ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags39f04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 654 0.0
2emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 535 e-149
3emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 490 e-135
4gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 490 e-135
5emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 474 e-130
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 440 e-120
7emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 333 3e-88
8emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 325 8e-86
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 317 2e-83
10gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 311 1e-81
11gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 311 1e-81
12emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 309 5e-81
13gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 287 2e-74
14emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 272 1e-69
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 153 7e-34
16gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 153 7e-34
17gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 147 4e-32
18gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 139 1e-29
19gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 137 4e-29
20gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 137 4e-29
21emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 137 4e-29
22gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 131 2e-27
23emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 117 4e-23
24gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 111 2e-21
25dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
26dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
27dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
28gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 111 2e-21
29emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 107 4e-20
30dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
31emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 107 4e-20
32dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
33gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 107 4e-20
34emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 107 4e-20
35gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 100 9e-18
36emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 100 9e-18
37dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 9e-18
38dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 9e-18
39emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 100 9e-18
40gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 100 9e-18
41emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 92 2e-15
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 92 2e-15
43gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 92 2e-15
44gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 80 8e-12
45emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 80 8e-12
46emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 80 8e-12
47emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 80 8e-12
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 80 8e-12
49dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
50dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
51gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 80 8e-12
52gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 78 3e-11
53emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 76 1e-10
54dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
55dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 72 2e-09
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 72 2e-09
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 72 2e-09
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 72 2e-09
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 2e-09
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 2e-09
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 72 2e-09
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 72 2e-09
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 72 2e-09
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 72 2e-09
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 72 2e-09
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 72 2e-09
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 72 2e-09
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 72 2e-09
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 72 2e-09
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 72 2e-09
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 72 2e-09
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 2e-09
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 72 2e-09
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 2e-09
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 72 2e-09
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 2e-09
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 72 2e-09
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 2e-09
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 72 2e-09
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 72 2e-09
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 2e-09
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 72 2e-09
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 2e-09
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 64 5e-07
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 64 5e-07
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 64 5e-07
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 64 5e-07
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 64 5e-07
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 64 5e-07
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 64 5e-07
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 64 5e-07
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 64 5e-07
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 64 5e-07
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 64 5e-07
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 64 5e-07
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 64 5e-07
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 64 5e-07
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 64 5e-07
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 64 5e-07
106gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 56 1e-04
107gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 50 0.007
108gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta... 44 0.44
109gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, com... 44 0.44
110gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, com... 44 0.44
111dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
112dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
113dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
114dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
115dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
116gb|AY109327.1| Zea mays CL468_1 mRNA sequence 42 1.7
117gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 42 1.7
118gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, com... 40 6.9
119gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosom... 40 6.9
120emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on ch... 40 6.9
121emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on ch... 40 6.9
122emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on ch... 40 6.9
123emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chr... 40 6.9
124dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130 40 6.9
125gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, comple... 40 6.9
126emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in l... 40 6.9
127gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete... 40 6.9
128dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
129gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, com... 40 6.9
130dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
131dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
132dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 6.9
133dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 6.9
134dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 40 6.9 
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  654 bits (330), Expect = 0.0
 Identities = 332/333 (99%)
 Strand = Plus / Minus

                                                                        
Query: 172  aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 231
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395

                                                                        
Query: 232  tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 291
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335

                                                                        
Query: 292  gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275

                                                                        
Query: 352  gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 411
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 1215

                                                                        
Query: 412  gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 471
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1214 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 1155

                                             
Query: 472  taggagatgcaagggctcaaggcanagctcacc 504
            |||||||||||||||||||||||| ||||||||
Sbjct: 1154 taggagatgcaagggctcaaggcagagctcacc 1122



 Score =  165 bits (83), Expect = 2e-37
 Identities = 86/87 (98%)
 Strand = Plus / Minus

                                                                        
Query: 7    acgattcctcttaaaggaagtaaatattaattataacatcgatacaacagtgtgccggcc 66
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1619 acgattcctctcaaaggaagtaaatattaattataacatcgatacaacagtgtgccggcc 1560

                                       
Query: 67   atgcagagctggctcaacgtacgtact 93
            |||||||||||||||||||||||||||
Sbjct: 1559 atgcagagctggctcaacgtacgtact 1533



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                    
Query: 114  ccacatggagataatatatgagagcatttattcatatata 153
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473
to top
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  535 bits (270), Expect = e-149
 Identities = 317/333 (95%)
 Strand = Plus / Minus

                                                                       
Query: 172 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 231
           ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380

                                                                       
Query: 232 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 291
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320

                                                                       
Query: 292 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 351
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260

                                                                       
Query: 352 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 411
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccg 200

                                                                       
Query: 412 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 471
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 199 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 140

                                            
Query: 472 taggagatgcaagggctcaaggcanagctcacc 504
           ||||| ||||| |||| ||||||| ||||||||
Sbjct: 139 taggaaatgcaggggcgcaaggcagagctcacc 107



 Score =  107 bits (54), Expect = 4e-20
 Identities = 82/91 (90%), Gaps = 4/91 (4%)
 Strand = Plus / Minus

                                                                       
Query: 7   acgattcctcttaaaggaagtaaatattaattataa----catcgatacaacagtgtgcc 62
           ||||||||||| ||||||||||||||| ||||||||    |||||||||||||| |||  
Sbjct: 617 acgattcctctcaaaggaagtaaatataaattataattaacatcgatacaacagagtgtt 558

                                          
Query: 63  ggccatgcagagctggctcaacgtacgtact 93
           |||||||||||||||||||||||||||||||
Sbjct: 557 ggccatgcagagctggctcaacgtacgtact 527



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 114 ccacatggagataatatatgagagcatttattcatatata 153
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471
to top
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  490 bits (247), Expect = e-135
 Identities = 264/270 (97%)
 Strand = Plus / Minus

                                                                        
Query: 235  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 294
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967

                                                                        
Query: 295  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 354
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 966  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907

                                                                        
Query: 355  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 414
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847

                                                                        
Query: 415  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 474
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 846  agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787

                                          
Query: 475  gagatgcaagggctcaaggcanagctcacc 504
            |||||||| |||||||||||| ||||||||
Sbjct: 786  gagatgcaggggctcaaggcagagctcacc 757



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 60   gccggccatgcagagctggctcaacgtacg 89
            |||||||||||||| |||||||||| ||||
Sbjct: 1167 gccggccatgcagaactggctcaacatacg 1138
to top
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  490 bits (247), Expect = e-135
 Identities = 264/270 (97%)
 Strand = Plus / Minus

                                                                        
Query: 235  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 294
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363

                                                                        
Query: 295  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 354
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303

                                                                        
Query: 355  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 414
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243

                                                                        
Query: 415  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 474
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183

                                          
Query: 475  gagatgcaagggctcaaggcanagctcacc 504
            |||||||| |||||||||||| ||||||||
Sbjct: 2182 gagatgcaggggctcaaggcagagctcacc 2153



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 60   gccggccatgcagagctggctcaacgtacg 89
            |||||||||||||| |||||||||| ||||
Sbjct: 2563 gccggccatgcagaactggctcaacatacg 2534
to top
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  474 bits (239), Expect = e-130
 Identities = 262/270 (97%)
 Strand = Plus / Minus

                                                                       
Query: 235 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 294
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362

                                                                       
Query: 295 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 354
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302

                                                                       
Query: 355 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 414
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242

                                                                       
Query: 415 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 474
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182

                                         
Query: 475 gagatgcaagggctcaaggcanagctcacc 504
           |||||||| |||||||||||| ||||||||
Sbjct: 181 gagatgcaggggctcaaggcagagctcacc 152



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 129 atatgagagcatttattcatatata 153
           |||||||||||||||||||||||||
Sbjct: 498 atatgagagcatttattcatatata 474



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 60  gccggccatgcagagctggctcaac 84
           |||||||||||||| ||||||||||
Sbjct: 581 gccggccatgcagaactggctcaac 557
to top
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  440 bits (222), Expect = e-120
 Identities = 305/333 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 231
           ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || ||
Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451

                                                                       
Query: 232 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 291
            | |||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||
Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391

                                                                       
Query: 292 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 351
           |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | 
Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331

                                                                       
Query: 352 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 411
           |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271

                                                                       
Query: 412 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 471
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 270 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 211

                                            
Query: 472 taggagatgcaagggctcaaggcanagctcacc 504
           ||||| ||||| |||| ||||||| ||||||||
Sbjct: 210 taggaaatgcaggggcgcaaggcagagctcacc 178



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 120 ggagataatatatgagagcatttattcatatata 153
           ||||||||||||||||| ||||||||||||||||
Sbjct: 573 ggagataatatatgagatcatttattcatatata 540
to top
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  333 bits (168), Expect = 3e-88
 Identities = 248/275 (90%)
 Strand = Plus / Minus

                                                                        
Query: 230  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 289
            |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577

                                                                        
Query: 290  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 349
            |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517

                                                                        
Query: 350  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 409
            | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457

                                                                        
Query: 410  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 469
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397

                                               
Query: 470  cataggagatgcaagggctcaaggcanagctcacc 504
            ||||||||||||| |||||||||||| ||||||||
Sbjct: 1396 cataggagatgcaggggctcaaggcagagctcacc 1362



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 37/38 (97%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 41   aacatcgatacaacagtgt-gccggccatgcagagctg 77
            ||||||||||||||||||| ||||||||||||||||||
Sbjct: 1819 aacatcgatacaacagtgtggccggccatgcagagctg 1782



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 129  atatgagagcatttattcata 149
            |||||||||||||||||||||
Sbjct: 1745 atatgagagcatttattcata 1725
to top
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  325 bits (164), Expect = 8e-86
 Identities = 247/275 (89%)
 Strand = Plus / Minus

                                                                       
Query: 230 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 289
           |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273

                                                                       
Query: 290 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 349
           | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213

                                                                       
Query: 350 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 409
           | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153

                                                                       
Query: 410 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 469
            ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93

                                              
Query: 470 cataggagatgcaagggctcaaggcanagctcacc 504
           ||||||||||||| |||||||||||| ||||||||
Sbjct: 92  cataggagatgcaggggctcaaggcagagctcacc 58



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 41  aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 93
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 516 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 463



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 129 atatgagagcatttattcatatata 153
           |||||||||||||||||||||||||
Sbjct: 437 atatgagagcatttattcatatata 413
to top
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  317 bits (160), Expect = 2e-83
 Identities = 246/275 (89%)
 Strand = Plus / Minus

                                                                       
Query: 230 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 289
           |||| ||||| ||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374

                                                                       
Query: 290 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 349
           |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314

                                                                       
Query: 350 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 409
           | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254

                                                                       
Query: 410 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 469
            ||| || ||| | |||||||||||||||||| ||| |||  |||||||||||||||| |
Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194

                                              
Query: 470 cataggagatgcaagggctcaaggcanagctcacc 504
           ||||||||||||| |||||||||||| ||||||||
Sbjct: 193 cataggagatgcaggggctcaaggcagagctcacc 159



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 41  aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 93
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 619 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 566



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 127 atatatgagagcatttattcatatata 153
           |||||||||||||||||||||||||||
Sbjct: 542 atatatgagagcatttattcatatata 516
to top
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  311 bits (157), Expect = 1e-81
 Identities = 231/256 (90%)
 Strand = Plus / Minus

                                                                       
Query: 249 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 308
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 309 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 368
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 369 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 428
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 429 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 488
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                           
Query: 489 caaggcanagctcacc 504
           ||||||| ||||||||
Sbjct: 108 caaggcagagctcacc 93
to top
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  311 bits (157), Expect = 1e-81
 Identities = 231/256 (90%)
 Strand = Plus / Minus

                                                                       
Query: 249 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 308
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 309 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 368
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 369 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 428
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 429 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 488
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                           
Query: 489 caaggcanagctcacc 504
           ||||||| ||||||||
Sbjct: 108 caaggcagagctcacc 93
to top
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  309 bits (156), Expect = 5e-81
 Identities = 245/275 (89%)
 Strand = Plus / Minus

                                                                        
Query: 230  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 289
            |||| ||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||
Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565

                                                                        
Query: 290  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 349
            |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| 
Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505

                                                                        
Query: 350  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 409
            | |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||
Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445

                                                                        
Query: 410  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 469
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385

                                               
Query: 470  cataggagatgcaagggctcaaggcanagctcacc 504
            ||||||||||||| |||||||||||| ||||||||
Sbjct: 1384 cataggagatgcaggggctcaaggcagagctcacc 1350



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 41   aacatcgatacaacagtgtg-ccggccatgcagagctg 77
            |||||||||| ||||||||| |||||||||||||||||
Sbjct: 1807 aacatcgatataacagtgtggccggccatgcagagctg 1770



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 129  atatgagagcatttattcatatata 153
            |||||||||||||||||||||||||
Sbjct: 1733 atatgagagcatttattcatatata 1709
to top
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  287 bits (145), Expect = 2e-74
 Identities = 228/256 (89%)
 Strand = Plus / Minus

                                                                       
Query: 249 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 308
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 309 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 368
           | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 369 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 428
           ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 429 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 488
            |||||||||||| |||| ||  ||| |||| ||||||| |||||||||||||| |||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                           
Query: 489 caaggcanagctcacc 504
           ||||||| ||||||||
Sbjct: 108 caaggcagagctcacc 93
to top
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  272 bits (137), Expect = 1e-69
 Identities = 145/148 (97%)
 Strand = Plus / Minus

                                                                       
Query: 357 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 416
           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 417 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 476
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                       
Query: 477 gatgcaagggctcaaggcanagctcacc 504
           ||||||||||||||||||| ||||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacc 138
to top
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  153 bits (77), Expect = 7e-34
 Identities = 173/205 (84%)
 Strand = Plus / Minus

                                                                        
Query: 245  tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
            |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149

                                                                        
Query: 305  cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
            ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089

                                                                        
Query: 365  tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
            ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029

                                     
Query: 425  cgccgctgcagcaggccacaggcgg 449
            | |||   ||||||||| |||||||
Sbjct: 3028 ctccggaacagcaggccccaggcgg 3004



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                           
Query: 47   gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 93
            |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 3394 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349
to top
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  153 bits (77), Expect = 7e-34
 Identities = 173/205 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
           |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353

                                                                       
Query: 305 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
           ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293

                                                                       
Query: 365 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
           ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233

                                    
Query: 425 cgccgctgcagcaggccacaggcgg 449
           | |||   ||||||||| |||||||
Sbjct: 232 ctccggaacagcaggccccaggcgg 208



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                          
Query: 47  gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 93
           |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 598 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553
to top
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  147 bits (74), Expect = 4e-32
 Identities = 164/194 (84%)
 Strand = Plus / Minus

                                                                       
Query: 256 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 315
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 316 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 375
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 376 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 435
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                         
Query: 436 caggccacaggcgg 449
           |||||| |||||||
Sbjct: 161 caggccccaggcgg 148
to top
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  139 bits (70), Expect = 1e-29
 Identities = 163/194 (84%)
 Strand = Plus / Minus

                                                                       
Query: 256 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 315
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 316 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 375
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 376 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 435
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                         
Query: 436 caggccacaggcgg 449
           |||||| |||||||
Sbjct: 161 caggccccaggcgg 148
to top
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  137 bits (69), Expect = 4e-29
 Identities = 159/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 288 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 347
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 348 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 407
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 408 gccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 467
           |||||||| |||| |||||||||||||||||||| ||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                    
Query: 468 ggcatagga 476
            ||||||||
Sbjct: 129 tgcatagga 121
to top
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  137 bits (69), Expect = 4e-29
 Identities = 165/197 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372

                                                                       
Query: 305 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312

                                                                       
Query: 365 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252

                            
Query: 425 cgccgctgcagcaggcc 441
           |||||||||||||||||
Sbjct: 251 cgccgctgcagcaggcc 235
to top
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  137 bits (69), Expect = 4e-29
 Identities = 165/197 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313

                                                                       
Query: 305 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253

                                                                       
Query: 365 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193

                            
Query: 425 cgccgctgcagcaggcc 441
           |||||||||||||||||
Sbjct: 192 cgccgctgcagcaggcc 176
to top
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  131 bits (66), Expect = 2e-27
 Identities = 156/186 (83%)
 Strand = Plus / Minus

                                                                       
Query: 256 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 315
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 316 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 375
           || || || |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 376 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 435
           |  ||||||||||| ||||||||| | |||  |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                 
Query: 436 caggcc 441
           ||||||
Sbjct: 161 caggcc 156
to top
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  117 bits (59), Expect = 4e-23
 Identities = 168/203 (82%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 236 agcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggga 295
           |||| ||| |||||||| | |||||||||||||||||    |||||||| | ||||||||
Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372

                                                                       
Query: 296 cgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcag 355
           |||||||||||||| |||||||||| || |||||| |||| |||||   | | || ||| 
Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313

                                                                       
Query: 356 cgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcca 415
           | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  ||||||||
Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253

                                  
Query: 416 gtctcttgacgccgctgcagcag 438
            ||||||||| ||||| ||||||
Sbjct: 252 atctcttgactccgctacagcag 230



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 46  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 90
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 582 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 539
to top
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                         
Query: 260   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 319
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 320   ttccggcggccttgccagcgtttagccc 347
             | | |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 260      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 319
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 320      ttccggcggccttgccagcgtttagccc 347
                | | |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 322    ccggcggccttgccagcgtttagccc 347
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 322    ccggcggccttgccagcgtt 341
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 322    ccggcg 327
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    tgacgccgctgcagcaggcc 441
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576
to top
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 319
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 320 ttccggcggccttgccagcgtttagccc 347
           | | |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
to top
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 319
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 320 ttccggcggccttgccagcgtttagccc 347
           | | |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 260      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 319
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 320      ttccggcggccttgccagcgtttagccc 347
                | | |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 322    ccggcggccttgccagcgtttagccc 347
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 322    ccggcggccttgccagcgtt 341
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 322    ccggcg 327
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    tgacgccgctgcagcaggcc 441
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576
to top
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  107 bits (54), Expect = 4e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
           |||||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||
Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295

                                                                       
Query: 305 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
           ||||| |||||||||| || |||||| |||| |||||   | | || ||  | |||||||
Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235

                                                                       
Query: 365 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175

                         
Query: 425 cgccgctgcagcag 438
           | ||||| ||||||
Sbjct: 174 ctccgctacagcag 161



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 46  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 90
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 527 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 484
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 322    ccggcggccttgccagcgtttagccc 347
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 322    ccggcggccttgccagcgtt 341
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 322    ccggcg 327
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    tgacgccgctgcagcaggcc 441
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428
to top
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 322    ccggcggccttgccagcgtttagccc 347
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 322    ccggcggccttgccagcgtt 341
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 262    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 322    ccggcg 327
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 422    tgacgccgctgcagcaggcc 441
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 322   ccggcggccttgccagcgtttagccc 347
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 322   ccggcggccttgccagcgtt 341
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 322   ccggcg 327
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 422   tgacgccgctgcagcaggcc 441
             ||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggcc 46706
to top
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
to top
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                        
Query: 262  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 322  ccggcggccttgccagcgtttagccc 347
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
to top
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
to top
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 322   ccggcggccttgccagcgtttagccc 347
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 322   ccggcggccttgccagcgtt 341
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 322   ccggcg 327
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 422   tgacgccgctgcagcaggcc 441
             ||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggcc 50396
to top
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 157/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 245 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 304
           |||||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |
Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366

                                                                       
Query: 305 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 364
           ||||| |||||||||| || |||||| | || |||||   | | || ||  | |||||||
Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306

                                                                       
Query: 365 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 424
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246

                         
Query: 425 cgccgctgcagcag 438
           | ||||| ||||||
Sbjct: 245 ctccgctacagcag 232



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 46  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 90
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 598 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 555
to top
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
to top
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 77/86 (89%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||| 
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 322 ccggcggccttgccagcgtttagccc 347
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggcc 281
to top
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggcc 513
to top
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215
to top
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918
to top
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggcc 143
to top
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggcc 466
to top
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggcc 249
to top
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggcc 231
to top
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 274 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttg 333
           |||| |||||||| |||||||| ||||||||||||| |||||||||| | |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                      
Query: 334 ccagcgtttag 344
           || ||||||||
Sbjct: 265 ccggcgtttag 255



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggcc 149
to top
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 322 ccggcggccttgcc 335
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                            
Query: 262      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 322      ccggcg 327
                ||||||
Sbjct: 14437004 ccggcg 14436999
to top
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 262   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 322   ccggcg 327
             ||||||
Sbjct: 45502 ccggcg 45497
to top
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344
to top
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254
to top
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 418 ctcttgacgccgctgcagcag 438
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140
to top
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 418 ctcttgacgccgctgcagcag 438
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140
to top
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355
to top
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 418 ctcttgacgccgctgcagcag 438
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266
to top
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335
to top
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagc 338
           |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 339 gtt 341
           |||
Sbjct: 157 gtt 159



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggcc 268
to top
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 322 ccggcg 327
           ||||||
Sbjct: 370 ccggcg 365
to top
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 262  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 322  ccggcg 327
            ||||||
Sbjct: 3456 ccggcg 3451
to top
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 322 ccggcg 327
           ||||||
Sbjct: 372 ccggcg 367
to top
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 322 ccggcg 327
           ||||||
Sbjct: 374 ccggcg 369
to top
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 374 ctggcggc 367
to top
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||| 
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 422 tgacgccgctgcagcaggcc 441
           ||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggcc 226
to top
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| || 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 356 ctggcggc 349
to top
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 281 ctggcggc 274
to top
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 380 ctggcggc 373
to top
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 395 ctggcggc 388
to top
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 322 ccggcggccttgccagcgtt 341
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 204 ctggcggc 197
to top
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 391 ctggcggc 384
to top
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 321
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||| 
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 322 ccggcggc 329
           | ||||||
Sbjct: 259 ctggcggc 252
to top
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 279  gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 327
            ||||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
to top
>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA
           clone IMAGE:4504353), partial cds
          Length = 4763

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 425 cgccgctgcagcaggccacagg 446
           ||||||||||||||||||||||
Sbjct: 367 cgccgctgcagcaggccacagg 388
to top
>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence
          Length = 43869

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 425   cgccgctgcagcaggccacagg 446
             ||||||||||||||||||||||
Sbjct: 43282 cgccgctgcagcaggccacagg 43303
to top
>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 425   cgccgctgcagcaggccacagg 446
             ||||||||||||||||||||||
Sbjct: 52943 cgccgctgcagcaggccacagg 52964
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 423      gacgccgctgcagcaggccac 443
                |||||||||||||||||||||
Sbjct: 41554621 gacgccgctgcagcaggccac 41554641
to top
>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0614D08
          Length = 147548

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 423    gacgccgctgcagcaggccac 443
              |||||||||||||||||||||
Sbjct: 110914 gacgccgctgcagcaggccac 110934
to top
>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0660F12
          Length = 147203

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 423    gacgccgctgcagcaggccac 443
              |||||||||||||||||||||
Sbjct: 122820 gacgccgctgcagcaggccac 122840
to top
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 256 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 308
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 256 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 308
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 418  ctcttgacgccgctgcagcag 438
            |||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagcag 2785
to top
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 418 ctcttgacgccgctgcagcag 438
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135
to top
>gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, complete sequence
          Length = 186258

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    ggaagtaaatattaattata 41
             ||||||||||||||||||||
Sbjct: 19775 ggaagtaaatattaattata 19794
to top
>gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosome 18, complete
             sequence
          Length = 170129

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    ggaagtaaatattaattata 41
             ||||||||||||||||||||
Sbjct: 23067 ggaagtaaatattaattata 23048
to top
>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 128843

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 115    cacatggagataatatatga 134
              ||||||||||||||||||||
Sbjct: 114026 cacatggagataatatatga 114007
to top
>emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on chromosome 13, complete
             sequence
          Length = 132436

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    aaggaagtaaatattaatta 39
             ||||||||||||||||||||
Sbjct: 74392 aaggaagtaaatattaatta 74373
to top
>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG
             island, complete sequence
          Length = 162575

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   tggagataatatatgagagc 138
             ||||||||||||||||||||
Sbjct: 31942 tggagataatatatgagagc 31961
to top
>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+
              transporting ATP synthase mitochondrial F0 complex subunit
              g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1)
              pseudogene, three novel genes, the gene for a novel ENTH
              domain containing protein, the 5' end of the Sox30 gene for
              SRY-box containing gene 30 and three Cpg islands, complete
              sequence
          Length = 207877

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     tcttaaaggaagtaaatatt 34
              ||||||||||||||||||||
Sbjct: 135370 tcttaaaggaagtaaatatt 135389
to top
>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130
          Length = 3692

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  agcaaggatgacagcaagtg 243
            ||||||||||||||||||||
Sbjct: 1826 agcaaggatgacagcaagtg 1807
to top
>gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, complete sequence
          Length = 118837

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    agtaaatattaattataaca 44
             ||||||||||||||||||||
Sbjct: 82647 agtaaatattaattataaca 82628
to top
>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2,
             complete sequence
          Length = 146298

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   tggagataatatatgagagc 138
             ||||||||||||||||||||
Sbjct: 85666 tggagataatatatgagagc 85685
to top
>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence
          Length = 109398

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 224    agcaaggatgacagcaagtg 243
              ||||||||||||||||||||
Sbjct: 100675 agcaaggatgacagcaagtg 100694
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 385      ttgtcagcggtgctctgggc 404
                ||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggc 11569482
to top
>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence
          Length = 206852

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   agcaaggatgacagcaagtg 243
             ||||||||||||||||||||
Sbjct: 90670 agcaaggatgacagcaagtg 90651
to top
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    ttgtcagcggtgctctgggc 404
              ||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggc 123616
to top
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   ttgtcagcggtgctctgggc 404
             ||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggc 29753
to top
>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete
             sequence
          Length = 211750

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 224   agcaaggatgacagcaagtg 243
             ||||||||||||||||||||
Sbjct: 90149 agcaaggatgacagcaagtg 90168
to top
>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete
              sequence
          Length = 156583

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 224    agcaaggatgacagcaagtg 243
              ||||||||||||||||||||
Sbjct: 142238 agcaaggatgacagcaagtg 142257
to top
>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 6/19
          Length = 100000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   agcaaggatgacagcaagtg 243
             ||||||||||||||||||||
Sbjct: 19820 agcaaggatgacagcaagtg 19801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,147,264
Number of Sequences: 3902068
Number of extensions: 3147264
Number of successful extensions: 63503
Number of sequences better than 10.0: 134
Number of HSP's better than 10.0 without gapping: 136
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62965
Number of HSP's gapped (non-prelim): 527
length of query: 507
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 485
effective length of database: 17,147,199,772
effective search space: 8316391889420
effective search space used: 8316391889420
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top