>ref|NM_106082.1| Arabidopsis thaliana unknown protein AT1G74220 mRNA, complete cds
          Length = 951

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 73  taatgaagctgctaacaaca 92
           ||||||||||||||||||||
Sbjct: 621 taatgaagctgctaacaaca 640

>gb|AC020579.5|AC020579 Arabidopsis thaliana chromosome 1 BAC F1O17 genomic sequence, complete
             sequence
          Length = 50821

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    taatgaagctgctaacaaca 92
             ||||||||||||||||||||
Sbjct: 39441 taatgaagctgctaacaaca 39460

>gb|AC003999.2| Homo sapiens PAC clone RP5-1139P1 from 7, complete sequence
          Length = 133457

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 59    aaaaaccacataantaatgaag 80
             ||||||||||||| ||||||||
Sbjct: 10571 aaaaaccacataaataatgaag 10592

>emb|AJ578547.1|EGU578547 Elaeis guineensis microsatellite DNA, clone mEgCIR0800
          Length = 830

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 32  ggcacattnataatgaagcttt 53
           |||||||| |||||||||||||
Sbjct: 335 ggcacattgataatgaagcttt 356

>emb|CR388098.7| Zebrafish DNA sequence from clone DKEY-12J14 in linkage group 13,
             complete sequence
          Length = 192818

 Score = 38.2 bits (19), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 32    ggcacattnataatgaagcttt 53
             |||||||| |||||||||||||
Sbjct: 56222 ggcacattcataatgaagcttt 56243


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 421,349
Number of Sequences: 3902068
Number of extensions: 421349
Number of successful extensions: 19116
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19111
Number of HSP's gapped (non-prelim): 5
length of query: 123
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 102
effective length of database: 17,151,101,840
effective search space: 1749412387680
effective search space used: 1749412387680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)