| Clone Name | rbags39g21 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_465282.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1517 Score = 656 bits (331), Expect = 0.0 Identities = 448/487 (91%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1315 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1256 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 1255 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 1196 Query: 297 cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 356 |||| || || ||||||| |||||||||||||| |||||||| |||||||| ||||||| Sbjct: 1195 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 1136 Query: 357 cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 416 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct: 1135 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 1076 Query: 417 tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 476 ||||||||| ||||| || ||||||||||| ||||||||||||| ||| |||||||| | Sbjct: 1075 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 1016 Query: 477 gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 536 ||||||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| Sbjct: 1015 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 956 Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 | ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct: 955 tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 896 Query: 597 cagccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaata 656 |||| || ||||||||||| || |||||||| |||||||||||||||||||| ||||||| Sbjct: 895 cagcaccagtctgagcatcaaaacgagcagttgctatagcatcaacctcatcgatgaata 836 Query: 657 ttatagc 663 | ||||| Sbjct: 835 tgatagc 829
>dbj|AK071476.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091H23, full insert sequence Length = 1518 Score = 656 bits (331), Expect = 0.0 Identities = 448/487 (91%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1315 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1256 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 1255 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 1196 Query: 297 cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 356 |||| || || ||||||| |||||||||||||| |||||||| |||||||| ||||||| Sbjct: 1195 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 1136 Query: 357 cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 416 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct: 1135 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 1076 Query: 417 tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 476 ||||||||| ||||| || ||||||||||| ||||||||||||| ||| |||||||| | Sbjct: 1075 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 1016 Query: 477 gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 536 ||||||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| Sbjct: 1015 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 956 Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 | ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct: 955 tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 896 Query: 597 cagccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaata 656 |||| || ||||||||||| || |||||||| |||||||||||||||||||| ||||||| Sbjct: 895 cagcaccagtctgagcatcaaaacgagcagttgctatagcatcaacctcatcgatgaata 836 Query: 657 ttatagc 663 | ||||| Sbjct: 835 tgatagc 829
>dbj|AB070253.1| Oryza sativa (japonica cultivar-group) OsRPT3 mRNA for 26S proteasome regulatory particle triple-A ATPase subunit3, partial cds Length = 1375 Score = 656 bits (331), Expect = 0.0 Identities = 448/487 (91%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1114 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1055 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 1054 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 995 Query: 297 cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 356 |||| || || ||||||| |||||||||||||| |||||||| |||||||| ||||||| Sbjct: 994 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 935 Query: 357 cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 416 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct: 934 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 875 Query: 417 tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 476 ||||||||| ||||| || ||||||||||| ||||||||||||| ||| |||||||| | Sbjct: 874 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 815 Query: 477 gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 536 ||||||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| Sbjct: 814 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 755 Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 | ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct: 754 tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaacttctcggt 695 Query: 597 cagccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaata 656 |||| || ||||||||||| || |||||||| |||||||||||||||||||| ||||||| Sbjct: 694 cagcaccagtctgagcatcaaaacgagcagttgctatagcatcaacctcatcgatgaata 635 Query: 657 ttatagc 663 | ||||| Sbjct: 634 tgatagc 628
>dbj|AK059237.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-F02, full insert sequence Length = 1293 Score = 648 bits (327), Expect = 0.0 Identities = 447/487 (91%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 1066 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 1007 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 1006 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 947 Query: 297 cttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataat 356 |||| || || ||||||| |||||||||||||| |||||||| |||||||| ||||||| Sbjct: 946 cttcttgacagatagcagcaatatcagcagcactaattttatctggtctggaaacataat 887 Query: 357 cttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcc 416 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct: 886 cttccaaatcaacctcatcactcaagttcattttagcagtacagacttggaaaacaagcc 827 Query: 417 tcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgca 476 ||||||||| ||||| || ||||||||||| ||||||||||||| ||| |||||||| | Sbjct: 826 tcttctgccgacgatctggaagagggaactcgattttcctgtccaatctacctggacgta 767 Query: 477 gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 536 ||||||||| ||||| ||||| |||| ||||| ||||||||||||||||||||||||| Sbjct: 766 acagagcagggtctagggtatccgccctgttggtcgccattataaccttcacattcactg 707 Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 | ||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||| Sbjct: 706 tttgatcaaatccatccatctgattgagtagttccataagaatacgctgaactcctcggt 647 Query: 597 cagccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaata 656 |||| || ||||||||||| || |||||||| |||||||||||||||||||| ||||||| Sbjct: 646 cagcaccagtctgagcatcaaaacgagcagttgctatagcatcaacctcatcgatgaata 587 Query: 657 ttatagc 663 | ||||| Sbjct: 586 tgatagc 580
>gb|AY530962.1| Zea mays 26S proteasome regulatory complex ATPase RPT3 mRNA, complete cds Length = 1251 Score = 573 bits (289), Expect = e-160 Identities = 430/477 (90%) Strand = Plus / Minus Query: 178 gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 237 |||| ||||||||||||| |||||||||| ||| |||||||| || ||||||||||| || Sbjct: 1068 gttgactcatttgtagaaatcaaagtctgtctcgggcttcttcacgttggttcggtagcc 1009 Query: 238 cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 297 ||| || ||||||||||||||||| ||||| || |||||||||||||||||||||||||| Sbjct: 1008 cttttcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 949 Query: 298 ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 357 || ||||| ||||||| ||||||||||||||||| ||||| |||||||| |||||||| Sbjct: 948 ctcttggcagatagcagcaatatcagcagcactgatcttatccggtctggaaacataatc 889 Query: 358 ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 417 |||||||||||||||||| |||| |||||| || ||||| |||||||| ||||||||||| Sbjct: 888 ttccaaatcaacctcatcgctcaggttcattttggcagtgcaaacttgaaaaacaagcct 829 Query: 418 cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 477 |||||| | ||| || |||||||||||||||||||||||||| ||||| || ||||||| Sbjct: 828 cttctgacgccggtctggcagagggaactcaattttcctgtcaagtctaccaggacgcaa 769 Query: 478 cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 537 || ||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 768 caaagcaggatctagagtgtctgcccgattagttgccattataaccttcacattgactgt 709 Query: 538 ctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 597 |||||||| |||||||||||||| ||||| ||||| ||||||||||||||||||||||| Sbjct: 708 ttgatcaaacccatccatctgattgagtagctccataagaatacgctgaacttctcggtc 649 Query: 598 agccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaa 654 ||| || ||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 648 agcaccagtctgagcatcaaaacgagcagtggctatagcatcaacctcatcaatgaa 592
>gb|AY104317.1| Zea mays PCO132144 mRNA sequence Length = 1654 Score = 559 bits (282), Expect = e-156 Identities = 430/478 (89%), Gaps = 1/478 (0%) Strand = Plus / Minus Query: 178 gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 237 |||| ||||||||||||| |||||||||| ||| |||||||| || ||||||||||| || Sbjct: 1379 gttgactcatttgtagaaatcaaagtctgtctcgggcttcttcacgttggttcggtagcc 1320 Query: 238 cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 297 ||| || ||||||||||||||||| ||||| || |||||||||||||||||||||||||| Sbjct: 1319 cttttcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 1260 Query: 298 ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 357 || ||||| ||||||| ||||||||||||||||| ||||| |||||||| |||||||| Sbjct: 1259 ctcttggcagatagcagcaatatcagcagcactgatcttatccggtctggaaacataatc 1200 Query: 358 ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 417 |||||||||||||||||| |||| |||||| || ||||| |||||||| ||||||||||| Sbjct: 1199 ttccaaatcaacctcatcgctcaggttcattttggcagtgcaaacttgaaaaacaagcct 1140 Query: 418 cttctgcctccgatccggc-agagggaactcaattttcctgtccagtcttcctggacgca 476 |||||| | ||| || ||| ||||||||||||||||||||||| ||||| || ||||||| Sbjct: 1139 cttctgacgccggtctggccagagggaactcaattttcctgtcaagtctaccaggacgca 1080 Query: 477 gcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactg 536 || ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||| Sbjct: 1079 acaaagcaggatctagagtgtctgcccgattagttgccattataaccttcacattgactg 1020 Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 | |||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||||| Sbjct: 1019 tttgatcaaacccatccatctgattgagtagctccataagaatacgctgaacttctcggt 960 Query: 597 cagccccggtctgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaa 654 |||| || ||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 959 cagcaccagtctgagcatcaaaacgagcagtggctatagcatcaacctcatcaatgaa 902
>gb|BT016898.1| Zea mays clone Contig731 mRNA sequence Length = 1066 Score = 452 bits (228), Expect = e-124 Identities = 354/396 (89%) Strand = Plus / Minus Query: 178 gttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacc 237 |||||||||||||||||| || ||||| | ||||||||| || || ||||||||||| || Sbjct: 397 gttgcctcatttgtagaaatcgaagtccgtctcaggctttttcacgttggttcggtagcc 338 Query: 238 cttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccagc 297 |||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||| Sbjct: 337 cttctcaaagtccttggggaggatgacatatcggtttttgcggacagcatgcatgccagc 278 Query: 298 ttcctggcaaatagcagtgatatcagcagcactgattttatcaggtctggagacataatc 357 ||| || || ||||||| ||||||||||||||||| ||||| |||||||| ||||| || Sbjct: 277 ttcttgacagatagcagcaatatcagcagcactgatcttatccggtctggaaacatagtc 218 Query: 358 ttccaaatcaacctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcct 417 ||||||||||||||| ||||||| |||||| || ||||| || ||||||||||||||||| Sbjct: 217 ttccaaatcaacctcgtcactcaggttcattttggcagtgcagacttggaaaacaagcct 158 Query: 418 cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 477 |||||| | ||| || |||| ||||||||||||||||||||| ||||| || ||||||| Sbjct: 157 cttctgacgccggtctggcaaagggaactcaattttcctgtcaagtctaccaggacgcaa 98 Query: 478 cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 537 |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 97 cagagcaggatctagagtgtctgcccgattagttgccattataaccttcacattcactgt 38 Query: 538 ctgatcaaatccatccatctgattcagtagttccat 573 |||||||| |||||||||||||| ||||| ||||| Sbjct: 37 ttgatcaaacccatccatctgattgagtagctccat 2
>emb|AJ006095.1|CAR6095 Cicer arietinum mRNA for putative 26S protease regulatory subunit 6, partial Length = 763 Score = 297 bits (150), Expect = 2e-77 Identities = 390/470 (82%) Strand = Plus / Minus Query: 188 ttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacccttctcgaag 247 ||||| || |||||||| | ||||||||||| ||||| || | |||||||||||||||| Sbjct: 531 ttgtaaaattcaaagtccgtatcaggcttcttcacatttgtcctgtaacccttctcgaag 472 Query: 248 tccttggggaggataacataccgatttttgcggacagcatgcatgccagcttcctggcaa 307 ||||| || || || ||||| | ||| || || ||||||||||| || ||||| || ||| Sbjct: 471 tccttcggcagtatgacatatctattcttacgaacagcatgcattcctgcttcttgacaa 412 Query: 308 atagcagtgatatcagcagcactgattttatcaggtctggagacataatcttccaaatca 367 ||||||| || ||||||||||| ||||| ||||| | ||| |||||||| |||| || Sbjct: 411 atagcagatatctcagcagcactaattttgtcaggacgggaaacataatcctccaggtcc 352 Query: 368 acctcatcactcaagttcatcttagcagtacaaacttggaaaacaagcctcttctgcctc 427 |||||||||||||||||||| || || || ||||| || || ||||||||||| |||| Sbjct: 351 acctcatcactcaagttcattttggctgtgcaaacctgaaatacaagcctcttttgccgt 292 Query: 428 cgatccggcagagggaactcaattttcctgtccagtcttcctggacgcagcagagcagga 487 | ||| |||| ||||||||||||||| | || || ||||| ||||||| || |||||| Sbjct: 291 ctatcaggcaaagggaactcaattttgcgatcaagccttccaggacgcaagagggcagga 232 Query: 488 tctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatcaaat 547 || | ||| ||||||||||||||||||||||| ||||| ||||||||||||||||| || Sbjct: 231 tccaaagtgtctgcccgattggttgccattatgaccttaacattcactgtctgatcgaaa 172 Query: 548 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtc 607 |||||||||||||||| |||||||| || ||||| || ||||||| |||||| || || Sbjct: 171 ccatccatctgattcaaaagttccatgaggatacgttgtacttctctgtcagctccagtt 112 Query: 608 tgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaatat 657 || ||||| || | |||||| ||||| ||||||||||||||||| ||||| Sbjct: 111 tgggcatcaaacctagcagtagctatcgcatcaacctcatcaataaatat 62
>gb|BT012705.1| Lycopersicon esculentum clone 113583F, mRNA sequence Length = 1608 Score = 234 bits (118), Expect = 3e-58 Identities = 364/446 (81%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| |||||||| | ||||||||| || |||||||||||||| || ||||| ||| Sbjct: 1269 ggcttcttcacattggtcctgtaacccttttcaaagtccttggggagtatgacatatcga 1210 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| || |||||||| || ||||| | || ||||||||||| Sbjct: 1209 ttctttcgcactgcatgcatacctgcttcctgacatatagctgcaatctcagcagcacta 1150 Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||||||||| | || |||||||||||||| |||||||| |||| |||||||||||| Sbjct: 1149 attttatcagggcgagaaacataatcttccaagtcaacctcgtcacctaagttcatctta 1090 Query: 392 gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 451 |||||||| || || |||||||||||||| || | || ||| |||| ||| || ||||| Sbjct: 1089 gcagtacagacctgaaaaacaagcctcttttgacgcctatcaggcaaaggaaattcaatc 1030 Query: 452 ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 511 |||| || || ||||| |||||||| || |||||||| | |||||| || | || ||| Sbjct: 1029 ttccgatcaagccttccaggacgcagaagtgcaggatccaaagtatcagctctgttagtt 970 Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| ||||| ||||||||||| ||||| |||||||||||||| ||||| || | ||| Sbjct: 969 gccatgataactttcacattcacagtctggtcaaatccatccatttgattaagcaactcc 910 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggct 631 |||| |||||||| || || | ||||| || || |||||||| || | |||||||| Sbjct: 909 atcaagatacgctggacctccctatcagctccagtttgagcatcaaacctcgcagtggca 850 Query: 632 atagcatcaacctcatcaatgaatat 657 || ||||| ||||||||||| ||||| Sbjct: 849 attgcatctacctcatcaataaatat 824
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 218 bits (110), Expect = 2e-53 Identities = 131/138 (94%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 13062628 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 13062569 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 13062568 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 13062509 Query: 297 cttcctggcaaatagcag 314 |||| || || ||||||| Sbjct: 13062508 cttcttgacagatagcag 13062491 Score = 186 bits (94), Expect = 6e-44 Identities = 142/158 (89%) Strand = Plus / Minus Query: 401 acttggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtcc 460 ||||||||||||||||||||||||| ||||| || ||||||||||| |||||||||||| Sbjct: 13060637 acttggaaaacaagcctcttctgccgacgatctggaagagggaactcgattttcctgtcc 13060578 Query: 461 agtcttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattata 520 | ||| |||||||| | ||||||||| ||||| ||||| |||| ||||| ||||||||| Sbjct: 13060577 aatctacctggacgtaacagagcagggtctagggtatccgccctgttggtcgccattata 13060518 Query: 521 accttcacattcactgtctgatcaaatccatccatctg 558 ||||||||||||||||| |||||||||||||||||||| Sbjct: 13060517 accttcacattcactgtttgatcaaatccatccatctg 13060480 Score = 143 bits (72), Expect = 8e-31 Identities = 99/108 (91%) Strand = Plus / Minus Query: 556 ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 |||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||| Sbjct: 13060241 ctgattgagtagttccataagaatacgctgaacttctcggtcagcaccagtctgagcatc 13060182 Query: 616 gaatcgagcagtggctatagcatcaacctcatcaatgaatattatagc 663 || |||||||| |||||||||||||||||||| |||||||| ||||| Sbjct: 13060181 aaaacgagcagttgctatagcatcaacctcatcgatgaatatgatagc 13060134 Score = 133 bits (67), Expect = 8e-28 Identities = 85/91 (93%) Strand = Plus / Minus Query: 319 atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 378 |||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 13061702 atcagcagcactaattttatctggtctggaaacataatcttccaaatcaacctcatcact 13061643 Query: 379 caagttcatcttagcagtacaaacttggaaa 409 ||||||||| ||||||||||| || |||||| Sbjct: 13061642 caagttcattttagcagtacagacctggaaa 13061612 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagtagttccatcag 576 |||||||||||| | |||||| || ||||||||||| Sbjct: 5597004 atcaaatccatctaactgatttagcagttccatcag 5597039
>dbj|AP004789.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0476C12 Length = 157570 Score = 218 bits (110), Expect = 2e-53 Identities = 131/138 (94%) Strand = Plus / Minus Query: 177 tgttgcctcatttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaac 236 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 39205 tgttgcctcatttgtagaagtcaaagtcagtctcaggcttcttgacattggttcggtaac 39146 Query: 237 ccttctcgaagtccttggggaggataacataccgatttttgcggacagcatgcatgccag 296 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| Sbjct: 39145 ccttctcgaagtccttggggaggataacataccgatttttgcgcacagcatgcataccag 39086 Query: 297 cttcctggcaaatagcag 314 |||| || || ||||||| Sbjct: 39085 cttcttgacagatagcag 39068 Score = 186 bits (94), Expect = 6e-44 Identities = 142/158 (89%) Strand = Plus / Minus Query: 401 acttggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtcc 460 ||||||||||||||||||||||||| ||||| || ||||||||||| |||||||||||| Sbjct: 37214 acttggaaaacaagcctcttctgccgacgatctggaagagggaactcgattttcctgtcc 37155 Query: 461 agtcttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattata 520 | ||| |||||||| | ||||||||| ||||| ||||| |||| ||||| ||||||||| Sbjct: 37154 aatctacctggacgtaacagagcagggtctagggtatccgccctgttggtcgccattata 37095 Query: 521 accttcacattcactgtctgatcaaatccatccatctg 558 ||||||||||||||||| |||||||||||||||||||| Sbjct: 37094 accttcacattcactgtttgatcaaatccatccatctg 37057 Score = 143 bits (72), Expect = 8e-31 Identities = 99/108 (91%) Strand = Plus / Minus Query: 556 ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 |||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||| Sbjct: 36818 ctgattgagtagttccataagaatacgctgaacttctcggtcagcaccagtctgagcatc 36759 Query: 616 gaatcgagcagtggctatagcatcaacctcatcaatgaatattatagc 663 || |||||||| |||||||||||||||||||| |||||||| ||||| Sbjct: 36758 aaaacgagcagttgctatagcatcaacctcatcgatgaatatgatagc 36711 Score = 133 bits (67), Expect = 8e-28 Identities = 85/91 (93%) Strand = Plus / Minus Query: 319 atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 378 |||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 38279 atcagcagcactaattttatctggtctggaaacataatcttccaaatcaacctcatcact 38220 Query: 379 caagttcatcttagcagtacaaacttggaaa 409 ||||||||| ||||||||||| || |||||| Sbjct: 38219 caagttcattttagcagtacagacctggaaa 38189
>ref|NM_125214.4| Arabidopsis thaliana RPT3; ATPase AT5G58290 (RPT3) mRNA, complete cds Length = 1518 Score = 214 bits (108), Expect = 3e-52 Identities = 366/452 (80%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1276 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1217 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1216 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1157 Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||||||||| | || ||||| |||||||| ||||||||||| || | |||||| || Sbjct: 1156 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1097 Query: 392 gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 451 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1096 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1037 Query: 452 ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 511 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || ||| Sbjct: 1036 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 977 Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 976 gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 917 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggct 631 || ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 916 atgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagcg 857 Query: 632 atagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 856 atggcatctacctcatcaatgaagatgatagc 825
>gb|BT020373.1| Arabidopsis thaliana At5g58290 gene, complete cds Length = 1227 Score = 214 bits (108), Expect = 3e-52 Identities = 366/452 (80%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1199 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1140 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1139 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1080 Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||||||||| | || ||||| |||||||| ||||||||||| || | |||||| || Sbjct: 1079 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1020 Query: 392 gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 451 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1019 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 960 Query: 452 ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 511 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || ||| Sbjct: 959 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 900 Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 899 gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 840 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggct 631 || ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 839 atgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagcg 780 Query: 632 atagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 779 atggcatctacctcatcaatgaagatgatagc 748
>gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds Length = 1950 Score = 214 bits (108), Expect = 3e-52 Identities = 366/452 (80%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1715 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1656 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1655 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1596 Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||||||||| | || ||||| |||||||| ||||||||||| || | |||||| || Sbjct: 1595 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1536 Query: 392 gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 451 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1535 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1476 Query: 452 ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 511 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || ||| Sbjct: 1475 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 1416 Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 1415 gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 1356 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggct 631 || ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 1355 atgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagcg 1296 Query: 632 atagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 1295 atggcatctacctcatcaatgaagatgatagc 1264
>gb|AF123392.1|AF123392 Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, complete cds Length = 1301 Score = 214 bits (108), Expect = 3e-52 Identities = 366/452 (80%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1240 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1181 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1180 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1121 Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||||||||| | || ||||| |||||||| ||||||||||| || | |||||| || Sbjct: 1120 attttatcaggccgtgaaacatagtcttccaagtcaacctcatcgctaaggttcattttg 1061 Query: 392 gcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaatt 451 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1060 gaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatc 1001 Query: 452 ttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggtt 511 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || ||| Sbjct: 1000 ttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgtt 941 Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 |||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || ||| Sbjct: 940 gccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctcc 881 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggct 631 || ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 880 atgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagcg 821 Query: 632 atagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 820 atggcatctacctcatcaatgaagatgatagc 789
>emb|BX831143.1|CNS09ZD2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS60ZH10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1426 Score = 200 bits (101), Expect = 4e-48 Identities = 366/453 (80%), Gaps = 1/453 (0%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1250 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1191 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1190 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1131 Query: 332 attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 390 ||||||||||| | || || ||| |||||||| ||||||||||| || | |||||| || Sbjct: 1130 attttatcaggccgtgaaacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1071 Query: 391 agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 450 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1070 ggaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaat 1011 Query: 451 tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 510 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || || Sbjct: 1010 cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 951 Query: 511 tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 570 ||||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || || Sbjct: 950 tgccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctc 891 Query: 571 catcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggc 630 ||| ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 890 catgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagc 831 Query: 631 tatagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 830 gatggcatctacctcatcaatgaagatgatagc 798
>emb|BX831136.1|CNS09ZEE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS60ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1414 Score = 200 bits (101), Expect = 4e-48 Identities = 366/453 (80%), Gaps = 1/453 (0%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1230 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1171 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1170 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1111 Query: 332 attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 390 ||||||||||| | || || ||| |||||||| ||||||||||| || | |||||| || Sbjct: 1110 attttatcaggccgtgaaacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1051 Query: 391 agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 450 | || || || ||||||||||||||||| || | | ||| || || ||||||||||| Sbjct: 1050 ggaggtgcatacctggaaaacaagcctcttttgacgtctatcaggaagggggaactcaat 991 Query: 451 tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 510 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || || Sbjct: 990 cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 931 Query: 511 tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 570 ||||||||| ||||| |||||||| ||||| |||||||||||||||||||| || || || Sbjct: 930 tgccattatgaccttgacattcacggtctggtcaaatccatccatctgattaagaagctc 871 Query: 571 catcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggc 630 ||| ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 870 catgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagc 811 Query: 631 tatagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 810 gatggcatctacctcatcaatgaagatgatagc 778
>emb|BX831437.1|CNS09ZEY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS90ZD08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1389 Score = 192 bits (97), Expect = 1e-45 Identities = 365/453 (80%), Gaps = 1/453 (0%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 1305 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 1246 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactg 331 || || || || |||||||| ||||||||||||||||| || | || |||||||| || Sbjct: 1245 ttctttcgcaccgcatgcataccagcttcctggcaaattgctgctatctcagcagcgcta 1186 Query: 332 attttatcaggtctggagac-ataatcttccaaatcaacctcatcactcaagttcatctt 390 ||||||||||| | ||||| ||| |||||||| ||||||||||| || | |||||| || Sbjct: 1185 attttatcaggccgtgagacgatagtcttccaagtcaacctcatcgctaaggttcatttt 1126 Query: 391 agcagtacaaacttggaaaacaagcctcttctgcctccgatccggcagagggaactcaat 450 | || || || |||||||| |||||||| || | | ||| || || ||||||||||| Sbjct: 1125 ggaggtgcatacctggaaaacgagcctcttttgacgtctatcaggaagggggaactcaat 1066 Query: 451 tttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattggt 510 || | || |||||||| ||||| | ||||||||||||||||| ||||||| || || Sbjct: 1065 cttacgatcaagtcttccaggacgtaagagagcaggatctagagtgtctgccctgtttgt 1006 Query: 511 tgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttc 570 ||||||||| ||||| |||||||| ||||| ||| |||||||||||||||| || || || Sbjct: 1005 tgccattatgaccttgacattcacggtctggtcagatccatccatctgattgagaagctc 946 Query: 571 catcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagcagtggc 630 ||| ||||||||||||||||| | || || || || |||||||| || | |||||| || Sbjct: 945 catgagaatacgctgaacttccctatcggctcctgtttgagcatcaaacctagcagtagc 886 Query: 631 tatagcatcaacctcatcaatgaatattatagc 663 || ||||| |||||||||||||| || ||||| Sbjct: 885 gatggcatctacctcatcaatgaagatgatagc 853
>gb|U43398.1|STU43398 Solanum tuberosum POTATP1 mRNA, complete cds Length = 1473 Score = 155 bits (78), Expect = 2e-34 Identities = 174/206 (84%) Strand = Plus / Minus Query: 188 ttgtagaagtcaaagtctgactcaggcttcttgacattggttcggtaacccttctcgaag 247 |||||||| |||||||| | ||||||||||| || || || | ||||||||| || ||| Sbjct: 1260 ttgtagaattcaaagtcagtgtcaggcttcttcacgtttgtcctgtaacccttttcaaag 1201 Query: 248 tccttggggaggataacataccgatttttgcggacagcatgcatgccagcttcctggcaa 307 ||||| || ||||| ||||| ||||| ||||| || |||||||| |||||||| || || Sbjct: 1200 tcctttggaaggatgacatatcgattcttgcgcactgcatgcataccagcttcttgacag 1141 Query: 308 atagcagtgatatcagcagcactgattttatcaggtctggagacataatcttccaaatca 367 ||||| || || ||||||||||||||||||||||| | || |||||||||||||| ||| Sbjct: 1140 atagccgtaatctcagcagcactgattttatcagggcgagaaacataatcttccaagtca 1081 Query: 368 acctcatcactcaagttcatcttagc 393 |||||||||| |||||||||||||| Sbjct: 1080 acctcatcacctaagttcatcttagc 1055 Score = 125 bits (63), Expect = 2e-25 Identities = 126/147 (85%) Strand = Plus / Minus Query: 505 attggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcag 564 |||||||||||| ||||| |||||||||||||| || ||||| |||||||||||||| || Sbjct: 943 attggttgccataataactttcacattcactgtttggtcaaacccatccatctgatttag 884 Query: 565 tagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatcgagc 624 ||| ||||| || |||||||| || |||| ||||| || ||||||||||| || | ||| Sbjct: 883 tagctccatgaggatacgctggacctctctatcagctccagtctgagcatcaaacctagc 824 Query: 625 agtggctatagcatcaacctcatcaat 651 ||| || || ||||||||||||||||| Sbjct: 823 agtagcaattgcatcaacctcatcaat 797
>dbj|AK117042.1| Ciona intestinalis cDNA, clone:cits021e02, full insert sequence Length = 1474 Score = 125 bits (63), Expect = 2e-25 Identities = 251/311 (80%), Gaps = 2/311 (0%) Strand = Plus / Minus Query: 263 acataccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatca 322 |||||||| |||| || || ||| ||||||| ||||| |||||||| ||| | |||||| Sbjct: 1219 acataccggttttcacgaactgcaagcatgcctgcttcttggcaaattgcatttatatca 1160 Query: 323 gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 382 ||| || ||||||| ||||||| || ||||||||||||||||| || ||||| || | | Sbjct: 1159 gcaccagtgattttgtcaggtcgggcaacataatcttccaaatccacttcatcgctgagg 1100 Query: 383 ttcatcttagcagtacaaacttg-gaaaacaagcctcttctgcctccgatccggcagagg 441 |||||||| ||||| | | | | ||| || || | |||||| ||||||||||| || || Sbjct: 1099 ttcatcttcccagta-atagtggagaagacgagacgcttctgtctccgatccggaagcgg 1041 Query: 442 gaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgc 501 ||| ||||| |||| ||||| | || |||||||||||||||||||| || || || || Sbjct: 1040 gaattcaatcttccgatccagacgaccaggacgcagcagagcaggatcgagcgtgtcagc 981 Query: 502 ccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctgatt 561 || ||||| ||||| |||||||| ||||| || || ||||| || ||||||||||| || Sbjct: 980 tcggttggtggccataataaccttaacattaacagtttgatcgaagccatccatctggtt 921 Query: 562 cagtagttcca 572 |||||||||| Sbjct: 920 aagtagttcca 910
>dbj|AB019228.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7 Length = 87090 Score = 107 bits (54), Expect = 5e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 404 tggaaaacaagcctcttctgcctccgatccggcagagggaactcaattttcctgtccagt 463 ||||||||||||||||| || | | ||| || || ||||||||||| || | || ||| Sbjct: 43576 tggaaaacaagcctcttttgacgtctatcaggaagggggaactcaatcttacgatcaagt 43517 Query: 464 cttcctggacgcagcagagcaggatctagagtatctgcccgattggttgccattataacc 523 ||||| ||||| | ||||||||||||||||| ||||||| || ||||||||||| ||| Sbjct: 43516 cttccaggacgtaagagagcaggatctagagtgtctgccctgtttgttgccattatgacc 43457 Query: 524 ttcacattcactgtctgatcaaatccatccatct 557 || |||||||| ||||| |||||||||||||||| Sbjct: 43456 ttgacattcacggtctggtcaaatccatccatct 43423 Score = 56.0 bits (28), Expect = 2e-04 Identities = 88/108 (81%) Strand = Plus / Minus Query: 556 ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 |||||| || || ||||| ||||||||||||||||| | || || || || |||||||| Sbjct: 43324 ctgattaagaagctccatgagaatacgctgaacttccctatcggctcctgtttgagcatc 43265 Query: 616 gaatcgagcagtggctatagcatcaacctcatcaatgaatattatagc 663 || | |||||| || || ||||| |||||||||||||| || ||||| Sbjct: 43264 aaacctagcagtagcgatggcatctacctcatcaatgaagatgatagc 43217 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| ||||| | ||||| ||||||||||| ||||| || || || ||||| | Sbjct: 44216 ggcttcttaacatttgcgcggtagcccttctcgaaatccttaggtagtatcacatatctg 44157 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaat 309 || || || || |||||||| ||||||||||||||||| Sbjct: 44156 ttctttcgcaccgcatgcataccagcttcctggcaaat 44119 Score = 48.1 bits (24), Expect = 0.037 Identities = 48/56 (85%) Strand = Plus / Minus Query: 320 tcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatc 375 |||||||| || ||||||||||| | || ||||| |||||||| ||||||||||| Sbjct: 43785 tcagcagcgctaattttatcaggccgtgaaacatagtcttccaagtcaacctcatc 43730
>dbj|AK174288.1| Ciona intestinalis cDNA, clone:cicl025a20, full insert sequence Length = 1481 Score = 93.7 bits (47), Expect = 7e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 418 cttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacgcag 477 |||||| ||||||||||| || ||||| ||||| |||| ||||| | || |||||||| Sbjct: 1071 cttctgtctccgatccggaagcgggaattcaatcttccgatccagacgaccaggacgcag 1012 Query: 478 cagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgt 537 |||||||||||| || || || || || ||||| ||||| |||||||| ||||| || || Sbjct: 1011 cagagcaggatcgagcgtgtcagctcggttggtggccataataaccttaacattaacagt 952 Query: 538 ctgatcaaatccatccatctgattcagtagttcca 572 ||||| || ||||||||||| || |||||||||| Sbjct: 951 ttgatcgaagccatccatctggttaagtagttcca 917 Score = 87.7 bits (44), Expect = 4e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 263 acataccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgatatca 322 |||||||| |||| || || ||| ||||||| ||||| |||||||| ||| | |||||| Sbjct: 1226 acataccggttttcacgaactgcaagcatgcctgcttcttggcaaattgcatttatatca 1167 Query: 323 gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 382 ||| || ||||||| |||||||||| ||||||||||||||||| || ||||| || | | Sbjct: 1166 gcaccagtgattttgtcaggtctggcaacataatcttccaaatccacttcatcgctgagg 1107 Query: 383 ttcatctt 390 |||||||| Sbjct: 1106 ttcatctt 1099
>gb|AY112326.1| Zea mays CL40761_1 mRNA sequence Length = 1098 Score = 93.7 bits (47), Expect = 7e-16 Identities = 71/79 (89%) Strand = Plus / Plus Query: 319 atcagcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcact 378 ||||| ||||||||| ||||| |||||| | |||||||||||||||||| |||||||||| Sbjct: 575 atcagtagcactgatcttatccggtctgcaaacataatcttccaaatcagcctcatcact 634 Query: 379 caagttcatcttagcagta 397 ||| | ||||||||||||| Sbjct: 635 caaatccatcttagcagta 653
>dbj|AK153991.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430019J12 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1409 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1058 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 999 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 998 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 939 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 938 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 879 Query: 620 c 620 | Sbjct: 878 c 878
>dbj|AK167528.1| Mus musculus 13 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530018N08 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1380 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1030 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 971 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 970 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 911 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 910 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 851 Query: 620 c 620 | Sbjct: 850 c 850
>dbj|AK160718.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched library, clone:3010086G18 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1375 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1029 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 970 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 969 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 910 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 909 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 850 Query: 620 c 620 | Sbjct: 849 c 849
>dbj|AK160644.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2810035H13 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1382 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1037 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 978 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 977 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 918 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 917 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 858 Query: 620 c 620 | Sbjct: 857 c 857
>dbj|AK167041.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0028L02 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1374 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1020 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 961 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 960 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 901 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 900 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 841 Query: 620 c 620 | Sbjct: 840 c 840
>dbj|AK169224.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920092H04 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1388 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1038 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 979 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 978 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 919 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 918 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 859 Query: 620 c 620 | Sbjct: 858 c 858
>dbj|AK077507.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730428I01 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1388 Score = 89.7 bits (45), Expect = 1e-14 Identities = 147/181 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1038 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 979 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 978 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 919 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 918 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 859 Query: 620 c 620 | Sbjct: 858 c 858
>ref|NM_001008009.1| Xenopus tropicalis rpt3 protein (rpt3), mRNA Length = 1567 Score = 87.7 bits (44), Expect = 4e-14 Identities = 143/176 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| || ||||||||||| || | || ||||||||||| || |||||||| || ||| Sbjct: 1185 gggaattctattttcctgtcgagacgcccgggacgcagcagtgccggatctagtgtgtct 1126 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 ||||| ||||| ||||| || ||||| |||||||| |||| |||||||| |||||||| Sbjct: 1125 gcccggttggtggccatgattacctttacattcacgttctggtcaaatccgtccatctgg 1066 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 || || || |||| |||||| ||||| || || ||||| || || ||||| ||||| Sbjct: 1065 ttaaggagctccagcagaattcgctgcacctcgcggtcggctcctgtctgggcatc 1010
>gb|BC080888.1| Xenopus tropicalis rpt3 protein, mRNA (cDNA clone MGC:79492 IMAGE:6976743), complete cds Length = 1567 Score = 87.7 bits (44), Expect = 4e-14 Identities = 143/176 (81%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| || ||||||||||| || | || ||||||||||| || |||||||| || ||| Sbjct: 1185 gggaattctattttcctgtcgagacgcccgggacgcagcagtgccggatctagtgtgtct 1126 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 ||||| ||||| ||||| || ||||| |||||||| |||| |||||||| |||||||| Sbjct: 1125 gcccggttggtggccatgattacctttacattcacgttctggtcaaatccgtccatctgg 1066 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 || || || |||| |||||| ||||| || || ||||| || || ||||| ||||| Sbjct: 1065 ttaaggagctccagcagaattcgctgcacctcgcggtcggctcctgtctgggcatc 1010
>ref|NM_153001.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 2, mRNA Length = 1363 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 939 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 880 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 879 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 820 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 819 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 765
>ref|NM_006503.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, mRNA Length = 1450 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1032 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 973 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 972 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 913 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 912 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 858
>gb|BC010396.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant 2, mRNA (cDNA clone MGC:13687 IMAGE:4046205), complete cds Length = 1363 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 939 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 880 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 879 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 820 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 819 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 765
>gb|BC014488.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant 1, mRNA (cDNA clone MGC:23214 IMAGE:4899042), complete cds Length = 1433 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 955 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 895 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 841
>gb|BC000343.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant 1, mRNA (cDNA clone MGC:8570 IMAGE:2823007), complete cds Length = 1426 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 955 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 895 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 841
>gb|BT008218.1| Synthetic construct Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 mRNA, partial cds Length = 1257 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 821
>gb|BT007232.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 mRNA, complete cds Length = 1257 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 821
>emb|CR624768.1| full-length cDNA clone CS0DB003YP08 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1094 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 709 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 650 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 649 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 590 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 589 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 535
>emb|CR624681.1| full-length cDNA clone CS0DI024YO05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1392 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1012 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 953 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 952 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 893 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 892 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 838
>emb|CR621309.1| full-length cDNA clone CS0DD009YP22 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1375 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1009 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 950 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 949 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 890 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 889 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 835
>emb|CR619473.1| full-length cDNA clone CS0DH005YK15 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1393 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 968 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 908 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 854
>emb|CR616731.1| full-length cDNA clone CS0DI027YF12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1374 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 955 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 895 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 841
>emb|CR607304.1| full-length cDNA clone CS0DI054YC02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1371 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 968 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 908 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 854
>emb|CR606858.1| full-length cDNA clone CS0DI008YH10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1355 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1005 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 946 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 945 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 886 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 885 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 831
>emb|CR604327.1| full-length cDNA clone CS0DE011YH14 of Placenta of Homo sapiens (human) Length = 1403 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1027 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 968 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 967 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 908 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 907 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 853
>emb|CR603370.1| full-length cDNA clone CS0DI020YH15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1351 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1027 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 968 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 967 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 908 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 907 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 853
>emb|CR602157.1| full-length cDNA clone CS0DI077YD19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1387 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1011 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 952 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 951 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 892 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 891 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 837
>emb|CR597394.1| full-length cDNA clone CS0DJ014YC04 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1414 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1028 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 969 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 968 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 909 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 908 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 854
>emb|CR594223.1| full-length cDNA clone CS0DJ006YJ24 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1351 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1014 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 955 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 954 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 895 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 894 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 840
>emb|CR591096.1| full-length cDNA clone CS0DB007YG13 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1385 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1005 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 946 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 945 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 886 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 885 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 831
>ref|XM_942509.1| PREDICTED: Homo sapiens similar to 26S protease regulatory subunit 6B (MIP224) (MB67-interacting protein) (TAT-binding protein 7) (TBP-7) (LOC652826), mRNA Length = 1396 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 983 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 924 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 923 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 864 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 863 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 809
>gb|AF038965.1| Homo sapiens 26S proteasome ATPase subunit mRNA, complete cds Length = 1439 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1017 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 958 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 957 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 898 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 897 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 843
>gb|AY891402.1| Synthetic construct Homo sapiens clone FLH025948.01L proteasome 26S subunit 4 (PSMC4) mRNA, partial cds Length = 1257 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 821
>gb|AY891401.1| Synthetic construct Homo sapiens clone FLH025947.01L proteasome 26S subunit 4 (PSMC4) mRNA, partial cds Length = 1257 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 821
>gb|AY888748.1| Synthetic construct Homo sapiens clone FLH025951.01X proteasome 26S subunit 4 (PSMC4) mRNA, complete cds Length = 1257 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 995 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 936 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 935 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 876 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 875 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 821
>gb|U27515.1|HSU27515 Human MIP224 (MIP224) mRNA, complete cds Length = 1425 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1007 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 948 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 947 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 888 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 887 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 833
>gb|AF020736.1|AF020736 Homo sapiens ATPase homolog mRNA, complete cds Length = 1463 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1035 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 976 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 975 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 916 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 915 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 861
>gb|BC018811.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant 1, mRNA (cDNA clone IMAGE:2961362) Length = 1426 Score = 85.7 bits (43), Expect = 2e-13 Identities = 142/175 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1015 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 956 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 955 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcagc 896 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 895 agctccagcaggatcctctgaacctccctgtcggcccctgtctgagcatcgaatc 841
>ref|XM_452488.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C06534g predicted mRNA Length = 1287 Score = 83.8 bits (42), Expect = 7e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 544 |||||||||||||| || |||||||||||||||||||| || ||||| || ||||||| Sbjct: 977 ggatctagagtatcagcacgattggttgccattataactttaacatttgttgactgatca 918 Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 || |||||||| ||| | |||| || |||| ||||| || ||||| || |||| ||| Sbjct: 917 aaaccatccatttgagtaagtaactcaatcaatatacgttggacttcacgatcagaccct 858 Query: 605 gtctgagcatcgaa 618 |||||||||||||| Sbjct: 857 gtctgagcatcgaa 844
>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1753957 Score = 83.8 bits (42), Expect = 7e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 544 |||||||||||||| || |||||||||||||||||||| || ||||| || ||||||| Sbjct: 573195 ggatctagagtatcagcacgattggttgccattataactttaacatttgttgactgatca 573136 Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 || |||||||| ||| | |||| || |||| ||||| || ||||| || |||| ||| Sbjct: 573135 aaaccatccatttgagtaagtaactcaatcaatatacgttggacttcacgatcagaccct 573076 Query: 605 gtctgagcatcgaa 618 |||||||||||||| Sbjct: 573075 gtctgagcatcgaa 573062
>ref|XM_679369.1| PREDICTED: Danio rerio similar to B4galt3-prov protein (LOC556544), mRNA Length = 4364 Score = 83.8 bits (42), Expect = 7e-13 Identities = 102/122 (83%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || Sbjct: 1190 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 1131 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 |||| ||||| ||||| ||||||||||| ||||| |||||||||| |||||||| ||| Sbjct: 1130 gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 1071 Query: 560 tt 561 || Sbjct: 1070 tt 1069
>gb|BC012708.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone MGC:13997 IMAGE:4211677), complete cds Length = 1406 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1036 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 977 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 976 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 917 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 916 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 857 Query: 620 c 620 | Sbjct: 856 c 856
>emb|CR611800.1| full-length cDNA clone CS0DF038YP01 of Fetal brain of Homo sapiens (human) Length = 1532 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 520 aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttccatcagaat 579 |||||| ||||| || |||||||||||||||||||||||||||| || |||| ||| || Sbjct: 954 aaccttgacattgacattctgatcaaatccatccatctgattcagcagctccagcaggat 895 Query: 580 acgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | |||||| || | ||| ||||| |||||||||||||||| Sbjct: 894 cctctgaacctccctgtcggcccctgtctgagcatcgaatc 854
>dbj|AK150989.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830019K15 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 972 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||||||||| || |||| |||||||||||||| ||||||||||||||| Sbjct: 958 gccatgattaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcc 899 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| |||||||||| Sbjct: 898 agcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaatc 850
>dbj|AK169244.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920097L15 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1883 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||||||||| || |||| |||||||||||||| ||||||||||||||| Sbjct: 1466 gccatgattaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcc 1407 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| |||||||||| Sbjct: 1406 agcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaatc 1358
>dbj|AK050677.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030002E20 product:proteasome (prosome, macropain) 26S subunit, ATPase, 4, full insert sequence Length = 1403 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1053 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 994 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 993 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 934 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 ||||||||||||| ||| || | |||||| || | |||||| || ||||| |||||||| Sbjct: 933 ttcagtagttccagcaggatcctctgaacctccctgtcagctcctgtctggccatcgaat 874 Query: 620 c 620 | Sbjct: 873 c 873
>gb|BC094063.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone IMAGE:4160213), partial cds Length = 777 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 393 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 334 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 333 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 274 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 273 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 214 Query: 620 c 620 | Sbjct: 213 c 213
>gb|BC092265.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone MGC:103150 IMAGE:3671250), complete cds Length = 1411 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1019 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 960 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 959 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 900 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 899 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 840 Query: 620 c 620 | Sbjct: 839 c 839
>ref|NM_011874.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4 (Psmc4), mRNA Length = 1371 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1026 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 967 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 966 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 907 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 906 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 847 Query: 620 c 620 | Sbjct: 846 c 846
>gb|L76223.1|MUSCIP21R Mus musculus 26S proteasome ATPase (CIP21) mRNA, complete cds Length = 1371 Score = 81.8 bits (41), Expect = 3e-12 Identities = 146/181 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||| |||||||| | |||||| | |||||| ||||| ||||| ||||| | || ||| Sbjct: 1026 gggaattcaatttttcggtccaggcgtcctggccgcagtagagctggatccaaggtgtct 967 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || | || || ||||| || ||||||||||| || |||| |||||||||||||| ||| Sbjct: 966 gctctgtttgtggccatgattaccttcacattgacgttctggtcaaatccatccatttga 907 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaat 619 |||||||| |||| ||| || | |||||| || | |||||| || ||||| ||||||||| Sbjct: 906 ttcagtagctccagcaggatcctctgaacctccctgtcagctcctgtctgggcatcgaat 847 Query: 620 c 620 | Sbjct: 846 c 846
>ref|XM_512659.1| PREDICTED: Pan troglodytes similar to proteasome 26S ATPase subunit 4 isoform 2; protease 26S subunit 6; Tat-binding protein 7; MB67 interacting protein (LOC456032), mRNA Length = 1506 Score = 79.8 bits (40), Expect = 1e-11 Identities = 73/84 (86%) Strand = Plus / Minus Query: 537 tctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggt 596 |||||||||||||||||||||||||||| || |||| ||| || | |||||| || | || Sbjct: 1378 tctgatcaaatccatccatctgattcagcagctccagcaggatcctctgaacctccctgt 1319 Query: 597 cagccccggtctgagcatcgaatc 620 | ||||| |||||||||||||||| Sbjct: 1318 cggcccctgtctgagcatcgaatc 1295
>gb|AC147002.20| Medicago truncatula clone mth2-151m16, complete sequence Length = 128621 Score = 79.8 bits (40), Expect = 1e-11 Identities = 121/148 (81%) Strand = Plus / Plus Query: 410 acaagcctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcct 469 ||||||||||| || | | ||| |||| ||||||||||||||| | || |||||||| Sbjct: 7391 acaagcctcttttggcgtctatcaggcaaagggaactcaattttgcgatcaagtcttcca 7450 Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||| || |||||||| | ||| ||||| ||||| ||||||||||| || || ||| Sbjct: 7451 ggacgcaagagggcaggatccaaagtgtctgcacgatttgttgccattatgactttaaca 7510 Query: 530 ttcactgtctgatcaaatccatccatct 557 ||||| ||||| ||||| || ||||||| Sbjct: 7511 ttcacggtctggtcaaaaccgtccatct 7538 Score = 67.9 bits (34), Expect = 4e-08 Identities = 85/102 (83%) Strand = Plus / Plus Query: 556 ctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 |||||||| |||||||| || |||||||| ||||||| ||||| || || || ||||| Sbjct: 7729 ctgattcaaaagttccatgaggatacgctgtacttctctatcagctcctgtttgggcatc 7788 Query: 616 gaatcgagcagtggctatagcatcaacctcatcaatgaatat 657 |||| |||||| ||||| |||||||||||||| || ||||| Sbjct: 7789 aaatctagcagtagctatcgcatcaacctcatcgataaatat 7830 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Plus Query: 323 gcagcactgattttatcaggtctggagacataatcttccaaatcaacctcatcactcaag 382 |||||||| ||||| ||||| | ||| ||||||||||||| || || ||||||||||| Sbjct: 6321 gcagcactaattttgtcagggcgggaaacataatcttccaggtccacttcatcactcaaa 6380 Query: 383 ttcat 387 ||||| Sbjct: 6381 ttcat 6385 Score = 46.1 bits (23), Expect = 0.15 Identities = 83/103 (80%) Strand = Plus / Plus Query: 212 ggcttcttgacattggttcggtaacccttctcgaagtccttggggaggataacataccga 271 |||||||| || ||||| | ||||| ||||| |||||||| || || || ||||| | | Sbjct: 5605 ggcttcttcacgttggtcctataacctttctcaaagtcctttggtagtatgacatatcta 5664 Query: 272 tttttgcggacagcatgcatgccagcttcctggcaaatagcag 314 || || || ||||||||||| || ||||| || |||||||||| Sbjct: 5665 ttcttacgaacagcatgcattcctgcttcttgacaaatagcag 5707
>gb|BC055215.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone MGC:63709 IMAGE:2601666), complete cds Length = 1630 Score = 79.8 bits (40), Expect = 1e-11 Identities = 142/176 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| ||| ||||||| |||||| ||||| || || || || Sbjct: 1016 gggaactcaatcttacggtccaatctacctggacacagcagggcagggtccagtgtgtca 957 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 |||| ||||| ||||| ||||||||||| ||||| |||||||||| |||||||| ||| Sbjct: 956 gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 897 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 || || || || | ||| || | ||| ||||||| |||||| || ||||| ||||| Sbjct: 896 ttgagaagctcaagcaggattctctgtacttctctgtcagctccagtctgtgcatc 841
>ref|NM_199750.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 4 (psmc4), mRNA Length = 1630 Score = 79.8 bits (40), Expect = 1e-11 Identities = 142/176 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| ||| ||||||| |||||| ||||| || || || || Sbjct: 1016 gggaactcaatcttacggtccaatctacctggacacagcagggcagggtccagtgtgtca 957 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 |||| ||||| ||||| ||||||||||| ||||| |||||||||| |||||||| ||| Sbjct: 956 gccctgttggtggccatgataaccttcacgttcacattctgatcaaacccatccatttga 897 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatc 615 || || || || | ||| || | ||| ||||||| |||||| || ||||| ||||| Sbjct: 896 ttgagaagctcaagcaggattctctgtacttctctgtcagctccagtctgtgcatc 841
>gb|BC060362.1| Xenopus laevis proteasome 26S ATPase subunit 4 isoform 1, mRNA (cDNA clone MGC:68784 IMAGE:4202064), complete cds Length = 1397 Score = 77.8 bits (39), Expect = 4e-11 Identities = 108/131 (82%) Strand = Plus / Minus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 |||||||||||||| ||||| | || || |||| ||||| ||||| || || || ||| Sbjct: 991 ggacgcagcagagccggatccaatgtgtccgccctgttggtggccatgattacttttaca 932 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||||| |||| ||||||||||||||||| || || ||||||| |||||| | |||||| Sbjct: 931 ttcacgttctggtcaaatccatccatctggttaagaagttccagcagaattctctgaacc 872 Query: 590 tctcggtcagc 600 ||||||||||| Sbjct: 871 tctcggtcagc 861
>dbj|AB168803.1| Macaca fascicularis testis cDNA, clone: QtsA-14940, similar to human proteasome (prosome, macropain) 26S subunit, ATPase, 4(PSMC4), transcript variant 1, mRNA, RefSeq: NM_006503.2 Length = 1654 Score = 77.8 bits (39), Expect = 4e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 1173 tcaattttacggtccagccgtcctggccgtagcagggctggatccagggtgtctgctctg 1114 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcagt 565 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 1113 tttgtggccatgatcaccttgacattgacattctgatcaaatccatccatctgattcagc 1054 Query: 566 agttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 || |||| ||| || | |||||| || | ||| || || |||||||||||||||| Sbjct: 1053 agctccagcaggatcctctgaacctccctgtcggctcccgtctgagcatcgaatc 999
>emb|BX049202.1|CNS09A4M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 498 Score = 73.8 bits (37), Expect = 7e-10 Identities = 121/149 (81%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 238 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 297 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 298 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 357 Query: 590 tctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 358 tcccgatcggcaccggtctgcgcatcgaa 386
>emb|BX009899.1|CNS08FSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 367 Score = 73.8 bits (37), Expect = 7e-10 Identities = 121/149 (81%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 172 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 231 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 232 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 291 Query: 590 tctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 292 tcccgatcggcaccggtctgcgcatcgaa 320
>gb|AY809946.1| Schistosoma japonicum clone SJCHGC01629 unknown mRNA Length = 590 Score = 73.8 bits (37), Expect = 7e-10 Identities = 112/137 (81%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 544 ||||||||||| || || |||||||| ||||| |||||||| || || || |||| || Sbjct: 191 ggatctagagtgtcagcacgattggtagccatgataacctttacgttgacattctggtcg 132 Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 ||||||||||| || |||| ||||| | || ||||||||| ||||| |||||||| || Sbjct: 131 aatccatccatttggttcaacagttctaacaaaatacgctgtacttcacggtcagctcca 72 Query: 605 gtctgagcatcgaatcg 621 || |||||||| ||||| Sbjct: 71 gtttgagcatcaaatcg 55
>gb|AY431597.1| Aedes aegypti ASAP ID: 36999 proteasome regulatory particle subunit mRNA sequence Length = 1252 Score = 71.9 bits (36), Expect = 3e-09 Identities = 186/236 (78%) Strand = Plus / Minus Query: 428 cgatccggcagagggaactcaattttcctgtccagtcttcctggacgcagcagagcagga 487 ||||| |||| ||| || || |||||||| |||| | ||||||||||||||| || ||| Sbjct: 1019 cgatcgggcaaaggaaattcgattttcctatccaaacgtcctggacgcagcagtgcggga 960 Query: 488 tctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatcaaat 547 ||||| ||||| || |||||||| ||||| ||||| || || || || ||||||||| Sbjct: 959 tctagtgtatcagcacgattggtagccatgataactttaacgttggtcgtttgatcaaat 900 Query: 548 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccggtc 607 || ||||| ||||||| || ||||| || ||||| || ||||| | ||| || || || Sbjct: 899 ccgtccatttgattcaataattccagtaggatacgttgcacttccctgtcggcgccagtt 840 Query: 608 tgagcatcgaatcgagcagtggctatagcatcaacctcatcaatgaatattatagc 663 ||||||||||| || |||||| || || || | ||||||||||| |||||||| Sbjct: 839 tgagcatcgaaacgcttagtggcaattgcgtcgatttcatcaatgaaaattatagc 784 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 266 taccgatttttgcggacagcatgcatgccagcttcctggcaaatagcagtgat 318 |||| ||||| ||| ||||| ||||||||||||||||| ||||| ||| |||| Sbjct: 1181 tacctattttcgcgcacagcgtgcatgccagcttcctgacaaattgcattgat 1129
>ref|XM_631330.1| Dictyostelium discoideum HIV1 TAT-binding protein (DDB0191435), partial mRNA Length = 1212 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 |||||||||| ||||||| |||||||||||||| || ||||| ||||| || | | Sbjct: 914 gcaggatctaaagtatcttgacgattggttgccataattacctttacatttacagataca 855 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 ||||| |||||||| ||||||| || |||||| |||||||| |||||||| || ||||| Sbjct: 854 tcaaaaccatccatttgattcaataattccataagaatacgttgaacttcacgatcagc 796
>gb|L16578.1|DDITATBPA Dictyostelium discoideum HIV1 TAT-binding protein homologous protein mRNA, complete cds Length = 1383 Score = 69.9 bits (35), Expect = 1e-08 Identities = 98/119 (82%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 |||||||||| ||||||| |||||||||||||| || ||||| ||||| || | | Sbjct: 1084 gcaggatctaaagtatcttgacgattggttgccataattacctttacatttacagataca 1025 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 ||||| |||||||| ||||||| || |||||| |||||||| |||||||| || ||||| Sbjct: 1024 tcaaaaccatccatttgattcaataattccataagaatacgttgaacttcacgatcagc 966
>ref|XM_662535.1| Cryptosporidium hominis TU502 26S proteasome AAA-ATPase subunit RPT3 (Chro.40284) partial mRNA Length = 1206 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||| || |||||||||||||| ||||| | |||||| || ||||||||||||||||| Sbjct: 1055 attttttctggtctggagacatattcttcaagatcaacttcttcactcaagttcatcttt 996 Query: 392 gcagta 397 |||||| Sbjct: 995 gcagta 990
>gb|BC063145.1| Rattus norvegicus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone MGC:72664 IMAGE:6889167), complete cds Length = 1401 Score = 67.9 bits (34), Expect = 4e-08 Identities = 163/206 (79%) Strand = Plus / Minus Query: 415 cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 474 ||||||||| | ||||| || || ||||| |||||||| | |||||| | |||||| || Sbjct: 1048 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 989 Query: 475 cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 534 || ||||| ||||| | || ||||| | || || ||||| || ||||||||||| || Sbjct: 988 aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 929 Query: 535 tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 594 | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | Sbjct: 928 gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 869 Query: 595 gtcagccccggtctgagcatcgaatc 620 |||||| || ||||| |||||||||| Sbjct: 868 gtcagctcctgtctgggcatcgaatc 843
>ref|XM_625842.1| Cryptosporidium parvum Iowa II 26S proteasome regulatory subunit 26b like AAA ATpase (cgd4_2540), partial mRNA Length = 1206 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 332 attttatcaggtctggagacataatcttccaaatcaacctcatcactcaagttcatctta 391 ||||| || |||||||||||||| ||||| | |||||| || ||||||||||||||||| Sbjct: 1055 attttttctggtctggagacatattcttcaagatcaacttcttcactcaagttcatcttt 996 Query: 392 gcagta 397 |||||| Sbjct: 995 gcagta 990
>ref|NM_057122.1| Rattus norvegicus proteasome (prosome, macropain) 26S subunit, ATPase, 4 (Psmc4), mRNA Length = 1376 Score = 67.9 bits (34), Expect = 4e-08 Identities = 163/206 (79%) Strand = Plus / Minus Query: 415 cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 474 ||||||||| | ||||| || || ||||| |||||||| | |||||| | |||||| || Sbjct: 1038 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 979 Query: 475 cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 534 || ||||| ||||| | || ||||| | || || ||||| || ||||||||||| || Sbjct: 978 aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 919 Query: 535 tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 594 | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | Sbjct: 918 gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 859 Query: 595 gtcagccccggtctgagcatcgaatc 620 |||||| || ||||| |||||||||| Sbjct: 858 gtcagctcctgtctgggcatcgaatc 833
>dbj|D50695.1|RATTBP7B Rattus norvegicus mRNA for proteasomal ATPase (Tat-binding protein7), complete cds Length = 1397 Score = 67.9 bits (34), Expect = 4e-08 Identities = 163/206 (79%) Strand = Plus / Minus Query: 415 cctcttctgcctccgatccggcagagggaactcaattttcctgtccagtcttcctggacg 474 ||||||||| | ||||| || || ||||| |||||||| | |||||| | |||||| || Sbjct: 1038 cctcttctggcgacgatcagggagtgggaattcaattttgcggtccaggcgtcctggccg 979 Query: 475 cagcagagcaggatctagagtatctgcccgattggttgccattataaccttcacattcac 534 || ||||| ||||| | || ||||| | || || ||||| || ||||||||||| || Sbjct: 978 aagtagagctggatccaaggtgtctgctctgtttgtggccatgattaccttcacattgac 919 Query: 535 tgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcg 594 | || |||||||||||||| ||||||||||| |||| ||| || | |||||| || | Sbjct: 918 gttttggtcaaatccatccatttgattcagtagctccagcaggatcctctgaacctccct 859 Query: 595 gtcagccccggtctgagcatcgaatc 620 |||||| || ||||| |||||||||| Sbjct: 858 gtcagctcctgtctgggcatcgaatc 833
>gb|BC012411.1| Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone IMAGE:3501138), complete cds Length = 660 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 520 aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 572 |||||||||||| || |||| |||||||||||||| |||||||||||||||| Sbjct: 75 aaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcca 23
>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence Length = 189304 Score = 65.9 bits (33), Expect = 2e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 520 aaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 572 |||||||||||| || |||| |||||||||||||| |||||||||||||||| Sbjct: 118782 aaccttcacattgacgttctggtcaaatccatccatttgattcagtagttcca 118730
>ref|XM_749387.1| Aspergillus fumigatus Af293 proteasome regulatory particle subunit Rpt3 (Afu3g11390) partial mRNA Length = 1398 Score = 65.9 bits (33), Expect = 2e-07 Identities = 111/137 (81%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 544 ||||| |||||||| || || ||||| ||||| || ||||||||||| |||||| || Sbjct: 956 ggatccagagtatccgctcggttggtggccatgatgaccttcacattgcttgtctgttcg 897 Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 || || ||||||||||| || || || | ||| |||||||||||||| || || || || Sbjct: 896 aagccgtccatctgattgaggagctcaagcaggatacgctgaacttcacgatcggcacca 837 Query: 605 gtctgagcatcgaatcg 621 ||||| ||||||||||| Sbjct: 836 gtctgggcatcgaatcg 820
>emb|BX064829.1|CNS09M6P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 655 Score = 65.9 bits (33), Expect = 2e-07 Identities = 120/149 (80%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 412 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 471 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 472 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 531 Query: 590 tctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 532 tcccgatcggcaccggtctgcgcatcgaa 560 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 173 gtaacccttctcgaagtcctt 193
>ref|XM_311871.2| Anopheles gambiae str. PEST ENSANGP00000023984 (ENSANGG00000015165), partial mRNA Length = 1374 Score = 65.9 bits (33), Expect = 2e-07 Identities = 120/149 (80%) Strand = Plus / Minus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 959 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 900 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 899 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 840 Query: 590 tctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 839 tcccgatcggcaccggtctgcgcatcgaa 811 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 1197 gtaacccttctcgaagtcctt 1177
>ref|XM_311870.2| Anopheles gambiae str. PEST ENSANGP00000017654 (ENSANGG00000015165), partial mRNA Length = 1449 Score = 65.9 bits (33), Expect = 2e-07 Identities = 120/149 (80%) Strand = Plus / Minus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 1034 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 975 Query: 530 ttcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaact 589 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 974 ttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcacc 915 Query: 590 tctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 914 tcccgatcggcaccggtctgcgcatcgaa 886 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 1272 gtaacccttctcgaagtcctt 1252
>ref|XM_390945.1| Gibberella zeae PH-1 chromosome 3 PRS6_ASPNG 26S PROTEASE REGULATORY SUBUNIT 6B HOMOLOG (FG10769.1) partial mRNA Length = 1266 Score = 63.9 bits (32), Expect = 6e-07 Identities = 113/140 (80%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 ||||| || |||||||| || || ||||| ||||| || ||||| || || | ||||| Sbjct: 959 gcagggtccagagtatcagctcggttggtggccatgatgaccttgacgttagcagtctgg 900 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 601 || || ||||||||||| || ||||| || | |||||||||||| ||||||| ||| || Sbjct: 899 tcgaaaccatccatctggttgagtagctcaagcagaatacgctggacttctctgtcggca 840 Query: 602 ccggtctgagcatcgaatcg 621 || || |||||||||||||| Sbjct: 839 ccagtttgagcatcgaatcg 820
>ref|XM_502714.1| Yarrowia lipolytica CLIB122, YALI0D11770g predicted mRNA Length = 1215 Score = 61.9 bits (31), Expect = 2e-06 Identities = 142/179 (79%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 |||||||| || || | |||||||| || |||||||||||||||||||| || || ||| Sbjct: 950 gggaactcgatctttcggtccagtcgaccgggacgcagcagagcaggatccagtgtgtct 891 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || || ||||| ||||| || ||||| || || ||||| || || || |||||||| Sbjct: 890 gctcggttggtggccatgatcaccttgacgttggaggtctggtcgaaaccgtccatctgg 831 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaa 618 || || || |||| ||| |||||||| || |||| ||| || |||||||| |||||||| Sbjct: 830 ttgagcagctccagcaggatacgctggacctctctgtcggcaccggtctgtgcatcgaa 772
>emb|CR622224.1| full-length cDNA clone CS0DK006YK15 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 549 Score = 61.9 bits (31), Expect = 2e-06 Identities = 97/119 (81%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccga 505 |||||||| | |||||| | |||||| || ||||| || ||||| || || ||||| | Sbjct: 155 tcaattttacggtccagccgtcctggccgtagcagggccggatccagggtgtctgctctg 96 Query: 506 ttggttgccattataaccttcacattcactgtctgatcaaatccatccatctgattcag 564 || || ||||| || ||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 95 tttgtggccatgattaccttgacattgacattctgatcaaatccatccatctgattcag 37
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 61.9 bits (31), Expect = 2e-06 Identities = 142/179 (79%) Strand = Plus / Plus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 |||||||| || || | |||||||| || |||||||||||||||||||| || || ||| Sbjct: 1459650 gggaactcgatctttcggtccagtcgaccgggacgcagcagagcaggatccagtgtgtct 1459709 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 || || ||||| ||||| || ||||| || || ||||| || || || |||||||| Sbjct: 1459710 gctcggttggtggccatgatcaccttgacgttggaggtctggtcgaaaccgtccatctgg 1459769 Query: 560 ttcagtagttccatcagaatacgctgaacttctcggtcagccccggtctgagcatcgaa 618 || || || |||| ||| |||||||| || |||| ||| || |||||||| |||||||| Sbjct: 1459770 ttgagcagctccagcaggatacgctggacctctctgtcggcaccggtctgtgcatcgaa 1459828
>emb|BX049214.1|CNS09A4Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 60.0 bits (30), Expect = 1e-05 Identities = 121/150 (80%), Gaps = 1/150 (0%) Strand = Plus / Plus Query: 470 ggacgcagcagagca-ggatctagagtatctgcccgattggttgccattataaccttcac 528 |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 160 ggacgcagcagagcctggatcgagcgtatcggcccggttagtggccatgatcaccttcac 219 Query: 529 attcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaac 588 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 220 gttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcac 279 Query: 589 ttctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 280 ctcccgatcggcaccggtctgcgcatcgaa 309
>emb|BX031109.1|CNS08W61 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 60.0 bits (30), Expect = 1e-05 Identities = 121/150 (80%), Gaps = 1/150 (0%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgccc-gattggttgccattataaccttcac 528 |||||||||||||| ||||| || ||||| |||| | || || ||||| || |||||||| Sbjct: 416 ggacgcagcagagccggatcgagcgtatcggccccggttagtggccatgatcaccttcac 475 Query: 529 attcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctgaac 588 ||| |||||||| || ||||||||||| || || || || | |||||||||||| || Sbjct: 476 gttcgtcgtctgatcgaacccatccatctggttgagcagctcgagcagaatacgctgcac 535 Query: 589 ttctcggtcagccccggtctgagcatcgaa 618 || || || || |||||||| |||||||| Sbjct: 536 ctcccgatcggcaccggtctgcgcatcgaa 565 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 178 gtaacccttctcgaagtcctt 198
>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 Length = 4170692 Score = 60.0 bits (30), Expect = 1e-05 Identities = 99/122 (81%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttc 526 ||||||||||||||||||||||| | |||||| ||||| || || ||||| || ||||| Sbjct: 1872792 cctggacgcagcagagcaggatccaaagtatcggcccggttagtagccataatgacctta 1872733 Query: 527 acattcactgtctgatcaaatccatccatctgattcagtagttccatcagaatacgctga 586 ||||| | || ||||| ||||||||||| || || ||||||| |||||||| ||| Sbjct: 1872732 acattgctcgattgctcaaaaccatccatctggttgaggagttccagaagaatacgttga 1872673 Query: 587 ac 588 || Sbjct: 1872672 ac 1872671
>ref|XM_861948.1| PREDICTED: Canis familiaris similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7), transcript variant 4 (LOC476459), mRNA Length = 1413 Score = 58.0 bits (29), Expect = 4e-05 Identities = 89/109 (81%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||| ||||| || |||| |||||||||||||| ||||||||||| ||| Sbjct: 961 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 902 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| ||||| |||| Sbjct: 901 agcaggattctctgaacctccctgtcagctcctgtctgggcatcaaatc 853
>ref|XM_861938.1| PREDICTED: Canis familiaris similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7), transcript variant 3 (LOC476459), mRNA Length = 1455 Score = 58.0 bits (29), Expect = 4e-05 Identities = 89/109 (81%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||| ||||| || |||| |||||||||||||| ||||||||||| ||| Sbjct: 1003 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 944 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| ||||| |||| Sbjct: 943 agcaggattctctgaacctccctgtcagctcctgtctgggcatcaaatc 895
>ref|XM_861928.1| PREDICTED: Canis familiaris similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7), transcript variant 2 (LOC476459), mRNA Length = 1307 Score = 58.0 bits (29), Expect = 4e-05 Identities = 89/109 (81%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||| ||||| || |||| |||||||||||||| ||||||||||| ||| Sbjct: 855 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 796 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| ||||| |||| Sbjct: 795 agcaggattctctgaacctccctgtcagctcctgtctgggcatcaaatc 747
>ref|XM_533670.2| PREDICTED: Canis familiaris similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7), transcript variant 1 (LOC476459), mRNA Length = 1411 Score = 58.0 bits (29), Expect = 4e-05 Identities = 89/109 (81%) Strand = Plus / Minus Query: 512 gccattataaccttcacattcactgtctgatcaaatccatccatctgattcagtagttcc 571 ||||| || ||||| ||||| || |||| |||||||||||||| ||||||||||| ||| Sbjct: 959 gccatgatcaccttgacattaacgttctggtcaaatccatccatttgattcagtagctcc 900 Query: 572 atcagaatacgctgaacttctcggtcagccccggtctgagcatcgaatc 620 | ||| || | |||||| || | |||||| || ||||| ||||| |||| Sbjct: 899 agcaggattctctgaacctccctgtcagctcctgtctgggcatcaaatc 851
>emb|BX064588.1|CNS09M00 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 522 Score = 58.0 bits (29), Expect = 4e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 |||||||||||||| ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 412 ggacgcagcagagccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 471 Query: 530 ttcactgtctgatcaaatccatccatctg 558 ||| |||||||| || ||||||||||| Sbjct: 472 ttcgtcgtctgatcgaacccatccatctg 500 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 174 gtaacccttctcgaagtcctt 194
>gb|AC007842.1|AC007842 Homo sapiens chromosome 19, BAC 331191 (CIT-B-471f3), complete sequence Length = 174009 Score = 58.0 bits (29), Expect = 4e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 520 aaccttcacattcactgtctgatcaaatccatccatctgattcag 564 |||||| ||||| || |||||||||||||||||||||||||||| Sbjct: 98391 aaccttgacattgacattctgatcaaatccatccatctgattcag 98347
>ref|XM_817508.1| Trypanosoma brucei TREU927 protease regulatory ATPase subunit 4 (Tb10.70.3930) partial mRNA Length = 1200 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 597 ||||| ||||||||||||| |||||||||||| || |||||||||| || ||||| Sbjct: 830 tcaaagccatccatctgatgcagtagttccattagcgtacgctgaacctcgcggtc 775
>gb|AF227502.1| Trypanosoma brucei proteasome regulatory ATPase subunit 4 (Rpt4) gene, complete cds Length = 1637 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtc 597 ||||| ||||||||||||| |||||||||||| || |||||||||| || ||||| Sbjct: 960 tcaaagccatccatctgatgcagtagttccattagcgtacgctgaacctcgcggtc 905
>gb|AC158188.2| Selaginella moellendorffii clone JGIASXY-5I4, complete sequence Length = 37581 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 |||||||| || |||||||| |||| ||| || | ||| |||||||| || | |||||| Sbjct: 21463 gggaactcgatcttcctgtcgagtcgtccaggcctcagtagagcagggtccaaagtatcg 21404 Query: 500 gcccgattggttgccattataaccttcacatt 531 || ||||| || ||||| |||||||||||||| Sbjct: 21403 gcacgatttgtagccatgataaccttcacatt 21372 Score = 42.1 bits (21), Expect = 2.3 Identities = 72/89 (80%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 |||||||| || |||||||| |||||||| || | ||| ||||| || || | |||||| Sbjct: 10612 gggaactcgatcttcctgtcgagtcttccaggcctcagtagagcggggtccaaagtatca 10553 Query: 500 gcccgattggttgccattataaccttcac 528 || || || || ||||| ||||||||||| Sbjct: 10552 gcacggtttgtagccatgataaccttcac 10524
>ref|XM_710241.1| Candida albicans SC5314 putative 26S proteasome regulatory particle ATPase Rpt3p (CaO19_5793), mRNA Length = 1236 Score = 54.0 bits (27), Expect = 6e-04 Identities = 111/139 (79%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 |||||||||| ||||||||| | || || ||||||||||| || ||| | ||||||| Sbjct: 929 gcaggatctaaagtatctgctctgttagtagccattataactttgacagtggatgtctga 870 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 601 ||||| |||||||| ||||||| || |||| || ||| | |||||||| || ||||| Sbjct: 869 tcaaacccatccatttgattcaataactccaacaaaattctttgaacttcacgatcagca 810 Query: 602 ccggtctgagcatcgaatc 620 || || |||||||| |||| Sbjct: 809 ccagtttgagcatcaaatc 791
>ref|XM_710176.1| Candida albicans SC5314 putative 26S proteasome regulatory particle ATPase Rpt3p (CaO19.13215), mRNA Length = 1236 Score = 54.0 bits (27), Expect = 6e-04 Identities = 111/139 (79%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 |||||||||| ||||||||| | || || ||||||||||| || ||| | ||||||| Sbjct: 929 gcaggatctaaagtatctgctctgttagtagccattataactttgacagtggatgtctga 870 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 601 ||||| |||||||| ||||||| || |||| || ||| | |||||||| || ||||| Sbjct: 869 tcaaacccatccatttgattcaataactccaacaaaattctttgaacttcacgatcagca 810 Query: 602 ccggtctgagcatcgaatc 620 || || |||||||| |||| Sbjct: 809 ccagtttgagcatcaaatc 791
>ref|XM_393513.2| PREDICTED: Apis mellifera similar to DEAD-box ATPase (LOC410026), mRNA Length = 1399 Score = 54.0 bits (27), Expect = 6e-04 Identities = 105/131 (80%) Strand = Plus / Minus Query: 482 gcaggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctga 541 |||||||||| ||||| || | ||| |||||||||||||| || ||||| || ||| Sbjct: 997 gcaggatctaatgtatcagctctattcgttgccattataactttaacattagtagtttga 938 Query: 542 tcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagcc 601 ||||| |||||||| ||||| || | ||||| |||||||| || ||||| || ||||| Sbjct: 937 tcaaaaccatccatttgattaagcaattccaaaagaatacgttgcacttcacgatcagca 878 Query: 602 ccggtctgagc 612 || |||||||| Sbjct: 877 ccagtctgagc 867
>ref|XM_509951.1| PREDICTED: Pan troglodytes similar to Psmc6 protein (LOC452909), mRNA Length = 1167 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 879 tcttcctggacgcagcaaagcaggatccagtgtatctg 842 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 801 atcaaatccatccatttgattcagta 776
>ref|XM_655416.1| Aspergillus nidulans FGSC A4 26S protease regulatory subunit 6B (AN2904.2), mRNA Length = 1293 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataaccttcacattcactgtctgatca 544 ||||| || |||||||| || || || ||||| || ||||||||||| ||||| || Sbjct: 983 ggatccagggtatctgctcggttagtggccatgatgaccttcacattgctagtctgctcg 924 Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 || || |||||||| ||||| ||||||| |||||||||||||| || || ||||| || Sbjct: 923 aaaccgtccatctggttcagaagttccaggagaatacgctgaacctcgcgatcagcacca 864 Query: 605 gtctgagcatcgaa 618 || || |||||||| Sbjct: 863 gtttgtgcatcgaa 850
>gb|BT007531.1| Synthetic construct Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6 mRNA, partial cds Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>gb|BT006843.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6 mRNA, complete cds Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>gb|BC005390.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6, mRNA (cDNA clone MGC:12520 IMAGE:3996906), complete cds Length = 1595 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 902 tcttcctggacgcagcaaagcaggatccagtgtatctg 865 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 824 atcaaatccatccatttgattcagta 799
>emb|CR615895.1| full-length cDNA clone CS0DI024YJ06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1509 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 871 tcttcctggacgcagcaaagcaggatccagtgtatctg 834 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 793 atcaaatccatccatttgattcagta 768
>ref|NM_002806.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), mRNA Length = 1590 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 902 tcttcctggacgcagcaaagcaggatccagtgtatctg 865 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 824 atcaaatccatccatttgattcagta 799
>emb|CR624028.1| full-length cDNA clone CS0DE008YC13 of Placenta of Homo sapiens (human) Length = 1507 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 877 tcttcctggacgcagcaaagcaggatccagtgtatctg 840 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 799 atcaaatccatccatttgattcagta 774
>emb|CR623246.1| full-length cDNA clone CS0DI074YH03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1511 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 800 atcaaatccatccatttgattcagta 775
>emb|CR622035.1| full-length cDNA clone CS0DA002YJ02 of Neuroblastoma of Homo sapiens (human) Length = 1498 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 868 tcttcctggacgcagcaaagcaggatccagtgtatctg 831 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 790 atcaaatccatccatttgattcagta 765
>emb|CR621047.1| full-length cDNA clone CS0DI018YK19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1536 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 879 tcttcctggacgcagcaaagcaggatccagtgtatctg 842 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 801 atcaaatccatccatttgattcagta 776
>emb|CR617697.1| full-length cDNA clone CS0DL004YH06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 1663 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 862 tcttcctggacgcagcaaagcaggatccagtgtatctg 825 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 784 atcaaatccatccatttgattcagta 759
>emb|CR611308.1| full-length cDNA clone CS0DE005YE03 of Placenta of Homo sapiens (human) Length = 1459 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 800 atcaaatccatccatttgattcagta 775
>emb|CR608774.1| full-length cDNA clone CS0DI016YM01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1528 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 878 tcttcctggacgcagcaaagcaggatccagtgtatctg 841 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 800 atcaaatccatccatttgattcagta 775
>emb|CR602871.1| full-length cDNA clone CS0DI005YB20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1511 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 877 tcttcctggacgcagcaaagcaggatccagtgtatctg 840 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 799 atcaaatccatccatttgattcagta 774
>emb|CR595318.1| full-length cDNA clone CS0DI061YK22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1506 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 869 tcttcctggacgcagcaaagcaggatccagtgtatctg 832 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 791 atcaaatccatccatttgattcagta 766
>emb|CR590720.1| full-length cDNA clone CS0DI025YI08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1514 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 861 tcttcctggacgcagcaaagcaggatccagtgtatctg 824 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 783 atcaaatccatccatttgattcagta 758
>emb|CR456709.1| Homo sapiens full open reading frame cDNA clone RZPDo834G013D for gene PSMC6, proteasome (prosome, macropain) 26S subunit, ATPase, 6; complete cds, incl. stopcodon Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>dbj|AB040869.2| Mus musculus TBP7/PSMC4 gene for proteasomal ATPase, complete cds Length = 2371 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 523 cttcacattcactgtctgatcaaatccatccatctgattcagtagttcca 572 ||||||||| || |||| |||||||||||||| ||||||||||| |||| Sbjct: 1643 cttcacattgacgttctggtcaaatccatccatttgattcagtagctcca 1594
>gb|AY892558.1| Synthetic construct Homo sapiens clone FLH013619.01L proteasome 26S subunit 6 (PSMC6) mRNA, partial cds Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>gb|AY890076.1| Synthetic construct Homo sapiens clone FLH013623.01X proteasome 26S subunit 6 (PSMC6) mRNA, complete cds Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>gb|AY890075.1| Synthetic construct Homo sapiens clone FLH013622.01X proteasome 26S subunit 6 (PSMC6) mRNA, complete cds Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 882 tcttcctggacgcagcaaagcaggatccagtgtatctg 845 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 804 atcaaatccatccatttgattcagta 779
>emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-841O20 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 212103 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 184117 tcttcctggacgcagcaaagcaggatccagtgtatctg 184080 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 184039 atcaaatccatccatttgattcagta 184014
>gb|AF006305.1|AF006305 Homo sapiens 26S proteasome regulatory subunit (SUG2) mRNA, complete cds Length = 1579 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 897 tcttcctggacgcagcaaagcaggatccagtgtatctg 860 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 819 atcaaatccatccatttgattcagta 794
>gb|U15601.1|ANU15601 Aspergillus niger 26S proteasome subunit (tbpA) gene, complete cds Length = 2120 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 |||||||||||||| || || || |||| |||||||||||| || || ||||| || ||| Sbjct: 1352 aatccatccatctggttgagaagctccagcagaatacgctgcacctcacggtctgcaccg 1293 Query: 605 gtctgagcatcgaa 618 ||||| || ||||| Sbjct: 1292 gtctgggcgtcgaa 1279
>dbj|D78275.1| Homo sapiens mRNA for proteasome subunit p42, complete cds Length = 1560 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||||||| ||||||||| || ||||||| Sbjct: 898 tcttcctggacgcagcaaagcaggatccagtgtatctg 861 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 820 atcaaatccatccatttgattcagta 795
>gb|BC083283.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 6, mRNA (cDNA clone MGC:101799 IMAGE:7231258), complete cds Length = 1561 Score = 50.1 bits (25), Expect = 0.009 Identities = 58/69 (84%) Strand = Plus / Minus Query: 448 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 507 |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| || Sbjct: 930 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 871 Query: 508 ggttgccat 516 ||| ||||| Sbjct: 870 ggtggccat 862 Score = 48.1 bits (24), Expect = 0.037 Identities = 30/32 (93%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcag 576 |||||||||||||||||||| || |||||||| Sbjct: 833 aatccatccatctgattcagcagctccatcag 802
>gb|AY648827.1| Danio rerio 26S protease regulatory subunit S10B mRNA, complete cds Length = 1554 Score = 50.1 bits (25), Expect = 0.009 Identities = 58/69 (84%) Strand = Plus / Minus Query: 448 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 507 |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| || Sbjct: 920 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 861 Query: 508 ggttgccat 516 ||| ||||| Sbjct: 860 ggtggccat 852 Score = 48.1 bits (24), Expect = 0.037 Identities = 30/32 (93%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcag 576 |||||||||||||||||||| || |||||||| Sbjct: 823 aatccatccatctgattcagcagctccatcag 792
>ref|XM_368336.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein (MG00908.4) partial mRNA Length = 1266 Score = 50.1 bits (25), Expect = 0.009 Identities = 118/149 (79%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| || || ||||| || || |||||||| ||||| || Sbjct: 1001 gggaactcaatcttacggtccaatcgaccgggacggagaagggcaggatcgagagtgtcg 942 Query: 500 gcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatctga 559 |||| ||||||||||| || ||||| || || | ||||| || || || |||||||| Sbjct: 941 gccctgttggttgccataatgaccttgacgttggcagtctggtcgaaaccgtccatctgg 882 Query: 560 ttcagtagttccatcagaatacgctgaac 588 ||||| || || | ||||||||||||||| Sbjct: 881 ttcagaagctcgagcagaatacgctgaac 853
>ref|XM_868959.1| PREDICTED: Bos taurus similar to proteasome 26S ATPase subunit 6 (LOC518637), mRNA Length = 1948 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttccat 573 ||||||||||||||| ||||||||||| ||||| Sbjct: 846 atcaaatccatccatttgattcagtagctccat 814
>ref|XM_813480.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase subunit 3 (Tc00.1047053507603.200) partial mRNA Length = 1212 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 ||||| |||||||| ||||||||||||||| ||||| ||||| |||||||| Sbjct: 890 cgatttgttgccatgataaccttcacattcgtcgtctggtcaaagccatccat 838
>ref|XM_815076.1| Trypanosoma cruzi strain CL Brener proteasome regulatory ATPase subunit 3 (Tc00.1047053509429.270) partial mRNA Length = 1212 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 ||||| |||||||| ||||||||||||||| ||||| ||||| |||||||| Sbjct: 890 cgatttgttgccatgataaccttcacattcgtcgtctggtcaaagccatccat 838
>gb|BC112482.1| Bos taurus similar to proteasome 26S ATPase subunit 6, mRNA (cDNA clone MGC:137217 IMAGE:8014462), complete cds Length = 1605 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttccat 573 ||||||||||||||| ||||||||||| ||||| Sbjct: 841 atcaaatccatccatttgattcagtagctccat 809
>emb|CR318611.4| Zebrafish DNA sequence from clone DKEY-199F5 in linkage group 16, complete sequence Length = 162349 Score = 50.1 bits (25), Expect = 0.009 Identities = 70/85 (82%) Strand = Plus / Plus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || Sbjct: 58291 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 58350 Query: 500 gcccgattggttgccattataacct 524 |||| ||||| ||||| ||||||| Sbjct: 58351 gccctgttggtggccatgataacct 58375
>ref|NM_001003832.1| Danio rerio proteasome (prosome, macropain) 26S subunit, ATPase, 6 (psmc6), mRNA Length = 1554 Score = 50.1 bits (25), Expect = 0.009 Identities = 58/69 (84%) Strand = Plus / Minus Query: 448 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 507 |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| || Sbjct: 920 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 861 Query: 508 ggttgccat 516 ||| ||||| Sbjct: 860 ggtggccat 852 Score = 48.1 bits (24), Expect = 0.037 Identities = 30/32 (93%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcag 576 |||||||||||||||||||| || |||||||| Sbjct: 823 aatccatccatctgattcagcagctccatcag 792
>emb|AL954679.7| Zebrafish DNA sequence from clone DKEY-63J12 in linkage group 20, complete sequence Length = 132218 Score = 50.1 bits (25), Expect = 0.009 Identities = 58/69 (84%) Strand = Plus / Plus Query: 448 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 507 |||||| | |||||| | ||| ||||||||||| |||||||||| ||| |||| ||| || Sbjct: 95321 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtctggccggtt 95380 Query: 508 ggttgccat 516 ||| ||||| Sbjct: 95381 ggtggccat 95389 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 545 aatccatccatctgattcag 564 |||||||||||||||||||| Sbjct: 95418 aatccatccatctgattcag 95437
>emb|AL954724.9| Zebrafish DNA sequence from clone CH211-265P12, complete sequence Length = 136892 Score = 50.1 bits (25), Expect = 0.009 Identities = 70/85 (82%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatct 499 ||||||||||| || | ||||| ||| |||||||||||||| ||||| || || || || Sbjct: 105952 gggaactcaatcttacggtccaatctacctggacgcagcagggcagggtccagtgtgtca 105893 Query: 500 gcccgattggttgccattataacct 524 |||| ||||| ||||| ||||||| Sbjct: 105892 gccctgttggtggccatgataacct 105868
>gb|BC073644.1| Xenopus laevis similar to proteasome 26S ATPase subunit 6, mRNA (cDNA clone IMAGE:5515801), partial cds Length = 1552 Score = 48.1 bits (24), Expect = 0.037 Identities = 51/60 (85%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 |||||||||||||||||| ||||| | ||||| ||| | | ||||| |||||||||||| Sbjct: 814 atcaaatccatccatctggttcagcaactccattagagttctctgaatttctcggtcagc 755
>gb|DQ440313.1| Aedes aegypti clone AET-397 26S proteasome regulatory chain 4 mRNA, complete cds Length = 1317 Score = 48.1 bits (24), Expect = 0.037 Identities = 27/28 (96%) Strand = Plus / Minus Query: 503 cgattggttgccattataaccttcacat 530 |||||||||||||| ||||||||||||| Sbjct: 992 cgattggttgccataataaccttcacat 965
>gb|BC045087.1| Xenopus laevis similar to proteasome 26S ATPase subunit 6, mRNA (cDNA clone IMAGE:5542937), partial cds Length = 1585 Score = 48.1 bits (24), Expect = 0.037 Identities = 51/60 (85%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 |||||||||||||||||| ||||| | ||||| ||| | | ||||| |||||||||||| Sbjct: 847 atcaaatccatccatctggttcagcaactccattagagttctctgaatttctcggtcagc 788
>gb|AF475102.1| Triticum aestivum tat binding protein mRNA, partial cds Length = 564 Score = 48.1 bits (24), Expect = 0.037 Identities = 63/76 (82%) Strand = Plus / Minus Query: 438 gagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtat 497 ||||||||||||| || |||||||| | || | ||| || | ||||||||| ||| ||| Sbjct: 484 gagggaactcaatctttctgtccaggcgaccagaacggagtaaagcaggatcgagaatat 425 Query: 498 ctgcccgattggttgc 513 |||| ||||||||||| Sbjct: 424 ctgcacgattggttgc 409
>gb|BC102595.1| Bos taurus proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone MGC:127979 IMAGE:7961736), complete cds Length = 1498 Score = 48.1 bits (24), Expect = 0.037 Identities = 63/76 (82%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 ||||||||||| ||||||||||| |||| || || | |||||| || | ||||||||| Sbjct: 938 aatccatccatttgattcagtagctccagtaggattctctgaacctccctgtcagcccct 879 Query: 605 gtctgagcatcgaatc 620 ||||| ||||| |||| Sbjct: 878 gtctgggcatcaaatc 863
>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI, complete sequence Length = 1813164 Score = 48.1 bits (24), Expect = 0.037 Identities = 121/148 (81%), Gaps = 4/148 (2%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatc- 498 |||||||||||||||||||| ||||| || || | || || |||||| || || ||||| Sbjct: 1145024 gggaactcaattttcctgtcaagtctaccaggtctcaacaaagcagggtccagcgtatca 1144965 Query: 499 tgcccgattggttgccattataaccttcacattcactg-tctgatcaaatccatccatct 557 || | | ||||||||||| ||||| || ||||| | || |||||||||| |||||||| | Sbjct: 1144964 tgtctg-ttggttgccatgataactttgacatt-agtgctctgatcaaagccatccattt 1144907 Query: 558 gattcagtagttccatcagaatacgctg 585 | | ||||| || |||||||||||||| Sbjct: 1144906 gtgttagtagctcgatcagaatacgctg 1144879
>ref|NM_211296.1| Eremothecium gossypii AFR394Wp (AFR394W), mRNA Length = 1419 Score = 48.1 bits (24), Expect = 0.037 Identities = 121/148 (81%), Gaps = 4/148 (2%) Strand = Plus / Minus Query: 440 gggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatc- 498 |||||||||||||||||||| ||||| || || | || || |||||| || || ||||| Sbjct: 1139 gggaactcaattttcctgtcaagtctaccaggtctcaacaaagcagggtccagcgtatca 1080 Query: 499 tgcccgattggttgccattataaccttcacattcactg-tctgatcaaatccatccatct 557 || | | ||||||||||| ||||| || ||||| | || |||||||||| |||||||| | Sbjct: 1079 tgtctg-ttggttgccatgataactttgacatt-agtgctctgatcaaagccatccattt 1022 Query: 558 gattcagtagttccatcagaatacgctg 585 | | ||||| || |||||||||||||| Sbjct: 1021 gtgttagtagctcgatcagaatacgctg 994
>ref|NM_001035083.1| Bos taurus proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), mRNA Length = 1498 Score = 48.1 bits (24), Expect = 0.037 Identities = 63/76 (82%) Strand = Plus / Minus Query: 545 aatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagccccg 604 ||||||||||| ||||||||||| |||| || || | |||||| || | ||||||||| Sbjct: 938 aatccatccatttgattcagtagctccagtaggattctctgaacctccctgtcagcccct 879 Query: 605 gtctgagcatcgaatc 620 ||||| ||||| |||| Sbjct: 878 gtctgggcatcaaatc 863
>ref|XM_643629.1| Entamoeba histolytica HM-1:IMSS 26s proteasome subunit P45 family protein (402.t00003) partial mRNA Length = 1170 Score = 46.1 bits (23), Expect = 0.15 Identities = 50/59 (84%) Strand = Plus / Minus Query: 284 gcatgcatgccagcttcctggcaaatagcagtgatatcagcagcactgattttatcagg 342 |||||||| |||||||| || ||||||| || || || ||| |||||||||||||||| Sbjct: 1070 gcatgcataccagcttcttgacaaatagaagctatttctgcaccactgattttatcagg 1012
>emb|AL590447.1|CNS07EGE chromosome VII of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 226576 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Plus Query: 455 ctgtccagtcttcctggacgcagcagagcaggatc 489 |||||||||||||||||||| || || |||||||| Sbjct: 25103 ctgtccagtcttcctggacgtagaagcgcaggatc 25137
>emb|AJ719962.1| Gallus gallus mRNA for hypothetical protein, clone 8n6 Length = 1570 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattca 563 ||||||||||||||||||||||| Sbjct: 822 atcaaatccatccatctgattca 800
>ref|NM_001006494.1| Gallus gallus proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), mRNA Length = 1570 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattca 563 ||||||||||||||||||||||| Sbjct: 822 atcaaatccatccatctgattca 800
>emb|CR386272.1| Gallus gallus finished cDNA, clone ChEST60c2 Length = 1546 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattca 563 ||||||||||||||||||||||| Sbjct: 813 atcaaatccatccatctgattca 791
>gb|AY609898.1| Sus scrofa clone Clu_40992.scr.msk.p1.Contig1, mRNA sequence Length = 1412 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 350 acataatcttccaaatcaacctc 372 ||||||||||||||||||||||| Sbjct: 1131 acataatcttccaaatcaacctc 1109
>emb|AL590449.1|CNS07EGG chromosome X of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 262797 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Plus Query: 434 ggcagagggaactcaattttcctgtccagtcttcc 468 ||||||||||||||||| |||||||| || ||||| Sbjct: 201203 ggcagagggaactcaatcttcctgtcgagccttcc 201237
>ref|XM_637738.1| Dictyostelium discoideum hypothetical protein (DDB0168337), partial mRNA Length = 1287 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 516 |||||||| || ||||| ||||| | |||||||| |||||||||||||| Sbjct: 989 cctggacgaagaagagctggatccaaagtatctggacgattggttgccat 940
>ref|XM_509208.1| PREDICTED: Pan troglodytes similar to conserved ATPase domain protein 44 (LOC452063), mRNA Length = 927 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 747 atcaaatccatccatttgattcagta 722
>ref|XM_519765.1| PREDICTED: Pan troglodytes similar to conserved ATPase domain protein 44 (LOC464183), mRNA Length = 1458 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||| ||||| ||||||||| || ||||||| Sbjct: 828 tcttcctggacacagcaaagcaggatccagtgtatctg 791 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 750 atcaaatccatccatttgattcagta 725
>gb|AY348237.1| Drosophila insignita RPT4 (Rpt4) gene, partial cds Length = 458 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 516 |||||||||| || ||||| |||||||| |||| |||||||||||||| Sbjct: 237 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 188
>gb|AY348236.1| Drosophila bipolita RPT4 (Rpt4) gene, partial cds Length = 458 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 516 |||||||||| || ||||| |||||||| |||| |||||||||||||| Sbjct: 227 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 178
>gb|AY348235.1| Drosophila canipolita RPT4 (Rpt4) gene, partial cds Length = 466 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 516 |||||||||| || ||||| |||||||| |||| |||||||||||||| Sbjct: 234 cctggacgcaatagggcagggtctagagtgtctggacgattggttgccat 185
>gb|AF165146.6| Homo sapiens chromosome 8 clone CTA-397H3 map q12.1, complete sequence Length = 110554 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 20845 atcaaatccatccatttgattcagta 20870 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Plus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||| ||||| ||||||||| || ||||||| Sbjct: 20767 tcttcctggacacagcaaagcaggatccagtgtatctg 20804
>ref|XM_535701.2| PREDICTED: Canis familiaris similar to proteasome 26S ATPase subunit 6 (LOC478522), mRNA Length = 1893 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 |||||||||||| |||| ||||||||| || ||||||| Sbjct: 924 tcttcctggacgaagcaaagcaggatccagtgtatctg 887
>ref|XM_758573.1| Theileria parva strain Muguga chromosome 4 26S proteasome aaa-ATPase subunit Rpt3 (TP04_0031) partial mRNA Length = 1191 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 539 tgatcaaatccatccatctgattcagtagttcca 572 ||||||||||||||||| || ||||| ||||||| Sbjct: 833 tgatcaaatccatccatttggttcagaagttcca 800
>emb|BX067090.1|CNS09NXI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 44.1 bits (22), Expect = 0.58 Identities = 70/86 (81%) Strand = Plus / Minus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 981 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 922 Query: 530 ttcactgtctgatcaaatccatccat 555 ||| |||||||| || |||||||| Sbjct: 921 ttcgtcgtctgatcgaacccatccat 896
>emb|Z38135.1|MSDBATPMR M.sexta mRNA for DEAD-box ATPase Length = 1341 Score = 44.1 bits (22), Expect = 0.58 Identities = 97/122 (79%) Strand = Plus / Minus Query: 437 agagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatctagagta 496 |||||||||||||||||||| |||| | ||| || | || ||||| ||||||| ||| Sbjct: 1027 agagggaactcaattttcctatccaaacgtccaggtctaagtagagcgggatctaaggta 968 Query: 497 tctgcccgattggttgccattataaccttcacattcactgtctgatcaaatccatccatc 556 || || ||||| || ||||| || || || ||||| ||| |||||||| ||||||||| Sbjct: 967 tcagcacgatttgtggccataattactttaacattggttgtttgatcaaagccatccatc 908 Query: 557 tg 558 || Sbjct: 907 tg 906
>gb|AC046176.13| Homo sapiens chromosome 8, clone RP11-446E9, complete sequence Length = 184349 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||| ||||| ||||||||| || ||||||| Sbjct: 4320 tcttcctggacacagcaaagcaggatccagtgtatctg 4283 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 4242 atcaaatccatccatttgattcagta 4217
>gb|AC091671.28| Papio anubis clone rp41-192i11, complete sequence Length = 173021 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 104682 atcaaatccatccatttgattcagta 104707 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 467 cctggacgcagcagagcaggatctagagtatctg 500 ||||||||||||| ||||||||| || ||||||| Sbjct: 104608 cctggacgcagcaaagcaggatccagtgtatctg 104641
>gb|AC107376.7| Homo sapiens chromosome 8, clone CTA-397H3, complete sequence Length = 110554 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 20846 atcaaatccatccatttgattcagta 20871 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Plus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||| ||||| ||||||||| || ||||||| Sbjct: 20768 tcttcctggacacagcaaagcaggatccagtgtatctg 20805
>gb|AC008971.6| Homo sapiens chromosome 5 clone CTD-2376B17, complete sequence Length = 131856 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 23345 atcaaatccatccatttgattcagta 23370
>gb|AC008954.6|AC008954 Homo sapiens chromosome 5 clone CTD-2340N2, complete sequence Length = 90111 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 58861 atcaaatccatccatttgattcagta 58886
>ref|NG_002379.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6 pseudogene (PSMC6P) on chromosome 8 Length = 1736 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 ||||||||||| ||||| ||||||||| || ||||||| Sbjct: 991 tcttcctggacacagcaaagcaggatccagtgtatctg 954 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 913 atcaaatccatccatttgattcagta 888
>ref|NG_001564.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 6 pseudogene (LOC160410) on chromosome 12 Length = 1181 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 901 atcaaatccatccatttgattcagta 876
>gb|AC139783.3| Homo sapiens chromosome 5 clone RP11-1084J3, complete sequence Length = 189108 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 82123 atcaaatccatccatttgattcagta 82098
>gb|AC008033.9| Homo sapiens 12 BAC RP11-81H14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 149136 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 54379 atcaaatccatccatttgattcagta 54404
>gb|AC116987.2| Dictyostelium discoideum chromosome 2 map 3527441-3568052 strain AX4, complete sequence Length = 40611 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 467 cctggacgcagcagagcaggatctagagtatctgcccgattggttgccat 516 |||||||| || ||||| ||||| | |||||||| |||||||||||||| Sbjct: 39082 cctggacgaagaagagctggatccaaagtatctggacgattggttgccat 39033
>gb|AY609771.1| Sus scrofa clone Clu_3050.scr.msk.p1.Contig3, mRNA sequence Length = 2107 Score = 44.1 bits (22), Expect = 0.58 Identities = 34/38 (89%) Strand = Plus / Minus Query: 463 tcttcctggacgcagcagagcaggatctagagtatctg 500 |||||||||||| |||| ||||||||| || ||||||| Sbjct: 1422 tcttcctggacgaagcaaagcaggatccagtgtatctg 1385
>gb|U36395.1|STU36395 Spermophilus tridecemlineatus 26S Proteasome S.U. CADp44 - a conserved ATPase domain protein of 44kDa (CADp44) gene, complete cds Length = 1566 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagta 566 ||||||||||||||| |||||||||| Sbjct: 813 atcaaatccatccatttgattcagta 788
>gb|DQ222507.1| Solanum tuberosum clone 115D06 26S proteasome subunit 4-like mRNA, complete cds Length = 1581 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 437 agagggaactcaattttcctgtccagtcttcctggacgcagcagagcaggatc 489 |||||||||||||| |||||||| | ||| || || ||||| || |||||||| Sbjct: 1113 agagggaactcaatcttcctgtctattctaccaggtcgcagtagggcaggatc 1061
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence Length = 1618915 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Plus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 |||||||| ||||| ||||| ||||| || |||||||||||| |||||||| Sbjct: 430310 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 430362
>gb|AC073906.6| Trypanosoma brucei chromosome 6 clone RPCI93-3A7, complete sequence Length = 175357 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Plus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 |||||||| ||||| ||||| ||||| || |||||||||||| |||||||| Sbjct: 82126 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 82178
>gb|AY915912.1| Schistosoma japonicum Tat binding protein 7, TBP-7 mRNA, complete cds Length = 592 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 485 ggatctagagtatctgcccgattggttgccattataacctt 525 ||||||||||| || || |||||||| ||||| |||||||| Sbjct: 44 ggatctagagtgtcagcacgattggtagccatgataacctt 4
>ref|XM_821194.1| Trypanosoma brucei TREU927 clone RPCI93-3A7 proteasome regulatory ATPase subunit 3 (Tb927.6.1090) partial mRNA Length = 1212 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 |||||||| ||||| ||||| ||||| || |||||||||||| |||||||| Sbjct: 890 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 838
>emb|CR727357.3|CNS0GO6B Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|CR699648.2|CNS0G2SS Tetraodon nigroviridis full-length cDNA Length = 441 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 335 agtggcgatggcatcaatctcatcaatgaatat 303
>emb|CR690609.3|CNS0FVTP Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|CR685247.2|CNS0FROR Tetraodon nigroviridis full-length cDNA Length = 423 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 317 agtggcgatggcatcaatctcatcaatgaatat 285
>emb|CR684460.2|CNS0FR2W Tetraodon nigroviridis full-length cDNA Length = 443 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 337 agtggcgatggcatcaatctcatcaatgaatat 305
>emb|CR675713.2|CNS0FKCN Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|CR671862.3|CNS0FHDO Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|CR671048.2|CNS0FGR2 Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|CR652378.2|CNS0F2CG Tetraodon nigroviridis full-length cDNA Length = 440 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 625 agtggctatagcatcaacctcatcaatgaatat 657 |||||| || ||||||| ||||||||||||||| Sbjct: 334 agtggcgatggcatcaatctcatcaatgaatat 302
>emb|BX067091.1|CNS09NXJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 42.1 bits (21), Expect = 2.3 Identities = 72/89 (80%) Strand = Plus / Plus Query: 470 ggacgcagcagagcaggatctagagtatctgcccgattggttgccattataaccttcaca 529 ||||||||||| || ||||| || ||||| ||||| || || ||||| || |||||||| Sbjct: 402 ggacgcagcagggccggatcgagcgtatcggcccggttagtggccatgatcaccttcacg 461 Query: 530 ttcactgtctgatcaaatccatccatctg 558 ||| |||||| | || ||||||||||| Sbjct: 462 ttcgtcgtctgaacgaacccatccatctg 490 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 165 gtaacccttctcgaagtcctt 185
>emb|BX057192.1|CNS09GAK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 379 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 178 gtaacccttctcgaagtcctt 198
>emb|BX048935.1|CNS099X7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC24BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 153 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 117 gtaacccttctcgaagtcctt 137
>emb|BX047011.1|CNS098FR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 127 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 92 gtaacccttctcgaagtcctt 112
>emb|BX030223.1|CNS08VHF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA45AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 138 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 232 gtaacccttctcgaagtcctt 252 ||||||||||||||||||||| Sbjct: 114 gtaacccttctcgaagtcctt 134
>emb|AL049728.1|SPCC306 S.pombe chromosome III cosmid c306 Length = 25465 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 548 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 |||||||||||||||| || |||||||| ||||||||| ||| || ||||| Sbjct: 181 ccatccatctgattcaataattccatcaatgtacgctgaatttcacgatcagc 129
>gb|AC103559.2| Homo sapiens chromosome 3 clone RP11-286L5, complete sequence Length = 184133 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 509 gttgccattataaccttcaca 529 ||||||||||||||||||||| Sbjct: 79977 gttgccattataaccttcaca 79957
>gb|AC098481.2| Homo sapiens chromosome 3 clone RP11-349E16, complete sequence Length = 227137 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 509 gttgccattataaccttcaca 529 ||||||||||||||||||||| Sbjct: 203731 gttgccattataaccttcaca 203711
>gb|AC087269.5| Homo sapiens chromosome 8, clone RP11-211C9, complete sequence Length = 187924 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 aacctcatcactcaagttcat 387 ||||||||||||||||||||| Sbjct: 159050 aacctcatcactcaagttcat 159070
>gb|AF227501.1| Trypanosoma brucei proteasome regulatory ATPase subunit 3 (Rpt3) gene, complete cds Length = 1789 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 503 cgattggttgccattataaccttcacattcactgtctgatcaaatccatccat 555 |||||||| ||||| ||||| ||||| || |||||||||||| |||||||| Sbjct: 1283 cgattggtcgccatgataactttcacgttagttgtctgatcaaaaccatccat 1231
>ref|NM_001022802.1| Schizosaccharomyces pombe 972h- 19S proteasome regulatory subunit (SPCC1682.16), partial mRNA Length = 1167 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 548 ccatccatctgattcagtagttccatcagaatacgctgaacttctcggtcagc 600 |||||||||||||||| || |||||||| ||||||||| ||| || ||||| Sbjct: 794 ccatccatctgattcaataattccatcaatgtacgctgaatttcacgatcagc 742
>gb|AC154832.2| Mus musculus BAC clone RP24-568D4 from chromosome 14, complete sequence Length = 134900 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 148 gtagaaaataaagcatcctct 168 ||||||||||||||||||||| Sbjct: 99844 gtagaaaataaagcatcctct 99864
>emb|BX936454.25| Zebrafish DNA sequence from clone DKEY-29M11 in linkage group 20, complete sequence Length = 225683 Score = 42.1 bits (21), Expect = 2.3 Identities = 57/69 (82%) Strand = Plus / Minus Query: 448 aattttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgatt 507 |||||| | |||||| | ||| ||||||||||| |||||||||| ||| || | ||| || Sbjct: 111470 aatttttcggtccagacgtccaggacgcagcagggcaggatctaaagtgtcaggccggtt 111411 Query: 508 ggttgccat 516 ||| ||||| Sbjct: 111410 ggtggccat 111402 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 545 aatccatccatctgattcag 564 |||||||||||||||||||| Sbjct: 111373 aatccatccatctgattcag 111354
>dbj|AK063910.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-A05, full insert sequence Length = 1227 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 637 atcaacctcatcaatgaatat 657 ||||||||||||||||||||| Sbjct: 131 atcaacctcatcaatgaatat 111
>gb|AY609476.1| Sus scrofa clone Clu_12870.scr.msk.p1.Contig3, mRNA sequence Length = 1571 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 443 aactcaattttcctgtccagtcttcctgg 471 |||||||| |||||||||||||| ||||| Sbjct: 1099 aactcaatcttcctgtccagtctccctgg 1071
>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome Length = 1664970 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 629 gctatagcatcaacctcatcaatgaatattata 661 |||||||| |||| |||||||||||||||||| Sbjct: 1096266 gctatagcgtcaatttcatcaatgaatattata 1096298
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome Length = 4096345 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 628 ggctatagcatcaacctcatcaatgaatattat 660 |||||| ||||||| |||||||||||| ||||| Sbjct: 408014 ggctattgcatcaagctcatcaatgaaaattat 407982
>ref|NM_111819.3| Arabidopsis thaliana CDC48 (CELL DIVISION CYCLE 48); ATP binding / ATPase/ hydrolase/ nucleoside-triphosphatase/ nucleotide binding AT3G09840 (CDC48) mRNA, complete cds Length = 2797 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 301 ctggcaaatagcagtgatatcagcagcactga 332 ||||||||| |||||||||||||| |||||| Sbjct: 2242 ctggcaaatctcagtgatatcagcaccactga 2211
>ref|NM_125854.2| Arabidopsis thaliana ATP binding / nucleoside-triphosphatase/ nucleotide binding AT5G64580 mRNA, complete cds Length = 2758 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 635 gcatcaacctcatcaatgaatattatag 662 ||||||| |||||||||||| ||||||| Sbjct: 1256 gcatcaatctcatcaatgaagattatag 1229
>ref|NM_103934.3| Arabidopsis thaliana unknown protein AT1G50510 mRNA, complete cds Length = 1363 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 307 aatagcagtgatatcagcag 326 |||||||||||||||||||| Sbjct: 630 aatagcagtgatatcagcag 649
>ref|NM_179641.1| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding AT2G18193 mRNA, complete cds Length = 1697 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 458 tccagtcttcctggacgcagcagagcaggatc 489 |||| |||||| ||||| |||||||||||||| Sbjct: 1199 tccattcttccaggacgtagcagagcaggatc 1168
>ref|XM_520776.1| PREDICTED: Pan troglodytes similar to protease (prosome, macropain) 26S subunit, ATPase 1 (LOC465322), mRNA Length = 711 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 348 atcaaatccatccaactggttcagcagttcca 317
>ref|XM_510114.1| PREDICTED: Pan troglodytes similar to protease (prosome, macropain) 26S subunit, ATPase 1 (LOC453097), mRNA Length = 3270 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 2736 atcaaatccatccaactggttcagcagttcca 2705
>ref|XM_464508.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1693 Score = 40.1 bits (20), Expect = 9.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttccatcag 576 |||||||||||| | |||||| || ||||||||||| Sbjct: 902 atcaaatccatctaactgatttagcagttccatcag 867
>gb|BC061627.1| Xenopus tropicalis 26S protease regulatory subunit 7, mRNA (cDNA clone MGC:76296 IMAGE:5379538), complete cds Length = 1418 Score = 40.1 bits (20), Expect = 9.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatc 489 |||||||| |||||||||||||| || | || ||||||||||| Sbjct: 1039 tcaatttttctgtccagtcttccaggtctcataagagcaggatc 996
>gb|BC073818.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1, mRNA (cDNA clone MGC:88853 IMAGE:5456334), complete cds Length = 1565 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 966 atcaaatccatccaactggttcagcagttcca 935
>gb|BC016368.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1, mRNA (cDNA clone MGC:24583 IMAGE:4133348), complete cds Length = 1590 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 988 atcaaatccatccaactggttcagcagttcca 957
>gb|BC000512.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1, mRNA (cDNA clone MGC:8541 IMAGE:2822718), complete cds Length = 1604 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 994 atcaaatccatccaactggttcagcagttcca 963
>gb|AE006675.1| Sulfolobus solfataricus P2 section 34 of 272 of the complete genome Length = 11917 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 629 gctatagcatcaacctcatcaatgaatattat 660 ||||| ||||||| ||||||||||||||||| Sbjct: 2704 gctattgcatcaatttcatcaatgaatattat 2735
>gb|AE006877.1| Sulfolobus solfataricus P2 section 236 of 272 of the complete genome Length = 13959 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 643 ctcatcaatgaatattatagccgg 666 |||||||||||||||||| ||||| Sbjct: 4821 ctcatcaatgaatattattgccgg 4844
>gb|DQ440423.1| Aedes aegypti clone AET-5666 26S proteasome regulatory complex ATPase RPT4 mRNA, complete cds Length = 1182 Score = 40.1 bits (20), Expect = 9.1 Identities = 56/68 (82%) Strand = Plus / Minus Query: 449 attttcctgtccagtcttcctggacgcagcagagcaggatctagagtatctgcccgattg 508 |||||||| |||| | ||| |||||||||||||| ||||| | ||||| | ||||||| Sbjct: 908 attttcctatccaaacgtccaggacgcagcagagcgggatccaacgtatccggccgattg 849 Query: 509 gttgccat 516 || ||||| Sbjct: 848 gtggccat 841
>gb|BC054143.1| Xenopus laevis xMSS1 protein, mRNA (cDNA clone MGC:64244 IMAGE:6872349), complete cds Length = 1492 Score = 40.1 bits (20), Expect = 9.1 Identities = 38/44 (86%) Strand = Plus / Minus Query: 446 tcaattttcctgtccagtcttcctggacgcagcagagcaggatc 489 |||||||| |||||||||||||| || | || ||||||||||| Sbjct: 1103 tcaatttttctgtccagtcttccaggcctcataagagcaggatc 1060
>ref|XM_448634.1| Candida glabrata CBS138, CAGL0K09526g partial mRNA Length = 1296 Score = 40.1 bits (20), Expect = 9.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 539 tgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtca 598 |||||||| ||||||||||| | | || ||| |||| |||||| |||||||| || ||| Sbjct: 932 tgatcaaaaccatccatctgggttaataattcaatcaaaatacgttgaacttcacgatca 873 Query: 599 gccccggtctgagcatcgaa 618 | || || ||||||||||| Sbjct: 872 gaaccagtttgagcatcgaa 853
>gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequence Length = 72902 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 301 ctggcaaatagcagtgatatcagcagcactga 332 ||||||||| |||||||||||||| |||||| Sbjct: 44321 ctggcaaatctcagtgatatcagcaccactga 44352
>gb|AC114549.9| Mus musculus chromosome 19, clone RP24-216P17, complete sequence Length = 200425 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 523 cttcacattcactgtctgatcaaa 546 ||||||||||||||||| |||||| Sbjct: 154671 cttcacattcactgtctaatcaaa 154648
>gb|BC021001.1| Homo sapiens cDNA clone IMAGE:3839998, **** WARNING: chimeric clone **** Length = 2938 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Plus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 1615 atcaaatccatccaactggttcagcagttcca 1646
>ref|NM_002802.2| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1 (PSMC1), mRNA Length = 1586 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 1008 atcaaatccatccaactggttcagcagttcca 977
>gb|BT009826.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1 mRNA, complete cds Length = 1323 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 960 atcaaatccatccaactggttcagcagttcca 929
>ref|XM_791312.1| PREDICTED: Strongylocentrotus purpuratus similar to proteasome 26S ATPase subunit 6 (LOC591760), mRNA Length = 1176 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 542 tcaaatccatccatctgatt 561 |||||||||||||||||||| Sbjct: 809 tcaaatccatccatctgatt 790
>ref|XM_777098.1| PREDICTED: Strongylocentrotus purpuratus similar to 26S protease regulatory subunit 6A (TAT-binding protein 1) (TBP-1) (Spermatogenic cell/sperm-associated TAT-binding protein homolog SATA) (LOC576830), mRNA Length = 1164 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 439 agggaactcaattttcctgtccagtcttcctg 470 |||||| ||||| ||||||||||| ||||||| Sbjct: 789 agggaattcaatcttcctgtccagccttcctg 758
>ref|XM_789501.1| PREDICTED: Strongylocentrotus purpuratus similar to 26S protease regulatory subunit 7 (MSS1 protein) (LOC589870), mRNA Length = 1239 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 452 ttcctgtccagtcttcctgg 471 |||||||||||||||||||| Sbjct: 956 ttcctgtccagtcttcctgg 937
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence Length = 1302002 Score = 40.1 bits (20), Expect = 9.1 Identities = 65/80 (81%) Strand = Plus / Minus Query: 539 tgatcaaatccatccatctgattcagtagttccatcagaatacgctgaacttctcggtca 598 |||||||| ||||||||||| | | || ||| |||| |||||| |||||||| || ||| Sbjct: 939605 tgatcaaaaccatccatctgggttaataattcaatcaaaatacgttgaacttcacgatca 939546 Query: 599 gccccggtctgagcatcgaa 618 | || || ||||||||||| Sbjct: 939545 gaaccagtttgagcatcgaa 939526
>emb|BX842654.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 9/11 Length = 344249 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 524 ttcacattcactgtctgatc 543 |||||||||||||||||||| Sbjct: 156098 ttcacattcactgtctgatc 156117
>ref|NM_204011.1| Xenopus tropicalis proteasome (prosome, macropain) 26S subunit, ATPase, 6 (psmc6), mRNA Length = 1605 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcag 564 |||||| ||||||||||||||||| Sbjct: 817 atcaaacccatccatctgattcag 794
>gb|BC067741.1| Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1, mRNA (cDNA clone MGC:86994 IMAGE:5264945), complete cds Length = 1577 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 541 atcaaatccatccatctgattcagtagttcca 572 |||||||||||||| ||| ||||| ||||||| Sbjct: 981 atcaaatccatccaactggttcagcagttcca 950
>emb|AJ223384.1|MSE223384 Manduca sexta mRNA for 26S proteasome regulatory ATPase subunit 10b (S10b) Length = 1346 Score = 40.1 bits (20), Expect = 9.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 542 tcaaatccatccatctgattcagtagttccat 573 ||||| || ||||||||||||||||| ||||| Sbjct: 913 tcaaagccgtccatctgattcagtagctccat 882
>gb|AC160129.2| Mus musculus BAC clone RP23-253N17 from chromosome 9, complete sequence Length = 205094 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 atgcatgccagcttcctggc 305 |||||||||||||||||||| Sbjct: 100096 atgcatgccagcttcctggc 100077 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,058,529 Number of Sequences: 3902068 Number of extensions: 6058529 Number of successful extensions: 104213 Number of sequences better than 10.0: 338 Number of HSP's better than 10.0 without gapping: 338 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 103260 Number of HSP's gapped (non-prelim): 911 length of query: 666 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 643 effective length of database: 17,143,297,704 effective search space: 11023140423672 effective search space used: 11023140423672 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)