>gb|AC003999.2| Homo sapiens PAC clone RP5-1139P1 from 7, complete sequence
          Length = 133457

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 61    aaaaaccacataaatnatgaag 82
             ||||||||||||||| ||||||
Sbjct: 10571 aaaaaccacataaataatgaag 10592

>ref|XM_644922.1| Entamoeba histolytica HM-1:IMSS Rap/Ran GTPase activating protein
            (252.t00012) partial mRNA
          Length = 4173

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 44   taatgaagctttgtctaaa 62
            |||||||||||||||||||
Sbjct: 4029 taatgaagctttgtctaaa 4011

>emb|AL590396.13| Human DNA sequence from clone RP11-193H5 on chromosome 1 Contains the
             3' end of a novel gene (LOC401987), a actin pseudogene, a
             cytochrome b (MTCYB) pseudogene, a NADH dehydrogenase 6
             (MTND6) pseudogene and a NADH dehydrogenase 5 (MTND5)
             pseudogene, complete sequence
          Length = 122108

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    aatgaagctttgtctaaaa 63
             |||||||||||||||||||
Sbjct: 66230 aatgaagctttgtctaaaa 66248

>emb|AL023859.1|SPBC19C7 S.pombe chromosome II cosmid c19C7
          Length = 34804

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 45   aatgaagctttgtctaaaa 63
            |||||||||||||||||||
Sbjct: 9894 aatgaagctttgtctaaaa 9912

>emb|BX649488.9| Zebrafish DNA sequence from clone DKEY-21O6 in linkage group 22,
             complete sequence
          Length = 183230

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    aatgaagctttgtctaaaa 63
             |||||||||||||||||||
Sbjct: 97872 aatgaagctttgtctaaaa 97854

>ref|NM_001022079.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC19C7.03),
            partial mRNA
          Length = 5079

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 45   aatgaagctttgtctaaaa 63
            |||||||||||||||||||
Sbjct: 2683 aatgaagctttgtctaaaa 2701

>gb|AC026364.36| Homo sapiens 12 BAC RP11-183N5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 40011

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    tgaagctttgtctaaaaaa 65
             |||||||||||||||||||
Sbjct: 22096 tgaagctttgtctaaaaaa 22114

>emb|AL928771.6| Mouse DNA sequence from clone RP23-45J15 on chromosome 4, complete
             sequence
          Length = 133159

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 60    aaaaaaccacataaatnatgaa 81
             |||||||||||||||| |||||
Sbjct: 94696 aaaaaaccacataaatcatgaa 94675

>emb|CR361552.19| Zebrafish DNA sequence from clone CH211-239J15 in linkage group 22,
              complete sequence
          Length = 166346

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     aatgaagctttgtctaaaa 63
              |||||||||||||||||||
Sbjct: 156014 aatgaagctttgtctaaaa 156032

>gb|M24942.1|YSPCYR1A Yeast (S.pombe) adenylate cyclase (CYR1) gene, complete cds
          Length = 5400

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 45   aatgaagctttgtctaaaa 63
            |||||||||||||||||||
Sbjct: 2883 aatgaagctttgtctaaaa 2901

>gb|M26699.1|YSPADC Yeast (S.pombe) cyr1 gene encoding adenylyl cyclase, complete cds
          Length = 6885

 Score = 38.2 bits (19), Expect = 5.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 45   aatgaagctttgtctaaaa 63
            |||||||||||||||||||
Sbjct: 4284 aatgaagctttgtctaaaa 4302


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 574,090
Number of Sequences: 3902068
Number of extensions: 574090
Number of successful extensions: 35077
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35064
Number of HSP's gapped (non-prelim): 13
length of query: 114
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 93
effective length of database: 17,151,101,840
effective search space: 1595052471120
effective search space used: 1595052471120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)