| Clone Name | rbags39f03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 660 bits (333), Expect = 0.0 Identities = 333/333 (100%) Strand = Plus / Minus Query: 214 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395 Query: 274 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335 Query: 334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275 Query: 394 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 1215 Query: 454 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1214 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 1155 Query: 514 taggagatgcaagggctcaaggcagagctcacc 546 ||||||||||||||||||||||||||||||||| Sbjct: 1154 taggagatgcaagggctcaaggcagagctcacc 1122 Score = 262 bits (132), Expect = 1e-66 Identities = 134/135 (99%) Strand = Plus / Minus Query: 1 tatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactcacgattcctctc 60 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1667 tatgatacatatatcaaaagtgcacatggtacaaagtacaacaaactcacgattcctctc 1608 Query: 61 aaaggaagtaaatattaattataacatcgatacaacagtgtgccggccatgcagagctgg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1607 aaaggaagtaaatattaattataacatcgatacaacagtgtgccggccatgcagagctgg 1548 Query: 121 ctcaacgtacgtact 135 ||||||||||||||| Sbjct: 1547 ctcaacgtacgtact 1533 Score = 79.8 bits (40), Expect = 9e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 156 ccacatggagataatatatgagagcatttattcatatata 195 |||||||||||||||||||||||||||||||||||||||| Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 541 bits (273), Expect = e-151 Identities = 318/333 (95%) Strand = Plus / Minus Query: 214 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273 ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380 Query: 274 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320 Query: 334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260 Query: 394 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccg 200 Query: 454 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513 |||| ||||||||||||||||||||||||| |||| | || |||||||||||| |||| Sbjct: 199 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 140 Query: 514 taggagatgcaagggctcaaggcagagctcacc 546 ||||| ||||| |||| |||||||||||||||| Sbjct: 139 taggaaatgcaggggcgcaaggcagagctcacc 107 Score = 190 bits (96), Expect = 3e-45 Identities = 123/132 (93%), Gaps = 4/132 (3%) Strand = Plus / Minus Query: 8 catatatnaaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaa 67 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 658 catatatcaaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaa 599 Query: 68 gtaaatattaatta----taacatcgatacaacagtgtgccggccatgcagagctggctc 123 |||||||| ||||| ||||||||||||||||| ||| ||||||||||||||||||| Sbjct: 598 gtaaatataaattataattaacatcgatacaacagagtgttggccatgcagagctggctc 539 Query: 124 aacgtacgtact 135 |||||||||||| Sbjct: 538 aacgtacgtact 527 Score = 79.8 bits (40), Expect = 9e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 156 ccacatggagataatatatgagagcatttattcatatata 195 |||||||||||||||||||||||||||||||||||||||| Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 496 bits (250), Expect = e-137 Identities = 265/270 (98%) Strand = Plus / Minus Query: 277 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336 ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967 Query: 337 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 966 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907 Query: 397 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 906 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847 Query: 457 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 846 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787 Query: 517 gagatgcaagggctcaaggcagagctcacc 546 |||||||| ||||||||||||||||||||| Sbjct: 786 gagatgcaggggctcaaggcagagctcacc 757 Score = 60.0 bits (30), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 1 tatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactca 49 |||||| ||||||| || |||||||||| |||||||||||| ||||||| Sbjct: 1269 tatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 1221 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 102 gccggccatgcagagctggctcaacgtacg 131 |||||||||||||| |||||||||| |||| Sbjct: 1167 gccggccatgcagaactggctcaacatacg 1138
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 496 bits (250), Expect = e-137 Identities = 265/270 (98%) Strand = Plus / Minus Query: 277 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336 ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363 Query: 337 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303 Query: 397 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243 Query: 457 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183 Query: 517 gagatgcaagggctcaaggcagagctcacc 546 |||||||| ||||||||||||||||||||| Sbjct: 2182 gagatgcaggggctcaaggcagagctcacc 2153 Score = 60.0 bits (30), Expect = 8e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 1 tatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactca 49 |||||| ||||||| || |||||||||| |||||||||||| ||||||| Sbjct: 2665 tatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 2617 Score = 44.1 bits (22), Expect = 0.47 Identities = 28/30 (93%) Strand = Plus / Minus Query: 102 gccggccatgcagagctggctcaacgtacg 131 |||||||||||||| |||||||||| |||| Sbjct: 2563 gccggccatgcagaactggctcaacatacg 2534
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 480 bits (242), Expect = e-132 Identities = 263/270 (97%) Strand = Plus / Minus Query: 277 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362 Query: 337 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302 Query: 397 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456 ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242 Query: 457 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182 Query: 517 gagatgcaagggctcaaggcagagctcacc 546 |||||||| ||||||||||||||||||||| Sbjct: 181 gagatgcaggggctcaaggcagagctcacc 152 Score = 58.0 bits (29), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 1 tatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactc 48 |||||| ||||||| || ||||||||||||||||| ||||| |||||| Sbjct: 683 tatgattcatatatcaacagtgcacatggtacaaaatacaataaactc 636 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 171 atatgagagcatttattcatatata 195 ||||||||||||||||||||||||| Sbjct: 498 atatgagagcatttattcatatata 474 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 102 gccggccatgcagagctggctcaac 126 |||||||||||||| |||||||||| Sbjct: 581 gccggccatgcagaactggctcaac 557
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 446 bits (225), Expect = e-122 Identities = 306/333 (91%) Strand = Plus / Minus Query: 214 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273 ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || || Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451 Query: 274 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333 | |||||||||||||||||| |||||||||||||||||||||||| |||||||| |||| Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391 Query: 334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393 |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331 Query: 394 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453 |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271 Query: 454 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513 |||| ||||||||||||||||||||||||| |||| | || |||||||||||| |||| Sbjct: 270 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 211 Query: 514 taggagatgcaagggctcaaggcagagctcacc 546 ||||| ||||| |||| |||||||||||||||| Sbjct: 210 taggaaatgcaggggcgcaaggcagagctcacc 178 Score = 60.0 bits (30), Expect = 8e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 162 ggagataatatatgagagcatttattcatatata 195 ||||||||||||||||| |||||||||||||||| Sbjct: 573 ggagataatatatgagatcatttattcatatata 540
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 339 bits (171), Expect = 6e-90 Identities = 249/275 (90%) Strand = Plus / Minus Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331 |||| ||||||||| |||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577 Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391 |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517 Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451 | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| || Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457 Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511 ||| || ||| | |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397 Query: 512 cataggagatgcaagggctcaaggcagagctcacc 546 ||||||||||||| ||||||||||||||||||||| Sbjct: 1396 cataggagatgcaggggctcaaggcagagctcacc 1362 Score = 60.0 bits (30), Expect = 8e-06 Identities = 37/38 (97%), Gaps = 1/38 (2%) Strand = Plus / Minus Query: 83 aacatcgatacaacagtgt-gccggccatgcagagctg 119 ||||||||||||||||||| |||||||||||||||||| Sbjct: 1819 aacatcgatacaacagtgtggccggccatgcagagctg 1782 Score = 52.0 bits (26), Expect = 0.002 Identities = 31/33 (93%) Strand = Plus / Minus Query: 8 catatatnaaaagtgcacatggtacaaagtaca 40 ||||||| |||||| |||||||||||||||||| Sbjct: 1880 catatatcaaaagtacacatggtacaaagtaca 1848 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 171 atatgagagcatttattcata 191 ||||||||||||||||||||| Sbjct: 1745 atatgagagcatttattcata 1725
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 331 bits (167), Expect = 1e-87 Identities = 248/275 (90%) Strand = Plus / Minus Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331 |||| ||||||||| |||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273 Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391 | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213 Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451 | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| || Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153 Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511 ||| || ||| | |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93 Query: 512 cataggagatgcaagggctcaaggcagagctcacc 546 ||||||||||||| ||||||||||||||||||||| Sbjct: 92 cataggagatgcaggggctcaaggcagagctcacc 58 Score = 60.0 bits (30), Expect = 8e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 8 catatatnaaaagtgcacatggtacaaagtacaacaaactc 48 ||||||| |||||| |||||||||||||||||| ||||||| Sbjct: 577 catatatcaaaagtacacatggtacaaagtacagcaaactc 537 Score = 60.0 bits (30), Expect = 8e-06 Identities = 49/54 (90%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 83 aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 135 |||||||||||||||||||| ||||||||||||||||| | ||||||||||| Sbjct: 516 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 463 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 171 atatgagagcatttattcatatata 195 ||||||||||||||||||||||||| Sbjct: 437 atatgagagcatttattcatatata 413
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 323 bits (163), Expect = 3e-85 Identities = 247/275 (89%) Strand = Plus / Minus Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331 |||| ||||| ||| |||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374 Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391 |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314 Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451 | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| || Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254 Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511 ||| || ||| | |||||||||||||||||| ||| ||| |||||||||||||||| | Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194 Query: 512 cataggagatgcaagggctcaaggcagagctcacc 546 ||||||||||||| ||||||||||||||||||||| Sbjct: 193 cataggagatgcaggggctcaaggcagagctcacc 159 Score = 60.0 bits (30), Expect = 8e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 8 catatatnaaaagtgcacatggtacaaagtacaacaaactc 48 ||||||| |||||| |||||||||||||||||| ||||||| Sbjct: 680 catatatcaaaagtacacatggtacaaagtacagcaaactc 640 Score = 60.0 bits (30), Expect = 8e-06 Identities = 49/54 (90%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 83 aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 135 |||||||||||||||||||| ||||||||||||||||| | ||||||||||| Sbjct: 619 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 566 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 169 atatatgagagcatttattcatatata 195 ||||||||||||||||||||||||||| Sbjct: 542 atatatgagagcatttattcatatata 516
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 317 bits (160), Expect = 2e-83 Identities = 232/256 (90%) Strand = Plus / Minus Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350 |||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470 ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530 ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 531 caaggcagagctcacc 546 |||||||||||||||| Sbjct: 108 caaggcagagctcacc 93
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 317 bits (160), Expect = 2e-83 Identities = 232/256 (90%) Strand = Plus / Minus Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350 |||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470 ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530 ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| ||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 531 caaggcagagctcacc 546 |||||||||||||||| Sbjct: 108 caaggcagagctcacc 93
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 315 bits (159), Expect = 8e-83 Identities = 246/275 (89%) Strand = Plus / Minus Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331 |||| ||||||||| |||||||| ||||||||||||||||||| |||| ||||||||||| Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565 Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391 |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505 Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451 | |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| || Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445 Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511 ||| || ||| | |||||||||||||||||| ||| || |||||||||||||||| | Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385 Query: 512 cataggagatgcaagggctcaaggcagagctcacc 546 ||||||||||||| ||||||||||||||||||||| Sbjct: 1384 cataggagatgcaggggctcaaggcagagctcacc 1350 Score = 52.0 bits (26), Expect = 0.002 Identities = 31/33 (93%) Strand = Plus / Minus Query: 8 catatatnaaaagtgcacatggtacaaagtaca 40 ||||||| |||||| |||||||||||||||||| Sbjct: 1868 catatatcaaaagtacacatggtacaaagtaca 1836 Score = 52.0 bits (26), Expect = 0.002 Identities = 36/38 (94%), Gaps = 1/38 (2%) Strand = Plus / Minus Query: 83 aacatcgatacaacagtgtg-ccggccatgcagagctg 119 |||||||||| ||||||||| ||||||||||||||||| Sbjct: 1807 aacatcgatataacagtgtggccggccatgcagagctg 1770 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 171 atatgagagcatttattcatatata 195 ||||||||||||||||||||||||| Sbjct: 1733 atatgagagcatttattcatatata 1709
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 293 bits (148), Expect = 3e-76 Identities = 229/256 (89%) Strand = Plus / Minus Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350 ||||||||||||||||||||| ||||| | ||| ||||||||||||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410 | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470 ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||| || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169 Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530 |||||||||||| |||| || ||| |||| ||||||| |||||||||||||| ||||| Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109 Query: 531 caaggcagagctcacc 546 |||||||||||||||| Sbjct: 108 caaggcagagctcacc 93
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 278 bits (140), Expect = 2e-71 Identities = 146/148 (98%) Strand = Plus / Minus Query: 399 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 458 |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226 Query: 459 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166 Query: 519 gatgcaagggctcaaggcagagctcacc 546 |||||||||||||||||||||||||||| Sbjct: 165 gatgcaagggctcaaggcagagctcacc 138
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 153 bits (77), Expect = 7e-34 Identities = 173/205 (84%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | |||||||||||||| ||||| |||||||||| |||||||| |||||||| Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||| Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 ||||| |||| |||||||||||||| ||||||||| | ||| |||||||| |||| | | Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029 Query: 467 cgccgctgcagcaggccacaggcgg 491 | ||| ||||||||| ||||||| Sbjct: 3028 ctccggaacagcaggccccaggcgg 3004 Score = 61.9 bits (31), Expect = 2e-06 Identities = 44/47 (93%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 89 gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 135 |||||||||||| |||||| ||||||||||||||| ||||||||||| Sbjct: 3394 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 153 bits (77), Expect = 7e-34 Identities = 173/205 (84%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | |||||||||||||| ||||| |||||||||| |||||||| |||||||| Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||| Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 ||||| |||| |||||||||||||| ||||||||| | ||| |||||||| |||| | | Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233 Query: 467 cgccgctgcagcaggccacaggcgg 491 | ||| ||||||||| ||||||| Sbjct: 232 ctccggaacagcaggccccaggcgg 208 Score = 61.9 bits (31), Expect = 2e-06 Identities = 44/47 (93%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 89 gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 135 |||||||||||| |||||| ||||||||||||||| ||||||||||| Sbjct: 598 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553 Score = 60.0 bits (30), Expect = 8e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 19 agtgcacatggtacaaagtacaacaaactc 48 |||||||||||||||||||||||||||||| Sbjct: 679 agtgcacatggtacaaagtacaacaaactc 650
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 147 bits (74), Expect = 4e-32 Identities = 164/194 (84%) Strand = Plus / Minus Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357 |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477 |||||||||||||| ||||||||| | ||| |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 478 caggccacaggcgg 491 |||||| ||||||| Sbjct: 161 caggccccaggcgg 148
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 143 bits (72), Expect = 7e-31 Identities = 213/260 (81%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | |||||||||||||| ||||| |||||||| | ||||||||||||||||| Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| ||||||| || || ||||||||| | ||| ||||| || ||| | ||||||| Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 |||| |||| | ||||||||||| ||||||||| | ||| |||||||| | || ||| Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252 Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526 ||||||||||||||||| ||| ||| ||| ||| |||| ||||||| || ||| | Sbjct: 251 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 192 Query: 527 ggctcaaggcagagctcacc 546 || ||||||||||||||||| Sbjct: 191 gggtcaaggcagagctcacc 172 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 acatggtacaaagtacaacaaactc 48 |||| |||||||||||||||||||| Sbjct: 680 acatcgtacaaagtacaacaaactc 656
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 143 bits (72), Expect = 7e-31 Identities = 213/260 (81%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | |||||||||||||| ||||| |||||||| | ||||||||||||||||| Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| ||||||| || || ||||||||| | ||| ||||| || ||| | ||||||| Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 |||| |||| | ||||||||||| ||||||||| | ||| |||||||| | || ||| Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193 Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526 ||||||||||||||||| ||| ||| ||| ||| |||| ||||||| || ||| | Sbjct: 192 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 133 Query: 527 ggctcaaggcagagctcacc 546 || ||||||||||||||||| Sbjct: 132 gggtcaaggcagagctcacc 113
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 139 bits (70), Expect = 1e-29 Identities = 163/194 (84%) Strand = Plus / Minus Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357 ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477 |||||||||||||| ||||||||| | ||| |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 478 caggccacaggcgg 491 |||||| ||||||| Sbjct: 161 caggccccaggcgg 148
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 137 bits (69), Expect = 4e-29 Identities = 159/189 (84%) Strand = Plus / Minus Query: 330 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 389 ||||||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 390 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 449 ||| ||||| |||||||||||| ||||||||||| ||||||||||| |||| || Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190 Query: 450 gccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 509 |||||||| |||| |||||||||||||||||||| ||| ||| |||||||||||||||| Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130 Query: 510 ggcatagga 518 |||||||| Sbjct: 129 tgcatagga 121
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 137 bits (69), Expect = 4e-29 Identities = 204/249 (81%) Strand = Plus / Minus Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357 |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417 || || || ||||||||| | ||| ||||| || ||| | ||||||| |||| |||| Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222 Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477 | ||||||||||| ||||||||| | ||| |||||||| | || |||||||||||||| Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162 Query: 478 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 537 |||||| ||| ||| ||| ||| |||| ||||||| || ||| ||| |||||||| Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102 Query: 538 gagctcacc 546 ||||||||| Sbjct: 101 gagctcacc 93
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 117 bits (59), Expect = 4e-23 Identities = 168/203 (82%), Gaps = 1/203 (0%) Strand = Plus / Minus Query: 278 agcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggga 337 |||| ||| |||||||| | ||||||||||||||||| |||||||| | |||||||| Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372 Query: 338 cgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcag 397 |||||||||||||| |||||||||| || |||||| |||| ||||| | | || ||| Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313 Query: 398 cgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcca 457 | ||||||| |||| |||||| ||||||||||| ||||||||| | ||| |||||||| Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253 Query: 458 gtctcttgacgccgctgcagcag 480 ||||||||| ||||| |||||| Sbjct: 252 atctcttgactccgctacagcag 230 Score = 50.1 bits (25), Expect = 0.008 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 88 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132 ||||||||||||| || ||||||| |||||||||||| ||||||| Sbjct: 582 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 539
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Plus Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080 Query: 362 ttccggcggccttgccagcgtttagccc 389 | | |||||| ||||| ||||| ||||| Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000 Query: 362 ttccggcggccttgccagcgtttagccc 389 | | |||||| ||||| ||||| ||||| Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| |||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 364 ccggcg 369 |||||| Sbjct: 679409 ccggcg 679404 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 692595 tgacgccgctgcagcaggcc 692576
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400 Query: 362 ttccggcggccttgccagcgtttagccc 389 | | |||||| ||||| ||||| ||||| Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399 Query: 362 ttccggcggccttgccagcgtttagccc 389 | | |||||| ||||| ||||| ||||| Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 111 bits (56), Expect = 2e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179 Query: 362 ttccggcggccttgccagcgtttagccc 389 | | |||||| ||||| ||||| ||||| Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| |||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 364 ccggcg 369 |||||| Sbjct: 679409 ccggcg 679404 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 692595 tgacgccgctgcagcaggcc 692576
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 107 bits (54), Expect = 4e-20 Identities = 159/194 (81%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | ||||| ||||||||||| |||||||| | ||||||||||||||||| Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| |||||||||| || |||||| |||| ||||| | | || || | ||||||| Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 |||| |||||| ||||||||||| ||||||||| | ||| |||||||| |||||||| Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175 Query: 467 cgccgctgcagcag 480 | ||||| |||||| Sbjct: 174 ctccgctacagcag 161 Score = 50.1 bits (25), Expect = 0.008 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 88 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132 ||||||||||||| || ||||||| |||||||||||| ||||||| Sbjct: 527 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 484
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 364 ccggcg 369 |||||| Sbjct: 722667 ccggcg 722662 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 732447 tgacgccgctgcagcaggcc 732428
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 364 ccggcg 369 |||||| Sbjct: 722667 ccggcg 722662 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 732447 tgacgccgctgcagcaggcc 732428
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 46578 ctggcggcattgccggcgtt 46597 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466 Query: 364 ccggcg 369 |||||| Sbjct: 56467 ccggcg 56472 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 46687 tgacgccgctgcagcaggcc 46706
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 50268 ctggcggcattgccggcgtt 50287 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| |||||||||| Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562 Query: 364 ccggcg 369 |||||| Sbjct: 63563 ccggcg 63568 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 50377 tgacgccgctgcagcaggcc 50396
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 91.7 bits (46), Expect = 2e-15 Identities = 157/194 (80%) Strand = Plus / Minus Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346 |||||||| | ||||| ||||||||||| |||||||| | ||||||||||||||| | Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366 Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406 ||||| |||||||||| || |||||| | || ||||| | | || || | ||||||| Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306 Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466 |||| |||||| ||||||||||| ||||||||| | ||| |||||||| |||||||| Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246 Query: 467 cgccgctgcagcag 480 | ||||| |||||| Sbjct: 245 ctccgctacagcag 232 Score = 50.1 bits (25), Expect = 0.008 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 88 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132 ||||||||||||| || ||||||| |||||||||||| ||||||| Sbjct: 598 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 555
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 91.7 bits (46), Expect = 2e-15 Identities = 77/86 (89%), Gaps = 1/86 (1%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||| Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354 Query: 364 ccggcggccttgccagcgtttagccc 389 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 409 ctggcggcattgccggcgtt 390 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 300 tgacgccgctgcagcaggcc 281
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 641 ctggcggcattgccggcgtt 622 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 532 tgacgccgctgcagcaggcc 513
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||||||||||||||||| |||||||||| Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 234 ctggcggcgttgccggcgtt 215
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||||||||||||||||| |||||||||| Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 937 ctggcggcgttgccggcgtt 918
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 271 ctggcggcattgccggcgtt 252 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 162 tgacgccgctgcagcaggcc 143
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 594 ctggcggcattgccggcgtt 575 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 485 tgacgccgctgcagcaggcc 466
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 377 ctggcggcattgccggcgtt 358 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 268 tgacgccgctgcagcaggcc 249
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 359 ctggcggcattgccggcgtt 340 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 250 tgacgccgctgcagcaggcc 231
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 77.8 bits (39), Expect = 3e-11 Identities = 63/71 (88%) Strand = Plus / Minus Query: 316 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttg 375 |||| |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||| Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266 Query: 376 ccagcgtttag 386 || |||||||| Sbjct: 265 ccggcgtttag 255 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 168 tgacgccgctgcagcaggcc 149
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906 Query: 364 ccggcggccttgcc 377 | |||||||||||| Sbjct: 905 ctggcggccttgcc 892
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||||||||| |||||||||| Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005 Query: 364 ccggcg 369 |||||| Sbjct: 14437004 ccggcg 14436999
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||||||||| |||||||||| Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503 Query: 364 ccggcg 369 |||||| Sbjct: 45502 ccggcg 45497
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 363 ctggcggcgttgccggcgtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 273 ctggcggcgttgccggcgtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ctcttgacgccgctgcagcag 480 ||||||||||||||||||||| Sbjct: 160 ctcttgacgccgctgcagcag 140
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ctcttgacgccgctgcagcag 480 ||||||||||||||||||||| Sbjct: 160 ctcttgacgccgctgcagcag 140
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 374 ctggcggcgttgccggcgtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 391 ctggcggcgttgccggcgtt 372 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ctcttgacgccgctgcagcag 480 ||||||||||||||||||||| Sbjct: 286 ctcttgacgccgctgcagcag 266
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 354 ctggcggcgttgccggcgtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 69.9 bits (35), Expect = 8e-09 Identities = 56/63 (88%) Strand = Plus / Plus Query: 321 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagc 380 |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| || Sbjct: 97 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156 Query: 381 gtt 383 ||| Sbjct: 157 gtt 159 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 249 tgacgccgctgcagcaggcc 268
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371 Query: 364 ccggcg 369 |||||| Sbjct: 370 ccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457 Query: 364 ccggcg 369 |||||| Sbjct: 3456 ccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| |||||| |||||||||| | ||||||||||| |||||||||| Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373 Query: 364 ccggcg 369 |||||| Sbjct: 372 ccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| |||||||||| Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375 Query: 364 ccggcg 369 |||||| Sbjct: 374 ccggcg 369
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 364 ccggcggc 371 | |||||| Sbjct: 374 ctggcggc 367
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 |||||||||| ||| | |||||||| |||||||| ||||||||||| |||||||||| Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 354 ctggcggcattgccggcgtt 335 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 tgacgccgctgcagcaggcc 483 |||||||||||||||||||| Sbjct: 245 tgacgccgctgcagcaggcc 226
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||| || Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357 Query: 364 ccggcggc 371 | |||||| Sbjct: 356 ctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282 Query: 364 ccggcggc 371 | |||||| Sbjct: 281 ctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381 Query: 364 ccggcggc 371 | |||||| Sbjct: 380 ctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 364 ccggcggc 371 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396 Query: 364 ccggcggc 371 | |||||| Sbjct: 395 ctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 364 ccggcggc 371 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 364 ccggcggc 371 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 364 ccggcggc 371 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 364 ccggcggc 371 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||| ||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||| ||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 364 ccggcggccttgccagcgtt 383 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205 Query: 364 ccggcggc 371 | |||||| Sbjct: 204 ctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 364 ccggcggc 371 | |||||| Sbjct: 391 ctggcggc 384
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363 ||||||||| ||| | |||||||| ||||||| ||||||||||||| |||||||||| Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260 Query: 364 ccggcggc 371 | |||||| Sbjct: 259 ctggcggc 252
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 321 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 369 ||||||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA clone IMAGE:4504353), partial cds Length = 4763 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Plus Query: 467 cgccgctgcagcaggccacagg 488 |||||||||||||||||||||| Sbjct: 367 cgccgctgcagcaggccacagg 388
>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence Length = 43869 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Plus Query: 467 cgccgctgcagcaggccacagg 488 |||||||||||||||||||||| Sbjct: 43282 cgccgctgcagcaggccacagg 43303
>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence Length = 199824 Score = 44.1 bits (22), Expect = 0.47 Identities = 22/22 (100%) Strand = Plus / Plus Query: 467 cgccgctgcagcaggccacagg 488 |||||||||||||||||||||| Sbjct: 52943 cgccgctgcagcaggccacagg 52964
>emb|AL158158.14| Human DNA sequence from clone RP11-427L11 on chromosome 9q31.2-32 Contains the TXN gene for thioredoxin, the gene for a novel protein similar to thioredoxin, the 3' end of the gene for the likely ortholog of mouse polydom (POLYDOM) and two CpG islands, complete sequence Length = 194835 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 tcaaaggaagtaaatattaat 79 ||||||||||||||||||||| Sbjct: 9384 tcaaaggaagtaaatattaat 9364
>gb|AF548001.1| Homo sapiens thioredoxin (TXN) gene, complete cds Length = 15100 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 59 tcaaaggaagtaaatattaat 79 ||||||||||||||||||||| Sbjct: 12943 tcaaaggaagtaaatattaat 12963
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 465 gacgccgctgcagcaggccac 485 ||||||||||||||||||||| Sbjct: 41554621 gacgccgctgcagcaggccac 41554641
>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0614D08 Length = 147548 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 465 gacgccgctgcagcaggccac 485 ||||||||||||||||||||| Sbjct: 110914 gacgccgctgcagcaggccac 110934
>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0660F12 Length = 147203 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 465 gacgccgctgcagcaggccac 485 ||||||||||||||||||||| Sbjct: 122820 gacgccgctgcagcaggccac 122840
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full insert sequence Length = 685 Score = 42.1 bits (21), Expect = 1.9 Identities = 45/53 (84%) Strand = Plus / Minus Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350 ||||| |||||||||||||| | |||||||| | ||| |||| ||||||||| Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full insert sequence Length = 654 Score = 42.1 bits (21), Expect = 1.9 Identities = 45/53 (84%) Strand = Plus / Minus Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350 ||||| |||||||||||||| | |||||||| | ||| |||| ||||||||| Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
>gb|AY109327.1| Zea mays CL468_1 mRNA sequence Length = 2907 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ctcttgacgccgctgcagcag 480 ||||||||||||||||||||| Sbjct: 2805 ctcttgacgccgctgcagcag 2785
>emb|X54541.1|HSTRXE4E5 H.sapiens Trx gene for thioredoxin, exon 4 and exon 5 Length = 1404 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 59 tcaaaggaagtaaatattaat 79 ||||||||||||||||||||| Sbjct: 60 tcaaaggaagtaaatattaat 80
>emb|X70288.1|HSTHDC H.sapiens gene for thioredoxin, exons 4 and 5 Length = 1394 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 59 tcaaaggaagtaaatattaat 79 ||||||||||||||||||||| Sbjct: 31 tcaaaggaagtaaatattaat 51
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 686 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 ctcttgacgccgctgcagcag 480 ||||||||||||||||||||| Sbjct: 155 ctcttgacgccgctgcagcag 135
>gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, complete sequence Length = 186258 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggaagtaaatattaattata 83 |||||||||||||||||||| Sbjct: 19775 ggaagtaaatattaattata 19794
>gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosome 18, complete sequence Length = 170129 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggaagtaaatattaattata 83 |||||||||||||||||||| Sbjct: 23067 ggaagtaaatattaattata 23048
>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence Length = 161430 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 aagtgcacatggtacaaagtacaa 41 ||||||||||||||||||| |||| Sbjct: 70159 aagtgcacatggtacaaagcacaa 70182
>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3' end of a novel gene, complete sequence Length = 128843 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 cacatggagataatatatga 176 |||||||||||||||||||| Sbjct: 114026 cacatggagataatatatga 114007
>emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on chromosome 13, complete sequence Length = 132436 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 aaggaagtaaatattaatta 81 |||||||||||||||||||| Sbjct: 74392 aaggaagtaaatattaatta 74373
>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG island, complete sequence Length = 162575 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tggagataatatatgagagc 180 |||||||||||||||||||| Sbjct: 31942 tggagataatatatgagagc 31961
>gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete sequence Length = 150117 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 aagtgcacatggtacaaagtacaa 41 ||||||||||||||||||| |||| Sbjct: 66671 aagtgcacatggtacaaagcacaa 66694
>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130 Length = 3692 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 1826 agcaaggatgacagcaagtg 1807
>gb|AC110774.3| Homo sapiens BAC clone RP11-254A24 from 4, complete sequence Length = 121016 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 54 tcctctcaaaggaagtaaat 73 |||||||||||||||||||| Sbjct: 18205 tcctctcaaaggaagtaaat 18186
>gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, complete sequence Length = 118837 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 agtaaatattaattataaca 86 |||||||||||||||||||| Sbjct: 82647 agtaaatattaattataaca 82628
>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold Length = 2136267 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 aagtgcacatggtacaaagtacaa 41 ||||||||||||||||||| |||| Sbjct: 1753936 aagtgcacatggtacaaagcacaa 1753959
>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2, complete sequence Length = 146298 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tggagataatatatgagagc 180 |||||||||||||||||||| Sbjct: 85666 tggagataatatatgagagc 85685
>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence Length = 109398 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 100675 agcaaggatgacagcaagtg 100694
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 427 ttgtcagcggtgctctgggc 446 |||||||||||||||||||| Sbjct: 11569463 ttgtcagcggtgctctgggc 11569482
>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence Length = 206852 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 90670 agcaaggatgacagcaagtg 90651
>gb|AC148962.4| Atelerix albiventris clone LB4-372K23, complete sequence Length = 54256 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 aagtgcacatggtacaaagtacaa 41 ||||||||||||||||||| |||| Sbjct: 24977 aagtgcacatggtacaaagcacaa 25000
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1034_C08 Length = 154441 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 427 ttgtcagcggtgctctgggc 446 |||||||||||||||||||| Sbjct: 123597 ttgtcagcggtgctctgggc 123616
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0467G09 Length = 158204 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 427 ttgtcagcggtgctctgggc 446 |||||||||||||||||||| Sbjct: 29734 ttgtcagcggtgctctgggc 29753
>gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complete sequence Length = 193738 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 attcctctcaaaggaagtaa 71 |||||||||||||||||||| Sbjct: 83149 attcctctcaaaggaagtaa 83130
>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete sequence Length = 211750 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 90149 agcaaggatgacagcaagtg 90168
>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete sequence Length = 156583 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 142238 agcaaggatgacagcaagtg 142257
>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region, section 6/19 Length = 100000 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 agcaaggatgacagcaagtg 285 |||||||||||||||||||| Sbjct: 19820 agcaaggatgacagcaagtg 19801 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,565,761 Number of Sequences: 3902068 Number of extensions: 3565761 Number of successful extensions: 71884 Number of sequences better than 10.0: 143 Number of HSP's better than 10.0 without gapping: 145 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 71264 Number of HSP's gapped (non-prelim): 609 length of query: 546 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 523 effective length of database: 17,143,297,704 effective search space: 8965944699192 effective search space used: 8965944699192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)