ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38p10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009027.1| Triticum aestivum clone wdk3c.pk021.e13:fis, full... 137 2e-29
2gb|AC158310.3| Mus musculus chromosome 5, clone RP23-106N8, comp... 44 0.18
3gb|AC105987.21| Mus musculus chromosome 5, clone RP24-446I1, com... 44 0.18
4gb|AC011944.12| Homo sapiens chromosome 15, clone RP11-16K12, co... 42 0.71
5gb|AC112965.10| Mus musculus chromosome 1, clone RP24-95N17, com... 40 2.8
6emb|CT025848.6| Mouse DNA sequence from clone RP24-326K2 on chro... 40 2.8
7gb|AC116371.5| Mus musculus chromosome 17, clone RP24-228A1, com... 40 2.8

>gb|BT009027.1| Triticum aestivum clone wdk3c.pk021.e13:fis, full insert mRNA
            sequence
          Length = 1612

 Score =  137 bits (69), Expect = 2e-29
 Identities = 175/207 (84%), Gaps = 14/207 (6%)
 Strand = Plus / Minus

                                                                        
Query: 19   ctccaacatgcacccaatcttatatagagacgacatacaacaacagaata----taaaca 74
            |||||||||||||||||||    |||||| ||| ||||||||||| ||||    ||||||
Sbjct: 1538 ctccaacatgcacccaatc----atagaggcgatatacaacaacaaaatacttataaaca 1483

                                                                        
Query: 75   tgaccntacggttcccactgctagcagcatacagtctttagcataactatggtttcatcc 134
            ||||  ||||||||| ||||||||||||||||||||||||||||| ||| ||||| ||||
Sbjct: 1482 tgac-atacggttcc-actgctagcagcatacagtctttagcatagctagggtttgatcc 1425

                                                                        
Query: 135  gctacagaacgtagcagaagccaccgatccttctttcatcttggccacatgcaccaccaa 194
            |||||  | | || |||| || ||| ||||    |||||| |||||||||||||||||| 
Sbjct: 1424 gctaccaagcataacagatgcaacctatcc----ttcatcctggccacatgcaccaccac 1369

                                       
Query: 195  ttcttcatcttgcccacatgcaaggga 221
            |||||||||||| ||||||||||||||
Sbjct: 1368 ttcttcatcttggccacatgcaaggga 1342



to top

>gb|AC158310.3| Mus musculus chromosome 5, clone RP23-106N8, complete sequence
          Length = 218714

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 136    ctacagaacgtagcagaagcca 157
              ||||||||||||||||||||||
Sbjct: 119408 ctacagaacgtagcagaagcca 119429



to top

>gb|AC105987.21| Mus musculus chromosome 5, clone RP24-446I1, complete sequence
          Length = 192043

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 136    ctacagaacgtagcagaagcca 157
              ||||||||||||||||||||||
Sbjct: 145261 ctacagaacgtagcagaagcca 145240



to top

>gb|AC011944.12| Homo sapiens chromosome 15, clone RP11-16K12, complete sequence
          Length = 166309

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 163  ccttctttcatcttggccaca 183
            |||||||||||||||||||||
Sbjct: 7431 ccttctttcatcttggccaca 7451



to top

>gb|AC112965.10| Mus musculus chromosome 1, clone RP24-95N17, complete sequence
          Length = 158782

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   gccacatgcaccaccaattc 197
             ||||||||||||||||||||
Sbjct: 87170 gccacatgcaccaccaattc 87151



to top

>emb|CT025848.6| Mouse DNA sequence from clone RP24-326K2 on chromosome 17, complete
              sequence
          Length = 172896

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 162    tccttctttcatcttggcca 181
              ||||||||||||||||||||
Sbjct: 126860 tccttctttcatcttggcca 126841



to top

>gb|AC116371.5| Mus musculus chromosome 17, clone RP24-228A1, complete sequence
          Length = 109222

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 162    tccttctttcatcttggcca 181
              ||||||||||||||||||||
Sbjct: 104840 tccttctttcatcttggcca 104859


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,061,124
Number of Sequences: 3902068
Number of extensions: 2061124
Number of successful extensions: 133229
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 133206
Number of HSP's gapped (non-prelim): 20
length of query: 221
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 199
effective length of database: 17,147,199,772
effective search space: 3412292754628
effective search space used: 3412292754628
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top