2381

 Score =  232 bits (117), Expect = 1e-57
 Identities = 198/225 (88%)
 Strand = Plus / Minus

                                                                        
Query: 343  tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
            |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 1979 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 1920

                                                                        
Query: 403  caggaaaccgagctcggcaccaccaatgtgcgggattgcactcttgccattgagcaccaa 462
            ||||||||| ||||| ||||| |||| ||| ||||| |  ||||||||||||||||||||
Sbjct: 1919 caggaaaccaagctccgcacctccaaggtgtgggatcgtgctcttgccattgagcaccaa 1860

                                                                        
Query: 463  cagctcaccatccacccaccgcgggtttttgaatccaggttgcgctattctcccctgacc 522
             |||||||||||||||||||| || |||||||| ||||| || || |||||||| |||||
Sbjct: 1859 tagctcaccatccacccaccggggatttttgaagccaggctgtgcaattctcccttgacc 1800

                                                         
Query: 523  tttataactagcagtcacaccaaactcttctgggtatgcaccacg 567
            |||||| |||||| |||||||||| ||||| ||||||||||||||
Sbjct: 1799 tttatagctagcaatcacaccaaattcttcagggtatgcaccacg 1755



to top

>dbj|AK070363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047F20, full
            insert sequence
          Length = 2381

 Score =  232 bits (117), Expect = 1e-57
 Identities = 198/225 (88%)
 Strand = Plus / Minus

                                                                        
Query: 343  tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
            |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 1979 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 1920

                                                                        
Query: 403  caggaaaccgagctcggcaccaccaatgtgcgggattgcactcttgccattgagcaccaa 462
            ||||||||| ||||| ||||| |||| ||| ||||| |  ||||||||||||||||||||
Sbjct: 1919 caggaaaccaagctccgcacctccaaggtgtgggatcgtgctcttgccattgagcaccaa 1860

                                                                        
Query: 463  cagctcaccatccacccaccgcgggtttttgaatccaggttgcgctattctcccctgacc 522
             |||||||||||||||||||| || |||||||| ||||| || || |||||||| |||||
Sbjct: 1859 tagctcaccatccacccaccggggatttttgaagccaggctgtgcaattctcccttgacc 1800

                                                         
Query: 523  tttataactagcagtcacaccaaactcttctgggtatgcaccacg 567
            |||||| |||||| |||||||||| ||||| ||||||||||||||
Sbjct: 1799 tttatagctagcaatcacaccaaattcttcagggtatgcaccacg 1755



to top

>dbj|AK058708.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D03, full
           insert sequence
          Length = 1178

 Score =  232 bits (117), Expect = 1e-57
 Identities = 198/225 (88%)
 Strand = Plus / Minus

                                                                       
Query: 343 tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
           |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 779 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 720

                                                                       
Query: 403 caggaaaccgagctcggcaccaccaatgtgcgggattgcactcttgccattgagcaccaa 462
           ||||||||| ||||| ||||| |||| ||| ||||| |  ||||||||||||||||||||
Sbjct: 719 caggaaaccaagctccgcacctccaaggtgtgggatcgtgctcttgccattgagcaccaa 660

                                                                       
Query: 463 cagctcaccatccacccaccgcgggtttttgaatccaggttgcgctattctcccctgacc 522
            |||||||||||||||||||| || |||||||| ||||| || || |||||||| |||||
Sbjct: 659 tagctcaccatccacccaccggggatttttgaagccaggctgtgcaattctcccttgacc 600

                                                        
Query: 523 tttataactagcagtcacaccaaactcttctgggtatgcaccacg 567
           |||||| |||||| |||||||||| ||||| ||||||||||||||
Sbjct: 599 tttatagctagcaatcacaccaaattcttcagggtatgcaccacg 555



to top

>gb|AY107854.1| Zea mays PCO142176 mRNA sequence
          Length = 1557

 Score =  196 bits (99), Expect = 6e-47
 Identities = 189/219 (86%)
 Strand = Plus / Minus

                                                                        
Query: 343  tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
            ||||||||||||  |||| || || ||||||||||| || ||||||||||| || || ||
Sbjct: 1093 tcactcgggaagattaagccgatcgaagagaaccagaaaactctgctcaggtacactata 1034

                                                                        
Query: 403  caggaaaccgagctcggcaccaccaatgtgcgggattgcactcttgccattgagcaccaa 462
            ||||||||||||||| || || |||| ||| || |||| ||||||||||||||| |||||
Sbjct: 1033 caggaaaccgagctctgcgcctccaaggtgtggaattgtactcttgccattgagtaccaa 974

                                                                        
Query: 463  cagctcaccatccacccaccgcgggtttttgaatccaggttgcgctattctcccctgacc 522
            |||||||||||||||||| || || |||||||||||||| || |||||||| ||||||||
Sbjct: 973  cagctcaccatccacccatcgaggatttttgaatccaggctgagctattctaccctgacc 914

                                                   
Query: 523  tttataactagcagtcacaccaaactcttctgggtatgc 561
            ||| ||||| ||| |||||||||| || ||||| |||||
Sbjct: 913  tttgtaactggcaatcacaccaaattcctctggatatgc 875



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Plus

                                                                          
Query: 445    cttgccattgagcaccaacagctcaccatccacccaccgcgggtttttgaatccaggttg 504
              |||||||||||||||||| |||||||||||||||||||| || |||||||| ||||| ||
Sbjct: 416510 cttgccattgagcaccaatagctcaccatccacccaccggggatttttgaagccaggctg 416569

                                             
Query: 505    cgctattctcccctgacctttataactagca 535
               || |||||||| ||||||||||| ||||||
Sbjct: 416570 tgcaattctcccttgacctttatagctagca 416600



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                          
Query: 343    tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
              |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 415666 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 415725

                                                  
Query: 403    caggaaaccgagctcggcaccaccaatgtgcgggat 438
              ||||||||| ||||| ||||| |||| ||| |||||
Sbjct: 415726 caggaaaccaagctccgcacctccaaggtgtgggat 415761



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 538    cacaccaaactcttctgggtatgcaccacg 567
              ||||||||| ||||| ||||||||||||||
Sbjct: 416776 cacaccaaattcttcagggtatgcaccacg 416805



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 223     gatgtggatgaggatgaggatgacg 247
               |||| ||||||||||||||||||||
Sbjct: 1373088 gatgaggatgaggatgaggatgacg 1373112



to top

>dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0005A05
          Length = 190834

 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Plus

                                                                          
Query: 445    cttgccattgagcaccaacagctcaccatccacccaccgcgggtttttgaatccaggttg 504
              |||||||||||||||||| |||||||||||||||||||| || |||||||| ||||| ||
Sbjct: 168348 cttgccattgagcaccaatagctcaccatccacccaccggggatttttgaagccaggctg 168407

                                             
Query: 505    cgctattctcccctgacctttataactagca 535
               || |||||||| ||||||||||| ||||||
Sbjct: 168408 tgcaattctcccttgacctttatagctagca 168438



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                          
Query: 343    tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
              |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 167504 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 167563

                                                  
Query: 403    caggaaaccgagctcggcaccaccaatgtgcgggat 438
              ||||||||| ||||| ||||| |||| ||| |||||
Sbjct: 167564 caggaaaccaagctccgcacctccaaggtgtgggat 167599



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 538    cacaccaaactcttctgggtatgcaccacg 567
              ||||||||| ||||| ||||||||||||||
Sbjct: 168614 cacaccaaattcttcagggtatgcaccacg 168643



to top

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482C06
          Length = 182779

 Score =  109 bits (55), Expect = 1e-20
 Identities = 82/91 (90%)
 Strand = Plus / Plus

                                                                         
Query: 445   cttgccattgagcaccaacagctcaccatccacccaccgcgggtttttgaatccaggttg 504
             |||||||||||||||||| |||||||||||||||||||| || |||||||| ||||| ||
Sbjct: 56711 cttgccattgagcaccaatagctcaccatccacccaccggggatttttgaagccaggctg 56770

                                            
Query: 505   cgctattctcccctgacctttataactagca 535
              || |||||||| ||||||||||| ||||||
Sbjct: 56771 tgcaattctcccttgacctttatagctagca 56801



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                         
Query: 343   tcactcgggaagcgtaaggcggtcaaagagaaccaggaagctctgctcaggcacgctgta 402
             |||||| |||||  |||| ||||||||||| |||| ||| ||||||||||||||||||||
Sbjct: 55867 tcactctggaagtttaagccggtcaaagagtaccaagaaactctgctcaggcacgctgta 55926

                                                 
Query: 403   caggaaaccgagctcggcaccaccaatgtgcgggat 438
             ||||||||| ||||| ||||| |||| ||| |||||
Sbjct: 55927 caggaaaccaagctccgcacctccaaggtgtgggat 55962



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 538   cacaccaaactcttctgggtatgcaccacg 567
             ||||||||| ||||| ||||||||||||||
Sbjct: 56977 cacaccaaattcttcagggtatgcaccacg 57006



to top

>gb|AC099011.1| Drosophila melanogaster, chromosome 2L, region 24C-24D, BAC clone
             BACR22M14, complete sequence
          Length = 173380

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 219   tgtggatgtggatgaggatgaggatga 245
             |||||||||||||||||||||||||||
Sbjct: 15902 tgtggatgtggatgaggatgaggatga 15928



to top

>gb|AC092240.1|AC092240 Drosophila melanogaster, chromosome 2L, region 24E-24F, BAC clone
              BACR06H02, complete sequence
          Length = 187707

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 219    tgtggatgtggatgaggatgaggatga 245
              |||||||||||||||||||||||||||
Sbjct: 176717 tgtggatgtggatgaggatgaggatga 176743



to top

>gb|AE003578.3| Drosophila melanogaster chromosome 2L, section 13 of 83 of the complete
              sequence
          Length = 295211

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 219    tgtggatgtggatgaggatgaggatga 245
              |||||||||||||||||||||||||||
Sbjct: 146467 tgtggatgtggatgaggatgaggatga 146493



to top

>gb|AC005732.1|AC005732 Drosophila melanogaster DNA sequence (P1s DS03998 (D223), DS01595
             (D161), and DS00065 (D263)), complete sequence
          Length = 127039

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 219   tgtggatgtggatgaggatgaggatga 245
             |||||||||||||||||||||||||||
Sbjct: 38204 tgtggatgtggatgaggatgaggatga 38178



to top

>gb|AC008351.4|AC008351 Drosophila melanogaster, chromosome 2R, region 59A-59C, BAC clone
             BACR09K23, complete sequence
          Length = 191438

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             ||||||||||||||||||||||||||
Sbjct: 24806 tgtggatgtggatgaggatgaggatg 24781



to top

>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete
              sequence
          Length = 302225

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 219    tgtggatgtggatgaggatgaggatg 244
              ||||||||||||||||||||||||||
Sbjct: 188000 tgtggatgtggatgaggatgaggatg 187975



to top

>ref|NM_057719.3| Drosophila melanogaster Megator CG8274-RA (Mtor), mRNA
          Length = 7435

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 219  tgtggatgtggatgaggatgaggatgacg 247
            |||||| ||||||||||||||||||||||
Sbjct: 5294 tgtggaagtggatgaggatgaggatgacg 5266



to top

>gb|AC099015.1| Drosophila melanogaster, chromosome 2R, region 48C-49A, BAC clone
              BACR26P21, complete sequence
          Length = 157010

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 219    tgtggatgtggatgaggatgaggatgacg 247
              |||||| ||||||||||||||||||||||
Sbjct: 124422 tgtggaagtggatgaggatgaggatgacg 124394



to top

>gb|AY050227.1| Drosophila melanogaster SD01380 full length cDNA
          Length = 3557

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 219  tgtggatgtggatgaggatgaggatgacg 247
            |||||| ||||||||||||||||||||||
Sbjct: 1394 tgtggaagtggatgaggatgaggatgacg 1366



to top

>gb|AC005466.5|AC005466 Drosophila melanogaster, chromosome 2R, region 48C2-48C5, P1 clone
            DS03299, complete sequence
          Length = 72986

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 219  tgtggatgtggatgaggatgaggatgacg 247
            |||||| ||||||||||||||||||||||
Sbjct: 2677 tgtggaagtggatgaggatgaggatgacg 2649



to top

>gb|AE003824.3| Drosophila melanogaster chromosome 2R, section 26 of 73 of the complete
              sequence
          Length = 268836

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 219    tgtggatgtggatgaggatgaggatgacg 247
              |||||| ||||||||||||||||||||||
Sbjct: 131418 tgtggaagtggatgaggatgaggatgacg 131390



to top

>gb|U91980.1|DMU91980 Drosophila melanogaster Tpr homolog mRNA, complete cds
          Length = 7431

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 219  tgtggatgtggatgaggatgaggatgacg 247
            |||||| ||||||||||||||||||||||
Sbjct: 5274 tgtggaagtggatgaggatgaggatgacg 5246



to top

>gb|AC093547.3| Drosophila melanogaster 3L BAC RP98-2K11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 142334

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||||||||||||||||||||||
Sbjct: 60192 ggatgtggatgaggatgaggatga 60169



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 219   tgtggatgtggatgaggatgagga 242
             |||||||| |||||||||||||||
Sbjct: 60189 tgtggatgaggatgaggatgagga 60166



to top

>gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, region 47D-47D, BAC clone
              BACR24G16, complete sequence
          Length = 165974

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 218    ctgtggatgtggatgaggatgagg 241
              ||||||||||||||||||||||||
Sbjct: 155870 ctgtggatgtggatgaggatgagg 155893



to top

>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone
              BACR27L16, complete sequence
          Length = 182623

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 220    gtggatgtggatgaggatgaggat 243
              ||||||||||||||||||||||||
Sbjct: 155778 gtggatgtggatgaggatgaggat 155755



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55703 ggatgaggatgaggatgaggatga 55726



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55697 ggatgaggatgaggatgaggatga 55720



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55691 ggatgaggatgaggatgaggatga 55714



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55685 ggatgaggatgaggatgaggatga 55708



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55679 ggatgaggatgaggatgaggatga 55702



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55673 ggatgaggatgaggatgaggatga 55696



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55667 ggatgaggatgaggatgaggatga 55690



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55661 ggatgaggatgaggatgaggatga 55684



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55655 ggatgaggatgaggatgaggatga 55678



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55649 ggatgaggatgaggatgaggatga 55672



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55643 ggatgaggatgaggatgaggatga 55666



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55637 ggatgaggatgaggatgaggatga 55660



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55631 ggatgaggatgaggatgaggatga 55654



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55625 ggatgaggatgaggatgaggatga 55648



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55619 ggatgaggatgaggatgaggatga 55642



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55613 ggatgaggatgaggatgaggatga 55636



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55607 ggatgaggatgaggatgaggatga 55630



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55601 ggatgaggatgaggatgaggatga 55624



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55595 ggatgaggatgaggatgaggatga 55618



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55589 ggatgaggatgaggatgaggatga 55612



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55583 ggatgaggatgaggatgaggatga 55606



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55577 ggatgaggatgaggatgaggatga 55600



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55571 ggatgaggatgaggatgaggatga 55594



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55565 ggatgaggatgaggatgaggatga 55588



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55559 ggatgaggatgaggatgaggatga 55582



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55553 ggatgaggatgaggatgaggatga 55576



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55547 ggatgaggatgaggatgaggatga 55570



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55541 ggatgaggatgaggatgaggatga 55564



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55535 ggatgaggatgaggatgaggatga 55558



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55529 ggatgaggatgaggatgaggatga 55552



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55523 ggatgaggatgaggatgaggatga 55546



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55517 ggatgaggatgaggatgaggatga 55540



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55511 ggatgaggatgaggatgaggatga 55534



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55505 ggatgaggatgaggatgaggatga 55528



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55499 ggatgaggatgaggatgaggatga 55522



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 55493 ggatggggatgaggatgaggatga 55516



to top

>gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, region 18D-18D, BAC clone
             BACR10M08, complete sequence
          Length = 180213

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 220   gtggatgtggatgaggatgaggat 243
             ||||||||||||||||||||||||
Sbjct: 94258 gtggatgtggatgaggatgaggat 94235



to top

>gb|AC008187.6|AC008187 Drosophila melanogaster, chromosome 2R, region 47D-47E, BAC clone
             BACR13D20, complete sequence
          Length = 168417

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 218   ctgtggatgtggatgaggatgagg 241
             ||||||||||||||||||||||||
Sbjct: 63474 ctgtggatgtggatgaggatgagg 63497



to top

>gb|AE003827.3| Drosophila melanogaster chromosome 2R, section 23 of 73 of the complete
              sequence
          Length = 256227

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 218    ctgtggatgtggatgaggatgagg 241
              ||||||||||||||||||||||||
Sbjct: 175591 ctgtggatgtggatgaggatgagg 175614



to top

>gb|AE003598.2| Drosophila melanogaster chromosome 3L, section 79 of 83 of the
           complete sequence
          Length = 303370

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||||||||||||||||||||||
Sbjct: 560 ggatgtggatgaggatgaggatga 537



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 219 tgtggatgtggatgaggatgagga 242
           |||||||| |||||||||||||||
Sbjct: 557 tgtggatgaggatgaggatgagga 534



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
              sequence
          Length = 346474

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 220    gtggatgtggatgaggatgaggat 243
              ||||||||||||||||||||||||
Sbjct: 200024 gtggatgtggatgaggatgaggat 200001



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99949 ggatgaggatgaggatgaggatga 99972



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99943 ggatgaggatgaggatgaggatga 99966



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99937 ggatgaggatgaggatgaggatga 99960



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99931 ggatgaggatgaggatgaggatga 99954



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99925 ggatgaggatgaggatgaggatga 99948



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99919 ggatgaggatgaggatgaggatga 99942



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99913 ggatgaggatgaggatgaggatga 99936



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99907 ggatgaggatgaggatgaggatga 99930



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99901 ggatgaggatgaggatgaggatga 99924



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99895 ggatgaggatgaggatgaggatga 99918



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99889 ggatgaggatgaggatgaggatga 99912



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99883 ggatgaggatgaggatgaggatga 99906



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99877 ggatgaggatgaggatgaggatga 99900



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99871 ggatgaggatgaggatgaggatga 99894



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99865 ggatgaggatgaggatgaggatga 99888



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99859 ggatgaggatgaggatgaggatga 99882



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99853 ggatgaggatgaggatgaggatga 99876



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99847 ggatgaggatgaggatgaggatga 99870



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99841 ggatgaggatgaggatgaggatga 99864



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99835 ggatgaggatgaggatgaggatga 99858



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99829 ggatgaggatgaggatgaggatga 99852



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99823 ggatgaggatgaggatgaggatga 99846



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99817 ggatgaggatgaggatgaggatga 99840



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99811 ggatgaggatgaggatgaggatga 99834



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99805 ggatgaggatgaggatgaggatga 99828



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99799 ggatgaggatgaggatgaggatga 99822



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99793 ggatgaggatgaggatgaggatga 99816



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99787 ggatgaggatgaggatgaggatga 99810



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99781 ggatgaggatgaggatgaggatga 99804



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99775 ggatgaggatgaggatgaggatga 99798



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99769 ggatgaggatgaggatgaggatga 99792



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99763 ggatgaggatgaggatgaggatga 99786



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99757 ggatgaggatgaggatgaggatga 99780



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99751 ggatgaggatgaggatgaggatga 99774



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99745 ggatgaggatgaggatgaggatga 99768



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 99739 ggatggggatgaggatgaggatga 99762



to top

>ref|XM_462353.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G19877g)
            partial mRNA
          Length = 1419

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 223  gatgtggatgaggatgaggatga 245
            |||||||||||||||||||||||
Sbjct: 1037 gatgtggatgaggatgaggatga 1015



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 219  tgtggatgtggatgaggatgaggatga 245
            |||||||| ||||||||||||||||||
Sbjct: 1035 tgtggatgaggatgaggatgaggatga 1009



to top

>ref|XM_751621.1| Ustilago maydis 521 hypothetical protein (UM00567.1) partial mRNA
          Length = 849

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 222 ggatgtggatgaggatgaggatg 244
           |||||||||||||||||||||||
Sbjct: 717 ggatgtggatgaggatgaggatg 695



to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 223     gatgtggatgaggatgaggatga 245
               |||||||||||||||||||||||
Sbjct: 1515425 gatgtggatgaggatgaggatga 1515403



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 219     tgtggatgtggatgaggatgaggatga 245
               |||||||| ||||||||||||||||||
Sbjct: 1515423 tgtggatgaggatgaggatgaggatga 1515397



to top

>gb|AC010967.3| Homo sapiens BAC clone RP11-7H13 from 2, complete sequence
          Length = 197328

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 218   ctgtggatgtggatgaggatgaggatg 244
             ||||||||||||||||||||| |||||
Sbjct: 59939 ctgtggatgtggatgaggatgtggatg 59965



to top

>ref|NM_113804.3| Arabidopsis thaliana ATP binding AT3G28830 mRNA, complete cds
          Length = 1884

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 222  ggatgtggatgaggatgaggatgacg 247
            ||||| ||||||||||||||||||||
Sbjct: 1563 ggatgaggatgaggatgaggatgacg 1538



to top

>gb|AC167815.3| Mus musculus BAC clone RP23-463H10 from chromosome 5, complete sequence
          Length = 198336

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 222   ggatgtggatgaggatgaggatgacggaga 251
             ||||| |||||||||||||||||| |||||
Sbjct: 56455 ggatgaggatgaggatgaggatgagggaga 56484



to top

>gb|AC010922.10| Drosophila melanogaster clone BACR09H01, complete sequence
          Length = 152607

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||| |||||||||||
Sbjct: 61905 tgtggatgtggatgtggatgaggatg 61930



to top

>ref|XM_951809.1| Neurospora crassa OR74A hypothetical protein (NCU01696.1) partial
            mRNA
          Length = 2454

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 224  atgtggatgaggatgaggatga 245
            ||||||||||||||||||||||
Sbjct: 1958 atgtggatgaggatgaggatga 1979



to top

>ref|XM_328134.1| Neurospora crassa OR74A hypothetical protein (NCU01696.1) partial
            mRNA
          Length = 2454

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 224  atgtggatgaggatgaggatga 245
            ||||||||||||||||||||||
Sbjct: 1958 atgtggatgaggatgaggatga 1979



to top

>gb|DQ491001.1| Chlorella virus MT325 ctg_71 genomic sequence
          Length = 314335

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 222    ggatgtggatgaggatgaggatgacg 247
              ||||| ||||||||||||||||||||
Sbjct: 120317 ggatgaggatgaggatgaggatgacg 120292



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    ggatgaggatgaggatgacg 247
              ||||||||||||||||||||
Sbjct: 120338 ggatgaggatgaggatgacg 120319



to top

>ref|NM_025725.2| Mus musculus coiled-coil domain containing 96 (Ccdc96), mRNA
          Length = 3584

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 222 ggatgtggatgaggatgaggatgacggaga 251
           ||||| |||||||||||||||||| |||||
Sbjct: 472 ggatgaggatgaggatgaggatgagggaga 501



to top

>gb|AC138679.10| Mus musculus chromosome 5, clone RP23-177I4, complete sequence
          Length = 230184

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 222   ggatgtggatgaggatgaggatgacggaga 251
             ||||| |||||||||||||||||| |||||
Sbjct: 63736 ggatgaggatgaggatgaggatgagggaga 63707



to top

>ref|XM_752057.1| Ustilago maydis 521 hypothetical protein (UM01003.1) partial mRNA
          Length = 3459

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 223  gatgtggatgaggatgaggatg 244
            ||||||||||||||||||||||
Sbjct: 3328 gatgtggatgaggatgaggatg 3349



to top

>ref|XM_753970.1| Ustilago maydis 521 hypothetical protein (UM02916.1) partial mRNA
          Length = 2430

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 222 ggatgtggatgaggatgaggatgacg 247
           ||||| ||||||||||||||||||||
Sbjct: 181 ggatgaggatgaggatgaggatgacg 156



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 247 ggatgaggatgaggatgaggatga 224



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 241 ggatgaggatgaggatgaggatga 218



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 235 ggatgaggatgaggatgaggatga 212



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 229 ggatgaggatgaggatgaggatga 206



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 223 ggatgaggatgaggatgaggatga 200



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 217 ggatgaggatgaggatgaggatga 194



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 211 ggatgaggatgaggatgaggatga 188



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 205 ggatgaggatgaggatgaggatga 182



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 199 ggatgaggatgaggatgaggatga 176



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 193 ggatgaggatgaggatgaggatga 170



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 187 ggatgaggatgaggatgaggatga 164



to top

>emb|AJ297289.1|PNI297289 Populus nigra microsatellite DNA, clone WPMS16
          Length = 457

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 222 ggatgtggatgaggatgaggatgacg 247
           ||||| ||||||||||||||||||||
Sbjct: 303 ggatgaggatgaggatgaggatgacg 278



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 309 ggatgaggatgaggatgaggatga 286



to top

>emb|AL513408.1|NC61D6 Neurospora crassa DNA linkage group II Cosmid clone 61D6
          Length = 38848

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 224   atgtggatgaggatgaggatga 245
             ||||||||||||||||||||||
Sbjct: 34086 atgtggatgaggatgaggatga 34107



to top

>emb|AL355927.1|NCB1D1 Neurospora crassa DNA linkage group II BAC clone B1D1
          Length = 76072

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 224   atgtggatgaggatgaggatga 245
             ||||||||||||||||||||||
Sbjct: 73847 atgtggatgaggatgaggatga 73826



to top

>emb|AL024484.2|DMC96G10 Drosophila melanogaster cosmid clone 96G10
          Length = 39565

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||||| |||||||||
Sbjct: 38852 tgtggatgtggatgagaatgaggatg 38877



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             |||||||| |||||||||||||||
Sbjct: 38873 ggatgtggctgaggatgaggatga 38896



to top

>gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179795

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 219    tgtggatgtggatgaggatgaggatg 244
              |||||||||||||||| |||||||||
Sbjct: 114921 tgtggatgtggatgagaatgaggatg 114896



to top

>tpg|BK002579.1| TPA: TPA_inf: Drosophila melanogaster HDC13963 (HDC13963) gene,
           complete cds
          Length = 778

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 220 gtggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||||
Sbjct: 433 gtggacgtggatgaggatgaggatga 458



to top

>gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 103196

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||||||||| |||||
Sbjct: 84529 tgtggatgtggatgaggatgtggatg 84554



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||| |||||||||||
Sbjct: 84523 tgtggatgtggatgtggatgaggatg 84548



to top

>gb|AC149642.2| Medicago truncatula chromosome 2 BAC clone mth2-62p11, complete
             sequence
          Length = 95165

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 222   ggatgtggatgaggatgaggatgacggaga 251
             ||||| |||||||||||||||||| |||||
Sbjct: 69519 ggatgaggatgaggatgaggatgagggaga 69490



to top

>dbj|AK015646.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930488J20 product:RIKEN cDNA 4921513E08
           gene, full insert sequence
          Length = 2030

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 222 ggatgtggatgaggatgaggatgacggaga 251
           ||||| |||||||||||||||||| |||||
Sbjct: 470 ggatgaggatgaggatgaggatgagggaga 499



to top

>dbj|AK014878.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4921513E08 product:hypothetical Aspartic
           acid-rich region/Glutamic acid-rich region containing
           protein, full insert sequence
          Length = 2210

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 222 ggatgtggatgaggatgaggatgacggaga 251
           ||||| |||||||||||||||||| |||||
Sbjct: 470 ggatgaggatgaggatgaggatgagggaga 499



to top

>dbj|AK030023.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4932416C18 product:hypothetical Aspartic
           acid-rich region/Glutamic acid-rich region containing
           protein, full insert sequence
          Length = 3584

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 222 ggatgtggatgaggatgaggatgacggaga 251
           ||||| |||||||||||||||||| |||||
Sbjct: 472 ggatgaggatgaggatgaggatgagggaga 501



to top

>gb|AC007947.5|AC007947 Drosophila melanogaster, chromosome 3R, region 98F-98F, BAC clone
              BACR11O03, complete sequence
          Length = 168505

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 219    tgtggatgtggatgaggatgaggatg 244
              ||||| ||||||||||||||||||||
Sbjct: 128096 tgtggctgtggatgaggatgaggatg 128071



to top

>gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, region 89D-89D, BAC clone
              BACR01H23, complete sequence
          Length = 199653

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 220    gtggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||||
Sbjct: 166281 gtggacgtggatgaggatgaggatga 166306



to top

>gb|AF180942.1|ATRPP5LE2 Arabidopsis thaliana RPP5 disease resistance locus, main contig
          Length = 91660

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 222   ggatgtggatgaggatgaggatgacg 247
             ||||| ||||||||||||||||||||
Sbjct: 21726 ggatgaggatgaggatgaggatgacg 21751



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 220   gtggatgtggatgaggatgaggatga 245
             ||||||| ||||||||||||||||||
Sbjct: 21718 gtggatgaggatgaggatgaggatga 21743



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 21783 ggatgaggatgaggatgaggatga 21806



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 21777 ggatgaggatgaggatgaggatga 21800



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 21771 ggatgaggatgaggatgaggatga 21794



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 21765 ggatgaggatgaggatgaggatga 21788



to top

>gb|BT004302.1| Arabidopsis thaliana clone RAFL15-45-C21 (R20902) unknown protein
           (At3g28830) mRNA, partial cds
          Length = 982

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 222 ggatgtggatgaggatgaggatgacg 247
           ||||| ||||||||||||||||||||
Sbjct: 646 ggatgaggatgaggatgaggatgacg 621



to top

>dbj|AP002057.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8
          Length = 73391

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 222   ggatgtggatgaggatgaggatgacg 247
             ||||| ||||||||||||||||||||
Sbjct: 52640 ggatgaggatgaggatgaggatgacg 52615



to top

>gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51 of 118 of the complete
              sequence
          Length = 226561

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 220    gtggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||||
Sbjct: 164449 gtggacgtggatgaggatgaggatga 164474



to top

>gb|AE003768.2| Drosophila melanogaster chromosome 3R, section 106 of 118 of the
             complete sequence
          Length = 243118

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             ||||| ||||||||||||||||||||
Sbjct: 58799 tgtggctgtggatgaggatgaggatg 58774



to top

>gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 of 74 of the complete
             sequence
          Length = 298703

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||| |||||||||||
Sbjct: 67274 tgtggatgtggatgtggatgaggatg 67249



to top

>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
             sequence
          Length = 288721

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||| |||||||||||
Sbjct: 40209 tgtggatgtggatgtggatgaggatg 40184



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 219   tgtggatgtggatgaggatgaggatg 244
             |||||||||||||||||||| |||||
Sbjct: 40203 tgtggatgtggatgaggatgtggatg 40178



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 146690 ggatgaggatgaggatgaggatga 146713



to top

>gb|AE003426.3| Drosophila melanogaster chromosome X, section 10 of 74 of the complete
              sequence
          Length = 396604

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 219    tgtggatgtggatgaggatgaggatg 244
              |||||||||||||||| |||||||||
Sbjct: 315299 tgtggatgtggatgagaatgaggatg 315324



to top

>gb|AC131803.3| Mus musculus BAC clone RP24-549I15 from chromosome 5, complete sequence
          Length = 168439

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 222    ggatgtggatgaggatgaggatgacggaga 251
              ||||| |||||||||||||||||| |||||
Sbjct: 144543 ggatgaggatgaggatgaggatgagggaga 144572



to top

>ref|NM_184180.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 960

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 223 gatgtggatgaggatgaggatgacg 247
           |||| ||||||||||||||||||||
Sbjct: 910 gatgaggatgaggatgaggatgacg 934



to top

>ref|XM_520821.1| PREDICTED: Pan troglodytes similar to DDX11 protein (LOC465368),
           mRNA
          Length = 4449

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 871 gtggatgaggatgaggatgac 891



to top

>ref|XM_529479.1| PREDICTED: Pan troglodytes LOC451824 (LOC451824), mRNA
          Length = 802

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 368 gtggatgaggatgaggatgac 388



to top

>ref|NM_030655.2| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
            (CHL1-like helicase homolog, S. cerevisiae) (DDX11),
            transcript variant 3, mRNA
          Length = 4203

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1048 gtggatgaggatgaggatgac 1068



to top

>ref|NM_030653.2| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae) (DDX11),
           transcript variant 1, mRNA
          Length = 3875

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 818 gtggatgaggatgaggatgac 838



to top

>ref|NM_004399.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae) (DDX11),
           transcript variant 2, mRNA
          Length = 3755

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 852 gtggatgaggatgaggatgac 872



to top

>gb|BC085279.1| Mus musculus RIKEN cDNA 2310040C09 gene, mRNA (cDNA clone MGC:102599
            IMAGE:30438273), complete cds
          Length = 2968

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1812 tggatgaggatgaggatgacg 1832



to top

>ref|XM_323946.1| Neurospora crassa OR74A hypothetical protein (NCU04591.1) partial
            mRNA
          Length = 2040

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 222  ggatgtggatgaggatgaggatgac 246
            ||||| |||||||||||||||||||
Sbjct: 1431 ggatgaggatgaggatgaggatgac 1407



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1437 ggatgaggatgaggatgaggatga 1414



to top

>ref|XM_363887.1| Magnaporthe grisea 70-15 hypothetical protein (MG01813.4) partial
           mRNA
          Length = 4173

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 222 ggatgtggatgaggatgaggatgac 246
           ||||| |||||||||||||||||||
Sbjct: 438 ggatgaggatgaggatgaggatgac 462



to top

>gb|BC078152.1| Homo sapiens cDNA clone IMAGE:6061719, containing frame-shift
           errors
          Length = 3484

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 854 gtggatgaggatgaggatgac 874



to top

>ref|XM_952832.1| Neurospora crassa OR74A hypothetical protein (NCU04591.1) partial
            mRNA
          Length = 2040

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 222  ggatgtggatgaggatgaggatgac 246
            ||||| |||||||||||||||||||
Sbjct: 1431 ggatgaggatgaggatgaggatgac 1407



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1437 ggatgaggatgaggatgaggatga 1414



to top

>ref|NM_178618.2| Mus musculus RIKEN cDNA 2310040C09 gene (2310040C09Rik), mRNA
          Length = 2940

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1798 tggatgaggatgaggatgacg 1818



to top

>ref|XM_755515.1| Ustilago maydis 521 hypothetical protein (UM04461.1) partial mRNA
          Length = 3153

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 221  tggatgtggatgaggatgagg 241
            |||||||||||||||||||||
Sbjct: 2116 tggatgtggatgaggatgagg 2096



to top

>ref|XM_757135.1| Ustilago maydis 521 hypothetical protein (UM06081.1) partial mRNA
          Length = 2616

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 222 ggatgtggatgaggatgaggatgac 246
           ||||| |||||||||||||||||||
Sbjct: 319 ggatgaggatgaggatgaggatgac 295



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 325 ggatgaggatgaggatgaggatga 302



to top

>ref|XM_381612.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01436.1)
           partial mRNA
          Length = 351

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 227 tggatgaggatgaggatgacg 247
           |||||||||||||||||||||
Sbjct: 119 tggatgaggatgaggatgacg 139



to top

>gb|BC011264.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae), mRNA (cDNA
           clone MGC:9335 IMAGE:3451006), complete cds
          Length = 3907

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 856 gtggatgaggatgaggatgac 876



to top

>gb|AY389348.1| Homo sapiens LDL receptor adaptor protein (ARH) gene, complete cds
          Length = 43420

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 121   tgttcccaggaaccaggctgc 141
             |||||||||||||||||||||
Sbjct: 27173 tgttcccaggaaccaggctgc 27153



to top

>emb|BX321882.7| Zebrafish DNA sequence from clone DKEYP-30F1 in linkage group 12,
             complete sequence
          Length = 187475

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 221   tggatgtggatgaggatgaggatga 245
             |||||| ||||||||||||||||||
Sbjct: 40543 tggatgaggatgaggatgaggatga 40567



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 221   tggatgtggatgaggatgaggatga 245
             ||||| |||||||||||||||||||
Sbjct: 40537 tggatatggatgaggatgaggatga 40561



to top

>gb|BC111733.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae), mRNA (cDNA
           clone MGC:133249 IMAGE:40035545), complete cds
          Length = 3079

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 891 gtggatgaggatgaggatgac 911



to top

>emb|AL139277.7| Human DNA sequence from clone RP11-465E19 on chromosome Xp11.1-11.23
             Contains the 3' end of the RRAGB for Ras-related GTP
             binding B, complete sequence
          Length = 158591

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 221   tggatgtggatgaggatgaggatga 245
             |||||| ||||||||||||||||||
Sbjct: 61111 tggatgaggatgaggatgaggatga 61087



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 222   ggatgtggatgaggatgaggatgac 246
             ||||| |||||||||||||||||||
Sbjct: 61104 ggatgaggatgaggatgaggatgac 61080



to top

>emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in linkage group 20 Contains
              the gene for a novel protein (zgc:63746), the gene for a
              novel protein (zgc:55614), the gene for the 5' end of a
              novel protein similar to mouse and human cyclin-dependent
              kinase (CDC2-like) 11 (CDK11), the gene for a novel protein
              similar to vertebrate mitogen-activated protein kinase
              kinase kinase 5 (MAP3K5), a novel gene and eleven CpG
              islands, complete sequence
          Length = 199986

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 229    gatgaggatgaggatgacgga 249
              |||||||||||||||||||||
Sbjct: 126654 gatgaggatgaggatgacgga 126674



to top

>emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cosmid contig 80A10
          Length = 161126

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 222   ggatgtggatgaggatgaggatgac 246
             ||||| |||||||||||||||||||
Sbjct: 98175 ggatgaggatgaggatgaggatgac 98151



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 98181 ggatgaggatgaggatgaggatga 98158



to top

>gb|BC050522.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae), mRNA (cDNA
           clone MGC:57502 IMAGE:6471750), complete cds
          Length = 3774

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 720 gtggatgaggatgaggatgac 740



to top

>gb|BC047317.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae), mRNA (cDNA
           clone IMAGE:5216292), with apparent retained intron
          Length = 4084

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 845 gtggatgaggatgaggatgac 865



to top

>ref|NM_182501.2| Homo sapiens MTERF domain containing 2 (MTERFD2), mRNA
          Length = 4545

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1052 tggatgaggatgaggatgacg 1072



to top

>gb|BC050069.1| Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11
           (CHL1-like helicase homolog, S. cerevisiae), mRNA (cDNA
           clone MGC:50970 IMAGE:5271949), complete cds
          Length = 3738

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 681 gtggatgaggatgaggatgac 701



to top

>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
             3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
             elegans), the Prpsap2 gene for phosphoribosyl
             pyrophosphate synthetase-associated protein 2, the gene
             for a novel sodium/glucose cotransporter protein, the gene
             for a novel protein (2310040C09Rik), the Grap gene for
             GRB2-related adaptor protein and a CpG island, complete
             sequence
          Length = 186359

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   tggatgaggatgaggatgacg 247
             |||||||||||||||||||||
Sbjct: 98578 tggatgaggatgaggatgacg 98558



to top

>emb|CR615652.1| full-length cDNA clone CS0DF037YL05 of Fetal brain of Homo sapiens
            (human)
          Length = 1531

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 995  tggatgaggatgaggatgacg 1015



to top

>gb|BC053533.1| Homo sapiens MTERF domain containing 2, mRNA (cDNA clone MGC:61716
            IMAGE:4417008), complete cds
          Length = 1612

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1028 tggatgaggatgaggatgacg 1048



to top

>dbj|AK131298.1| Homo sapiens cDNA FLJ16261 fis, clone IMR322007078
          Length = 2410

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1849 tggatgaggatgaggatgacg 1869



to top

>emb|CR622447.1| full-length cDNA clone CS0DC010YC23 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1536

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 998  tggatgaggatgaggatgacg 1018



to top

>emb|CR617083.1| full-length cDNA clone CS0DI071YA05 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1517

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 998  tggatgaggatgaggatgacg 1018



to top

>emb|CR607675.1| full-length cDNA clone CS0DF022YI07 of Fetal brain of Homo sapiens
            (human)
          Length = 1529

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 998  tggatgaggatgaggatgacg 1018



to top

>emb|CR590225.1| full-length cDNA clone CS0DC003YH23 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1570

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1037 tggatgaggatgaggatgacg 1057



to top

>dbj|AK021703.1| Homo sapiens cDNA FLJ11641 fis, clone HEMBA1004354, weakly similar
           to CHL1 PROTEIN
          Length = 1825

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 55  gtggatgaggatgaggatgac 75



to top

>gb|AC006432.15| Homo sapiens 12p13 PAC RPCI11-726G1 (Roswell Park Cancer Institute Human
              PAC Library) complete sequence
          Length = 180685

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 226    gtggatgaggatgaggatgac 246
              |||||||||||||||||||||
Sbjct: 176404 gtggatgaggatgaggatgac 176424



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 222     ggatgtggatgaggatgaggatgac 246
               ||||| |||||||||||||||||||
Sbjct: 1037344 ggatgaggatgaggatgaggatgac 1037320



to top

>ref|XM_927232.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 2 (DDX12), mRNA
          Length = 5094

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931954.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 26 (DDX12), mRNA
          Length = 4944

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931947.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 25 (DDX12), mRNA
          Length = 4849

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1135 gtggatgaggatgaggatgac 1155



to top

>ref|XM_931941.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 12 (CHL1-like helicase homolog, S.
           cerevisiae), transcript variant 24 (DDX12), mRNA
          Length = 4445

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 713 gtggatgaggatgaggatgac 733



to top

>ref|XM_931933.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 12 (CHL1-like helicase homolog, S.
           cerevisiae), transcript variant 23 (DDX12), mRNA
          Length = 4463

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 731 gtggatgaggatgaggatgac 751



to top

>ref|XM_931927.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 22 (DDX12), mRNA
          Length = 4776

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1044 gtggatgaggatgaggatgac 1064



to top

>ref|XM_495908.2| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 1 (DDX12), mRNA
          Length = 5021

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1307 gtggatgaggatgaggatgac 1327



to top

>ref|XM_931918.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 12 (CHL1-like helicase homolog, S.
           cerevisiae), transcript variant 21 (DDX12), mRNA
          Length = 4437

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 472 gtggatgaggatgaggatgac 492



to top

>ref|XM_931915.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 20 (DDX12), mRNA
          Length = 5380

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1568 gtggatgaggatgaggatgac 1588



to top

>ref|XM_931895.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 17 (DDX12), mRNA
          Length = 4675

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931891.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 16 (DDX12), mRNA
          Length = 6525

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931887.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 15 (DDX12), mRNA
          Length = 5251

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931883.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 14 (DDX12), mRNA
          Length = 3222

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931876.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 13 (DDX12), mRNA
          Length = 4249

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931872.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 12 (DDX12), mRNA
          Length = 2060

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_931867.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 11 (DDX12), mRNA
          Length = 1260

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1135 gtggatgaggatgaggatgac 1155



to top

>ref|XM_931845.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 7 (DDX12), mRNA
          Length = 4940

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1226 gtggatgaggatgaggatgac 1246



to top

>ref|XM_931839.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 12 (CHL1-like helicase homolog, S.
           cerevisiae), transcript variant 6 (DDX12), mRNA
          Length = 1571

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 472 gtggatgaggatgaggatgac 492



to top

>ref|XM_931836.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 12 (CHL1-like helicase homolog, S.
           cerevisiae), transcript variant 5 (DDX12), mRNA
          Length = 611

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 486 gtggatgaggatgaggatgac 506



to top

>ref|XM_931833.1| PREDICTED: Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
            12 (CHL1-like helicase homolog, S. cerevisiae),
            transcript variant 4 (DDX12), mRNA
          Length = 2502

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_944856.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 11 isoform 1, transcript variant 6
            (LOC650933), mRNA
          Length = 2206

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_944852.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 11 isoform 1, transcript variant 5
           (LOC650933), mRNA
          Length = 1571

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 472 gtggatgaggatgaggatgac 492



to top

>ref|XM_944851.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
           polypeptide 11 isoform 1, transcript variant 4
           (LOC650933), mRNA
          Length = 955

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 472 gtggatgaggatgaggatgac 492



to top

>ref|XM_940861.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 11 isoform 1, transcript variant 1
            (LOC650933), mRNA
          Length = 2060

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1380 gtggatgaggatgaggatgac 1400



to top

>ref|XM_944847.1| PREDICTED: Homo sapiens similar to DEAD/H (Asp-Glu-Ala-Asp/His) box
            polypeptide 11 isoform 1, transcript variant 3
            (LOC650933), mRNA
          Length = 1961

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1135 gtggatgaggatgaggatgac 1155



to top

>ref|XM_697070.1| PREDICTED: Danio rerio hypothetical protein LOC554886 (LOC554886),
            mRNA
          Length = 2220

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  gatgaggatgaggatgacgga 249
            |||||||||||||||||||||
Sbjct: 1111 gatgaggatgaggatgacgga 1131



to top

>ref|XM_689738.1| PREDICTED: Danio rerio similar to peptidylprolyl isomerase
            (cyclophilin)-like 4 (LOC566468), mRNA
          Length = 1305

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  gatgaggatgaggatgacgga 249
            |||||||||||||||||||||
Sbjct: 1165 gatgaggatgaggatgacgga 1185



to top

>emb|BX572623.8| Human DNA sequence from clone XXyac-22CH10 on chromosome 1, complete
              sequence
          Length = 112168

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 121    tgttcccaggaaccaggctgc 141
              |||||||||||||||||||||
Sbjct: 108617 tgttcccaggaaccaggctgc 108597



to top

>gb|AY007367.1| Lycopersicon esculentum tospovirus resistance protein C (Sw5-c),
             tospovirus resistance protein D (Sw5-d), and tospovirus
             resistance protein E (Sw5-e) genes, complete cds
          Length = 59465

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 222   ggatgtggatgaggatgaggatgac 246
             ||||| |||||||||||||||||||
Sbjct: 38307 ggatgaggatgaggatgaggatgac 38331



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 38301 ggatgaggatgaggatgaggatga 38324



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 38295 ggatgaggatgaggatgaggatga 38318



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 31409 ggatgaggatgaggatgaggatga 31432



to top

>gb|AC158493.2| Capitella capitata clone JGIAUTO-1A6, complete sequence
          Length = 35980

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 225   tgtggatgaggatgaggatga 245
             |||||||||||||||||||||
Sbjct: 24229 tgtggatgaggatgaggatga 24249



to top

>dbj|AK028566.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
            library, clone:4732401E24 product:hypothetical
            Phospholipase D/nuclease structure containing protein,
            full insert sequence
          Length = 2940

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1798 tggatgaggatgaggatgacg 1818



to top

>gb|AC092821.11| Homo sapiens 12 BAC RP11-525E9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 121181

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 226   gtggatgaggatgaggatgac 246
             |||||||||||||||||||||
Sbjct: 17249 gtggatgaggatgaggatgac 17229



to top

>gb|AC007723.5|AC007723 Drosophila melanogaster, chromosome 3R, region 87F-87F, BAC clone
              BACR01E10, complete sequence
          Length = 160972

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 220    gtggatgtggatgaggatgaggatg 244
              ||||||||||||||||||| |||||
Sbjct: 113018 gtggatgtggatgaggatgtggatg 112994



to top

>gb|AC005237.2|AC005237 Homo sapiens BAC clone RP11-556H17 from 2, complete sequence
          Length = 175179

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 227   tggatgaggatgaggatgacg 247
             |||||||||||||||||||||
Sbjct: 64095 tggatgaggatgaggatgacg 64075



to top

>ref|NM_199890.1| Danio rerio peptidylprolyl isomerase (cyclophilin)-like 4 (ppil4),
            mRNA
          Length = 2210

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  gatgaggatgaggatgacgga 249
            |||||||||||||||||||||
Sbjct: 1111 gatgaggatgaggatgacgga 1131



to top

>gb|AC009533.10| Homo sapiens 12 BAC RP11-22B23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162572

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 226   gtggatgaggatgaggatgac 246
             |||||||||||||||||||||
Sbjct: 83789 gtggatgaggatgaggatgac 83769



to top

>emb|BX000984.7| Zebrafish DNA sequence from clone CH211-157C7, complete sequence
          Length = 160029

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 71    aagttttgttttgttgtagcacgtc 95
             ||||||||||||||||| |||||||
Sbjct: 64735 aagttttgttttgttgttgcacgtc 64711



to top

>gb|BC056814.1| Danio rerio peptidylprolyl isomerase (cyclophilin)-like 4, mRNA (cDNA
            clone MGC:63746 IMAGE:2640101), complete cds
          Length = 2210

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 229  gatgaggatgaggatgacgga 249
            |||||||||||||||||||||
Sbjct: 1111 gatgaggatgaggatgacgga 1131



to top

>dbj|AP003233.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0037C04
          Length = 137879

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 223   gatgtggatgaggatgaggatgacg 247
             |||| ||||||||||||||||||||
Sbjct: 71139 gatgaggatgaggatgaggatgacg 71163



to top

>gb|AY893130.1| Synthetic construct Homo sapiens clone FLH119967.01L DEAD/H box
           polypeptide 11 (DDX11) mRNA, partial cds
          Length = 2913

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 640 gtggatgaggatgaggatgac 660



to top

>emb|BX648184.1|HSM808332 Homo sapiens mRNA; cDNA DKFZp686L13129 (from clone DKFZp686L13129)
          Length = 4539

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 227  tggatgaggatgaggatgacg 247
            |||||||||||||||||||||
Sbjct: 1041 tggatgaggatgaggatgacg 1061



to top

>emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in linkage group 20,
             complete sequence
          Length = 169849

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 229   gatgaggatgaggatgacgga 249
             |||||||||||||||||||||
Sbjct: 38300 gatgaggatgaggatgacgga 38280



to top

>gb|AC008013.8| Homo sapiens 12 BAC RP11-551L14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168986

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 226    gtggatgaggatgaggatgac 246
              |||||||||||||||||||||
Sbjct: 133731 gtggatgaggatgaggatgac 133751



to top

>gb|AE003700.3| Drosophila melanogaster chromosome 3R, section 38 of 118 of the complete
              sequence
          Length = 228324

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 220    gtggatgtggatgaggatgaggatg 244
              ||||||||||||||||||| |||||
Sbjct: 200092 gtggatgtggatgaggatgtggatg 200068



to top

>gb|AC132471.4| Mus musculus BAC clone RP23-106E17 from 10, complete sequence
          Length = 197822

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 438    ttgcactcttgccattgagca 458
              |||||||||||||||||||||
Sbjct: 147524 ttgcactcttgccattgagca 147504



to top

>gb|U75968.1|HSU75968 Human clone C3 CHL1 protein (CHLR1) mRNA, alternatively spliced,
            complete cds
          Length = 4203

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 226  gtggatgaggatgaggatgac 246
            |||||||||||||||||||||
Sbjct: 1048 gtggatgaggatgaggatgac 1068



to top

>gb|U75967.1|HSU75967 Human CHL1 potential helicase (CHLR1), complete cds
          Length = 3838

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 781 gtggatgaggatgaggatgac 801



to top

>gb|U33834.1|HSU33834 Human CHL1-related helicase (CHLR2) mRNA, partial cds
          Length = 2202

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 196 gtggatgaggatgaggatgac 216



to top

>gb|U33833.1|HSU33833 Human CHL1-related helicase (CHLR1) mRNA, complete cds
          Length = 3096

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 818 gtggatgaggatgaggatgac 838



to top

>emb|X99583.1|HSCHL1 H.sapiens mRNA for CHL1 protein
          Length = 3755

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 226 gtggatgaggatgaggatgac 246
           |||||||||||||||||||||
Sbjct: 852 gtggatgaggatgaggatgac 872



to top

>dbj|AP002909.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0044F08
          Length = 141528

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 223   gatgtggatgaggatgaggatgacg 247
             |||| ||||||||||||||||||||
Sbjct: 22709 gatgaggatgaggatgaggatgacg 22733



to top

>ref|NM_127512.2| Arabidopsis thaliana nucleotide binding AT2G19540 mRNA, complete
           cds
          Length = 1619

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 228 ggatgaggatgaggatgacg 247
           ||||||||||||||||||||
Sbjct: 417 ggatgaggatgaggatgacg 436



to top

>ref|XM_638940.1| Dictyostelium discoideum hypothetical protein (DDB0167791), partial
           mRNA
          Length = 702

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 614 ggatgaggatgaggatgaggatga 591



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 566 ggatgaggatgaggatgaggatga 543



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 560 ggatgaggatgaggatgaggatga 537



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 554 ggatgaggatgaggatgaggatga 531



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 548 ggatgaggatgaggatgaggatga 525



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 506 ggatgaggatgaggatgaggatga 483



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 500 ggatgaggatgaggatgaggatga 477



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 494 ggatgaggatgaggatgaggatga 471



to top

>ref|XM_638425.1| Dictyostelium discoideum hypothetical protein (DDB0217700), partial
            mRNA
          Length = 3873

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 219  tgtggatgtggatgaggatg 238
            ||||||||||||||||||||
Sbjct: 1253 tgtggatgtggatgaggatg 1234



to top

>ref|XM_635248.1| Dictyostelium discoideum hypothetical protein (DDB0205166), partial
           mRNA
          Length = 1323

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 708 ggatgaggatgaggatgaggatga 685



to top

>ref|XM_509170.1| PREDICTED: Pan troglodytes amplified in osteosarcoma (LOC452022),
            mRNA
          Length = 2079

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1260 ggatgaggatgaggatgaggatga 1283



to top

>ref|XM_480116.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 561

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 228 ggatgaggatgaggatgaggatga 251



to top

>ref|NM_194693.1| Oryza sativa (japonica cultivar-group) unknown protein
            (OSJNBa0020E23.10), mRNA
          Length = 1728

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1701 ggatgaggatgaggatgaggatga 1724



to top

>gb|AC154044.2| Drosophila melanogaster clone BACR32E02, complete sequence
          Length = 186002

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 91936 ggatgcggatgaggatgaggatga 91959



to top

>gb|AC154051.2| Drosophila melanogaster clone BACR17E02, complete sequence
          Length = 168158

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 20516 ggatgcggatgaggatgaggatga 20539



to top

>ref|XM_469446.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1143

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 186 ggatgaggatgaggatgaggatga 209



to top

>gb|AE017135.1| Yersinia pestis biovar Medievalis str. 91001 section 9 of 16 of the
              complete genome
          Length = 291326

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 217355 ggatgaggatgaggatgaggatga 217378



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 217349 ggatgaggatgaggatgaggatga 217372



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 217343 ggatgaggatgaggatgaggatga 217366



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 217337 ggatgaggatgaggatgaggatga 217360



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
               sequence
          Length = 1783081

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1290015 ggatgaggatgaggatgaggatga 1290038



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1290009 ggatgaggatgaggatgaggatga 1290032



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1290003 ggatgaggatgaggatgaggatga 1290026



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1289997 ggatggggatgaggatgaggatga 1290020



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269809 ggatggggatgaggatgaggatga 269786



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269803 ggatgaggatgaggatgaggatga 269780



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269797 ggatgaggatgaggatgaggatga 269774



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269791 ggatgaggatgaggatgaggatga 269768



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269785 ggatgaggatgaggatgaggatga 269762



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 269779 ggatgaggatgaggatgaggatga 269756



to top

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
               sequence
          Length = 2105742

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1681018 ggatgaggatgaggatgaggatga 1680995



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 347866 ggatgaggatgaggatgaggatga 347889



to top

>gb|AC084046.13| Trypanosoma brucei chromosome 6 clone RPCI93-3D8, complete sequence
          Length = 154240

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 141013 ggatgaggatgaggatgaggatga 141036



to top

>gb|AC008225.4| Drosophila melanogaster clone BACR03E11, complete sequence
          Length = 174123

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 28180 ggatgaggatgaggatgaggatga 28203



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 28174 ggatggggatgaggatgaggatga 28197



to top

>gb|AC010124.6| Drosophila melanogaster clone BACR06O03, complete sequence
          Length = 193483

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 222   ggatgtggatgaggatgagg 241
             ||||||||||||||||||||
Sbjct: 70244 ggatgtggatgaggatgagg 70225



to top

>gb|AC012164.12| Drosophila melanogaster clone BACR14D22, complete sequence
          Length = 169385

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 219   tgtggatgtggatgaggatgagga 242
             |||| |||||||||||||||||||
Sbjct: 58253 tgtgtatgtggatgaggatgagga 58276



to top

>gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromosome 17, complete
             sequence
          Length = 181509

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 308   catgagagaaccagctcata 327
             ||||||||||||||||||||
Sbjct: 63160 catgagagaaccagctcata 63179



to top

>gb|AC150554.1| Drosophila melanogaster clone BACR21O10, complete sequence
          Length = 193926

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    tgtggatgtggatgaggatg 238
              ||||||||||||||||||||
Sbjct: 152919 tgtggatgtggatgaggatg 152900



to top

>ref|XM_960622.1| Neurospora crassa OR74A hypothetical protein (NCU02584.1) partial
           mRNA
          Length = 1179

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 786 ggatgaggatgaggatgaggatga 809



to top

>gb|AC185243.2| Pan troglodytes BAC clone CH251-228E19 from chromosome 3, complete
              sequence
          Length = 222273

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 342    ctcactcgggaagcgtaagg 361
              ||||||||||||||||||||
Sbjct: 160830 ctcactcgggaagcgtaagg 160849



to top

>ref|XM_323037.1| Neurospora crassa OR74A hypothetical protein (NCU03736.1) partial
           mRNA
          Length = 1224

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 tggatgaggatgaggatgac 246
           ||||||||||||||||||||
Sbjct: 677 tggatgaggatgaggatgac 696



to top

>ref|XM_954556.1| Neurospora crassa OR74A hypothetical protein (NCU08157.1) partial
            mRNA
          Length = 2403

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1737 ggatgaggatgaggatgaggatga 1760



to top

>ref|XM_956419.1| Neurospora crassa OR74A hypothetical protein (NCU03736.1) partial
           mRNA
          Length = 1224

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 227 tggatgaggatgaggatgac 246
           ||||||||||||||||||||
Sbjct: 677 tggatgaggatgaggatgac 696



to top

>ref|XM_956624.1| Neurospora crassa OR74A hypothetical protein (NCU01105.1) partial
            mRNA
          Length = 5253

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 5148 ggatgaggatgaggatgaggatga 5171



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 5142 ggatgaggatgaggatgaggatga 5165



to top

>ref|XM_959956.1| Neurospora crassa OR74A hypothetical protein (NCU07502.1) partial
           mRNA
          Length = 1920

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 24  ggatgaggatgaggatgaggatga 47



to top

>ref|XM_326597.1| Neurospora crassa OR74A hypothetical protein (NCU01105.1) partial
            mRNA
          Length = 5253

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 5148 ggatgaggatgaggatgaggatga 5171



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 5142 ggatgaggatgaggatgaggatga 5165



to top

>ref|XM_327787.1| Neurospora crassa OR74A hypothetical protein (NCU07502.1) partial
           mRNA
          Length = 1920

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 24  ggatgaggatgaggatgaggatga 47



to top

>ref|XM_328862.1| Neurospora crassa OR74A hypothetical protein (NCU08157.1) partial
            mRNA
          Length = 2403

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1737 ggatgaggatgaggatgaggatga 1760



to top

>ref|XM_331782.1| Neurospora crassa OR74A hypothetical protein (NCU02584.1) partial
           mRNA
          Length = 1179

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 786 ggatgaggatgaggatgaggatga 809



to top

>ref|NM_006812.2| Homo sapiens amplified in osteosarcoma (OS9), transcript variant 1,
            mRNA
          Length = 2721

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1310 ggatgaggatgaggatgaggatga 1333



to top

>ref|NM_001017956.1| Homo sapiens amplified in osteosarcoma (OS9), transcript variant 2,
            mRNA
          Length = 2556

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1310 ggatgaggatgaggatgaggatga 1333



to top

>ref|NM_001017957.1| Homo sapiens amplified in osteosarcoma (OS9), transcript variant 3,
            mRNA
          Length = 2511

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1310 ggatgaggatgaggatgaggatga 1333



to top

>ref|NM_001017958.1| Homo sapiens amplified in osteosarcoma (OS9), transcript variant 4,
            mRNA
          Length = 2676

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1310 ggatgaggatgaggatgaggatga 1333



to top

>ref|XM_705666.1| Candida albicans SC5314 putative DNA repair apurinic/apyrimidinic
            endonuclease Apn2p (CaO19.9394), mRNA
          Length = 1356

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1194 ggatgaggatgaggatgaggatga 1217



to top

>ref|XM_705628.1| Candida albicans SC5314 putative DNA repair apurinic/apyrimidinic
            endonuclease Apn2p (CaO19.1836), mRNA
          Length = 1356

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1194 ggatgaggatgaggatgaggatga 1217



to top

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 26699 ggatgaggatgaggatgaggatga 26676



to top

>ref|XM_654417.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1905.2), mRNA
          Length = 594

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 114 ggatgaggatgaggatgaggatga 137



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900647 ggatgaggatgaggatgaggatga 1900624



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900641 ggatgaggatgaggatgaggatga 1900618



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900635 ggatgaggatgaggatgaggatga 1900612



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900629 ggatgaggatgaggatgaggatga 1900606



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900623 ggatgaggatgaggatgaggatga 1900600



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900617 ggatgaggatgaggatgaggatga 1900594



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900611 ggatgaggatgaggatgaggatga 1900588



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1900605 ggatgaggatgaggatgaggatga 1900582



to top

>ref|XM_454170.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E04939g predicted mRNA
          Length = 747

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 339 ggatgaggatgaggatgaggatga 316



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 333 ggatgaggatgaggatgaggatga 310



to top

>ref|XM_452424.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C05016g predicted mRNA
          Length = 480

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 357 ggatgaggatgaggatgaggatga 334



to top

>gb|BT014350.1| Lycopersicon esculentum clone 133626F, mRNA sequence
          Length = 1197

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 202 ggatgaggatgaggatgaggatga 179



to top

>ref|NM_024885.2| Homo sapiens TAF7-like RNA polymerase II, TATA box binding protein
            (TBP)-associated factor, 50kDa (TAF7L), mRNA
          Length = 2357

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1041 ggatgaggatgaggatgaggatga 1064



to top

>gb|AC122749.9| Mus musculus chromosome 3, clone RP24-175I7, complete sequence
          Length = 188484

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 461    aacagctcaccatccaccca 480
              ||||||||||||||||||||
Sbjct: 124076 aacagctcaccatccaccca 124095



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 222      ggatgtggatgaggatgaggatga 245
                ||||| ||||||||||||||||||
Sbjct: 27998821 ggatgaggatgaggatgaggatga 27998798



to top

>ref|XM_994047.1| PREDICTED: Mus musculus hypothetical protein LOC672514 (LOC672514),
           mRNA
          Length = 576

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 226 gtggatgaggatgaggatga 245
           ||||||||||||||||||||
Sbjct: 373 gtggatgaggatgaggatga 392



to top

>ref|XM_987857.1| PREDICTED: Mus musculus hypothetical protein LOC667029 (LOC667029),
           mRNA
          Length = 768

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 226 gtggatgaggatgaggatga 245
           ||||||||||||||||||||
Sbjct: 565 gtggatgaggatgaggatga 584



to top

>gb|AC133334.8| Oryza sativa chromosome 3 BAC OSJNBa0004L11 genomic sequence, complete
             sequence
          Length = 133889

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 26205 ggatgaggatgaggatgaggatga 26228



to top

>ref|XM_533043.2| PREDICTED: Canis familiaris similar to acidic (leucine-rich)
           nuclear phosphoprotein 32 family, member E (LOC475834),
           mRNA
          Length = 1646

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 929 ggatgaggatgaggatgaggatga 952



to top

>ref|XM_746925.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g08080)
           partial mRNA
          Length = 1671

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 291 ggatgaggatgaggatgaggatga 314



to top

>ref|XM_388140.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07964.1)
           partial mRNA
          Length = 2847

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 708 ggatgaggatgaggatgaggatga 731



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 702 ggatgaggatgaggatgaggatga 725



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 696 ggatgaggatgaggatgaggatga 719



to top

>ref|XM_390019.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09843.1)
           partial mRNA
          Length = 2592

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 226 gtggatgaggatgaggatga 245
           ||||||||||||||||||||
Sbjct: 769 gtggatgaggatgaggatga 788



to top

>ref|XM_568775.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNB00340) partial mRNA
          Length = 3090

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 588 ggatgaggatgaggatgaggatga 611



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 582 ggatgaggatgaggatgaggatga 605



to top

>ref|XM_569780.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNC05650) partial mRNA
          Length = 1505

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 493 ggatgaggatgaggatgaggatga 516



to top

>gb|AC127344.3| Mus musculus BAC clone RP23-212H18 from chromosome 7, complete sequence
          Length = 182487

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 117028 ggatgaggatgaggatgaggatga 117051



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 117022 ggatgaggatgaggatgaggatga 117045



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 117016 ggatgaggatgaggatgaggatga 117039



to top

>gb|AC025165.27| Homo sapiens 12 BAC RP11-571M6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 211544

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 112181 ggatgaggatgaggatgaggatga 112204



to top

>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence
          Length = 200673

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 114    ccagccatgttcccaggaaccagg 137
              ||||||||||||||||| ||||||
Sbjct: 175812 ccagccatgttcccaggtaccagg 175835



to top

>gb|BC006506.2| Homo sapiens amplified in osteosarcoma, mRNA (cDNA clone
           IMAGE:2961147), partial cds
          Length = 1787

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 371 ggatgaggatgaggatgaggatga 394



to top

>ref|XM_760814.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_0380) partial mRNA
          Length = 3570

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 2607 ggatgaggatgaggatgaggatga 2630



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 2601 ggatgaggatgaggatgaggatga 2624



to top

>ref|XM_672107.1| Plasmodium berghei strain ANKA chaperonin cpn60, mitochondrial
            precursor (PB001598.02.0) partial mRNA
          Length = 2076

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 232  gaggatgaggatgacggagacggagaag 259
            |||||||||||||||| |||||| ||||
Sbjct: 1984 gaggatgaggatgacgaagacggtgaag 2011



to top

>gb|AY344225.1| Candida glabrata Epa5p (EPA5) and Epa4p (EPA4) genes, complete cds
          Length = 27514

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 20179 ggatgaggatgaggatgaggatga 20156



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 20173 ggatgaggatgaggatgaggatga 20150



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 10587 ggatgaggatgaggatgaggatga 10610



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 10581 ggatgaggatgaggatgaggatga 10604



to top

>emb|AJ783221.1| Drosophila melanogaster CG8557 gene intron 1, strain CN22BX,
           fragment ID 87-16BMELCN22BX
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783220.1| Drosophila melanogaster CG8557 gene intron 1, strain CN21X,
           fragment ID 87-16BMELCN21X
          Length = 738

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783219.1| Drosophila melanogaster CG8557 gene intron 1, strain CN19X,
           fragment ID 87-16BMELCN19X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783218.1| Drosophila melanogaster CG8557 gene intron 1, strain CN17X,
           fragment ID 87-16BMELCN17X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783217.1| Drosophila melanogaster CG8557 gene intron 1, strain CN16X,
           fragment ID 87-16BMELCN16X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783216.1| Drosophila melanogaster CG8557 gene intron 1, strain CN15X,
           fragment ID 87-16BMELCN15X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783214.1| Drosophila melanogaster CG8557 gene intron 1, strain CN11X,
           fragment ID 87-16BMELCN11X
          Length = 745

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 592 ggatgaggatgaggatgaggatga 615



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783213.1| Drosophila melanogaster CG8557 gene intron 1, strain CN10X,
           fragment ID 87-16BMELCN10X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783212.1| Drosophila melanogaster CG8557 gene intron 1, strain CN7X, fragment
           ID 87-16BMELCN7X
          Length = 738

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783211.1| Drosophila melanogaster CG8557 gene intron 1, strain CN5X, fragment
           ID 87-16BMELCN5X
          Length = 739

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783210.1| Drosophila melanogaster CG8557 gene intron 1, strain CN4X, fragment
           ID 87-16BMELCN4X
          Length = 738

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>emb|AJ783209.1| Drosophila melanogaster CG8557 gene intron 1, strain CN3X, fragment
           ID 87-16BMELCN3X
          Length = 738

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 586 ggatgaggatgaggatgaggatga 609



to top

>ref|XM_784063.1| PREDICTED: Strongylocentrotus purpuratus similar to dishevelled 3
           (LOC584189), mRNA
          Length = 1593

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 755 ggatgaggatgaggatgaggatga 778



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 749 ggatgaggatgaggatgaggatga 772



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 743 ggatgaggatgaggatgaggatga 766



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 737 ggatgaggatgaggatgaggatga 760



to top

>ref|XM_502000.1| Yarrowia lipolytica CLIB122, YALI0C19129g predicted mRNA
          Length = 4821

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 303 ggatgaggatgaggatgaggatga 326



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||| ||||||||||||||||||
Sbjct: 297 ggatgaggatgaggatgaggatga 320



to top

>emb|AL353631.17| Human DNA sequence from clone RP11-5N16 on chromosome 9 Contains the 5'
             end of the gene for netrin G2 protein (KIAA1857) and three
             CpG islands, complete sequence
          Length = 97112

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 219   tgtggatgtggatgaggatg 238
             ||||||||||||||||||||
Sbjct: 90785 tgtggatgtggatgaggatg 90766



to top

>emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chromosome 10 Contains the
             5' end of a novel gene (DKFZp761L0424) (KIAA1217) and a
             CpG island, complete sequence
          Length = 84778

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   tggatcctgtgaggagccag 197
             ||||||||||||||||||||
Sbjct: 80853 tggatcctgtgaggagccag 80834



to top

>emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on chromosome 9 Contains the 5'
              end of a novel gene (CGI-67), a novel gene, a novel gene
              (LOC138240) and a CpG island, complete sequence
          Length = 195844

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    tgtgaggagccaggctacct 204
              ||||||||||||||||||||
Sbjct: 167746 tgtgaggagccaggctacct 167765



to top

>emb|AL136080.6| Human DNA sequence from clone RP11-448E12 on chromosome Xq22.1-23
              Contains part of the COL4A6 gene for collagen type IV alpha
              6, complete sequence
          Length = 116106

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 342    ctcactcgggaagcgtaagg 361
              ||||||||||||||||||||
Sbjct: 106876 ctcactcgggaagcgtaagg 106895



to top

>emb|AL121974.16|HSJ417L20 Human DNA sequence from clone RP3-417L20 on chromosome 6p12-21.3
             Contains the 5' end of the gene for specific granule
             protein (28 kDa) (SGP28) and the PGK2 gene for
             phosphoglycerate kinase 2, parts of 2 novel genes,
             complete sequence
          Length = 90901

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   ctcactcgggaagcgtaagg 361
             ||||||||||||||||||||
Sbjct: 67777 ctcactcgggaagcgtaagg 67758



to top

>emb|AL109801.14|HSJ738A13 Human DNA sequence from clone RP4-738A13 on chromosome Xq21.31-22.1
            Contains the 5' end of the TAF7L gene for TAF7-like RNA
            polymerase II 50kDa TATA box binding protein
            (TBP)-associated factor and a CpG island, complete
            sequence
          Length = 46775

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 4900 ggatgaggatgaggatgaggatga 4877



to top

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
               Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 222     ggatgtggatgaggatgaggatga 245
               ||||| ||||||||||||||||||
Sbjct: 1674332 ggatgaggatgaggatgaggatga 1674309



to top

>emb|Z97342.2|ATFCA7 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 7
          Length = 201471

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 110245 ggatgaggatgaggatgaggatga 110222



to top

>emb|Z36011.1|SCYBR142W S.cerevisiae chromosome II reading frame ORF YBR142w
          Length = 2833

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 222 ggatgtggatgaggatgaggatga 245
           ||||||||||||||||| ||||||
Sbjct: 695 ggatgtggatgaggatgtggatga 718



to top

>emb|X78937.1|SCIRA1 S.cerevisiae (S288C) IRA1, YBR1118 and YBR1119 genes
          Length = 12595

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||||||||||||||| ||||||
Sbjct: 10436 ggatgtggatgaggatgtggatga 10459



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 441303 ggatgaggatgaggatgaggatga 441326



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 441297 ggatgaggatgaggatgaggatga 441320



to top

>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1753957

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 456171 ggatgaggatgaggatgaggatga 456194



to top

>emb|BX883051.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
             assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
             RT1n haplotype; segment 10/11
          Length = 348946

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    ctaagttttgttttgttgta 88
             ||||||||||||||||||||
Sbjct: 84449 ctaagttttgttttgttgta 84468



to top

>emb|BX842632.1| Neurospora crassa DNA linkage group I BAC contig B5K2
          Length = 86737

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 3914 ggatgaggatgaggatgaggatga 3891



to top

>emb|BX649606.1| Aspergillus fumigatus BAC pilot project supercontig; segment 2/3
          Length = 348551

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 223    gatgtggatgaggatgaggatgacggag 250
              |||| |||||||||||||||||| ||||
Sbjct: 275494 gatgaggatgaggatgaggatgagggag 275467



to top

>emb|AL663049.8| Mouse DNA sequence from clone RP23-198N8 on chromosome 11 Contains the
              Mor2 gene for soluble malate dehydrogenase, a novel gene, a
              phosphoglycerate mutase (Pgam) pseudogene and a CpG island,
              complete sequence
          Length = 203295

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 155766 ggatgaggatgaggatgaggatga 155743



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 155760 ggatgaggatgaggatgaggatga 155737



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 155754 ggatgaggatgaggatgaggatga 155731



to top

>emb|AL670008.1|NCB13O8 Neurospora crassa DNA linkage group V BAC contig B13O8
          Length = 80765

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 20848 ggatgaggatgaggatgaggatga 20825



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 20842 ggatgaggatgaggatgaggatga 20819



to top

>gb|BC043391.1| Homo sapiens TAF7-like RNA polymerase II, TATA box binding protein
            (TBP)-associated factor, 50kDa, mRNA (cDNA clone
            MGC:50682 IMAGE:6154641), complete cds
          Length = 2357

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1041 ggatgaggatgaggatgaggatga 1064



to top

>emb|AL513444.1|NCB11N2 Neurospora crassa DNA linkage group V BAC contig B11N2
          Length = 99360

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 77678 ggatgaggatgaggatgaggatga 77655



to top

>emb|AL161545.2|ATCHRIV45 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 45
          Length = 199548

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 96074 ggatgaggatgaggatgaggatga 96051



to top

>emb|AJ414152.1| Yersinia pestis strain CO92 complete genome; segment 12/20
          Length = 313050

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 171496 ggatgaggatgaggatgaggatga 171519



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 171490 ggatgaggatgaggatgaggatga 171513



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 222    ggatgtggatgaggatgaggatga 245
              ||||| ||||||||||||||||||
Sbjct: 171484 ggatgaggatgaggatgaggatga 171507



to top

>emb|AL137691.1|HSM802119 Homo sapiens mRNA; cDNA DKFZp434P172 (from clone DKFZp434P172)
          Length = 3880

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  ggatgtggatgaggatgaggatga 245
            ||||| ||||||||||||||||||
Sbjct: 1553 ggatgaggatgaggatgaggatga 1576



to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
             sequence
          Length = 1632307

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 93104 ggatgaggatgaggatgaggatga 93127



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   ggatgtggatgaggatgaggatga 245
             ||||| ||||||||||||||||||
Sbjct: 93098 ggatgaggatgaggatgaggatga 93121


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,312,681
Number of Sequences: 3902068
Number of extensions: 5312681
Number of successful extensions: 130053
Number of sequences better than 10.0: 355
Number of HSP's better than 10.0 without gapping: 355
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 128054
Number of HSP's gapped (non-prelim): 1746
length of query: 569
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 546
effective length of database: 17,143,297,704
effective search space: 9360240546384
effective search space used: 9360240546384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top