>gb|AC119908.16| Mus musculus chromosome 7, clone RP24-240G4, complete sequence
          Length = 190369

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ggctgtgatcaaccttggca 137
             ||||||||||||||||||||
Sbjct: 63094 ggctgtgatcaaccttggca 63075

>gb|AE014304.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 1
             of 11 of the complete sequence
          Length = 250029

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    aagctttgaatacaaccct 33
             |||||||||||||||||||
Sbjct: 53682 aagctttgaatacaaccct 53700

>emb|AL161771.17| Human DNA sequence from clone RP11-11L8 on chromosome 13 Contains the
             SLC10A2 gene for solute carrier family 10 (sodium/bile
             acid cotransporter family, member 2, complete sequence
          Length = 171132

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    aagctttgaatacaaccct 33
             |||||||||||||||||||
Sbjct: 34861 aagctttgaatacaaccct 34879

>emb|BX883043.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
             assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
             RT1n haplotype; segment 2/11
          Length = 347664

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 37    gctcggtgttcagctntcttgagcgg 62
             ||||||||||| ||| ||||||||||
Sbjct: 10955 gctcggtgttccgctctcttgagcgg 10930

>gb|AC120734.5| Rattus norvegicus  BAC CH230-220D1 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 232990

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 37     gctcggtgttcagctntcttgagcgg 62
              ||||||||||| ||| ||||||||||
Sbjct: 155940 gctcggtgttccgctctcttgagcgg 155965


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 563,085
Number of Sequences: 3902068
Number of extensions: 563085
Number of successful extensions: 32892
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32885
Number of HSP's gapped (non-prelim): 7
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)