| Clone Name | rbags38o14 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL136000.4|CNS01DVQ Human chromosome 14 DNA sequence BAC R-860P2 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 201587 Score = 42.1 bits (21), Expect = 1.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 aaatcaacagaaacaaagtggacga 95 ||||| ||||||||||||||||||| Sbjct: 49007 aaatctacagaaacaaagtggacga 48983
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete genome Length = 3397754 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 233 cgatgtaaaacatgatgacg 252 |||||||||||||||||||| Sbjct: 3013429 cgatgtaaaacatgatgacg 3013410
>gb|AC163746.5| Mus musculus BAC clone RP23-394B5 from chromosome 17, complete sequence Length = 199852 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tctaaaaataattcttgggt 48 |||||||||||||||||||| Sbjct: 53445 tctaaaaataattcttgggt 53464
>gb|AC163687.5| Mus musculus BAC clone RP23-3H13 from chromosome 17, complete sequence Length = 220643 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tctaaaaataattcttgggt 48 |||||||||||||||||||| Sbjct: 177827 tctaaaaataattcttgggt 177846
>gb|AC163285.3| Mus musculus BAC clone RP23-379H2 from chromosome 16, complete sequence Length = 184951 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 tctaaaaataattcttgggt 48 |||||||||||||||||||| Sbjct: 123697 tctaaaaataattcttgggt 123678
>emb|AL451065.13| Human DNA sequence from clone RP11-274J16 on chromosome 9 Contains the 3' end of the FGD3 gene for FGD1 family, member 3 (FLJ00004), a novel gene, a novel gene (MGC26847), a novel gene (MGC11115), the NINJ1 gene for ninjurin 1 and three CpG islands, complete sequence Length = 163689 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 caacagaaacaaagtggacg 94 |||||||||||||||||||| Sbjct: 157062 caacagaaacaaagtggacg 157081
>emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chromosome 9 Contains the 3' emd of novel gene (MGC11115), the NINJ1 gene for ninjurin 1, a novel gene, the 5' end of the PRKWNK2 gene for protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) and two CpG islands, complete sequence Length = 175797 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 caacagaaacaaagtggacg 94 |||||||||||||||||||| Sbjct: 39103 caacagaaacaaagtggacg 39122
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome Length = 3345687 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 233 cgatgtaaaacatgatgacg 252 |||||||||||||||||||| Sbjct: 2960248 cgatgtaaaacatgatgacg 2960229
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome Length = 3503610 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 233 cgatgtaaaacatgatgacg 252 |||||||||||||||||||| Sbjct: 3100509 cgatgtaaaacatgatgacg 3100490
>emb|AL445563.1|MPULM01 Mycoplasma pulmonis (strain UAB CTIP) complete genome; segment 1/3 Length = 327650 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 aactctaaaaataattcttg 45 |||||||||||||||||||| Sbjct: 82975 aactctaaaaataattcttg 82994
>emb|BX537275.8| Zebrafish DNA sequence from clone DKEYP-120E12 in linkage group 11, complete sequence Length = 173631 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 cttggattactctagtgaaa 73 |||||||||||||||||||| Sbjct: 87398 cttggattactctagtgaaa 87417
>gb|AC154427.2| Mus musculus BAC clone RP24-200D20 from 16, complete sequence Length = 163687 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 tctaaaaataattcttgggt 48 |||||||||||||||||||| Sbjct: 42076 tctaaaaataattcttgggt 42057
>emb|AL935040.6| Zebrafish DNA sequence from clone CH211-176L21, complete sequence Length = 159468 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 cttggattactctagtgaaa 73 |||||||||||||||||||| Sbjct: 88994 cttggattactctagtgaaa 89013
>emb|AL805933.7| Mouse DNA sequence from clone RP23-31P9 on chromosome X, complete sequence Length = 209410 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tctaaaaataattcttgggt 48 |||||||||||||||||||| Sbjct: 155393 tctaaaaataattcttgggt 155412 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,400,065 Number of Sequences: 3902068 Number of extensions: 2400065 Number of successful extensions: 45735 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45681 Number of HSP's gapped (non-prelim): 54 length of query: 304 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 282 effective length of database: 17,147,199,772 effective search space: 4835510335704 effective search space used: 4835510335704 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)