ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38o14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL136000.4|CNS01DVQ Human chromosome 14 DNA sequence BAC R-8... 42 1.0
2gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 40 4.0
3gb|AC163746.5| Mus musculus BAC clone RP23-394B5 from chromosome... 40 4.0
4gb|AC163687.5| Mus musculus BAC clone RP23-3H13 from chromosome ... 40 4.0
5gb|AC163285.3| Mus musculus BAC clone RP23-379H2 from chromosome... 40 4.0
6emb|AL451065.13| Human DNA sequence from clone RP11-274J16 on ch... 40 4.0
7emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chr... 40 4.0
8emb|CR628337.1| Legionella pneumophila str. Lens complete genome 40 4.0
9emb|CR628336.1| Legionella pneumophila str. Paris complete genome 40 4.0
10emb|AL445563.1|MPULM01 Mycoplasma pulmonis (strain UAB CTIP) com... 40 4.0
11emb|BX537275.8| Zebrafish DNA sequence from clone DKEYP-120E12 i... 40 4.0
12gb|AC154427.2| Mus musculus BAC clone RP24-200D20 from 16, compl... 40 4.0
13emb|AL935040.6| Zebrafish DNA sequence from clone CH211-176L21, ... 40 4.0
14emb|AL805933.7| Mouse DNA sequence from clone RP23-31P9 on chrom... 40 4.0

>emb|AL136000.4|CNS01DVQ Human chromosome 14 DNA sequence BAC R-860P2 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 201587

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 71    aaatcaacagaaacaaagtggacga 95
             ||||| |||||||||||||||||||
Sbjct: 49007 aaatctacagaaacaaagtggacga 48983



to top

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 233     cgatgtaaaacatgatgacg 252
               ||||||||||||||||||||
Sbjct: 3013429 cgatgtaaaacatgatgacg 3013410



to top

>gb|AC163746.5| Mus musculus BAC clone RP23-394B5 from chromosome 17, complete sequence
          Length = 199852

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    tctaaaaataattcttgggt 48
             ||||||||||||||||||||
Sbjct: 53445 tctaaaaataattcttgggt 53464



to top

>gb|AC163687.5| Mus musculus BAC clone RP23-3H13 from chromosome 17, complete sequence
          Length = 220643

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     tctaaaaataattcttgggt 48
              ||||||||||||||||||||
Sbjct: 177827 tctaaaaataattcttgggt 177846



to top

>gb|AC163285.3| Mus musculus BAC clone RP23-379H2 from chromosome 16, complete sequence
          Length = 184951

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     tctaaaaataattcttgggt 48
              ||||||||||||||||||||
Sbjct: 123697 tctaaaaataattcttgggt 123678



to top

>emb|AL451065.13| Human DNA sequence from clone RP11-274J16 on chromosome 9 Contains the 3'
              end of the FGD3 gene for FGD1 family, member 3 (FLJ00004),
              a novel gene, a novel gene (MGC26847), a novel gene
              (MGC11115), the NINJ1 gene for ninjurin 1 and three CpG
              islands, complete sequence
          Length = 163689

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     caacagaaacaaagtggacg 94
              ||||||||||||||||||||
Sbjct: 157062 caacagaaacaaagtggacg 157081



to top

>emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chromosome 9 Contains the
             3' emd of novel gene (MGC11115), the NINJ1 gene for
             ninjurin 1, a novel gene, the 5' end of the PRKWNK2 gene
             for protein kinase, lysine deficient 2 (WNK2, NY-CO-43,
             SDCCAG43, P/OKcl.13) and two CpG islands, complete
             sequence
          Length = 175797

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    caacagaaacaaagtggacg 94
             ||||||||||||||||||||
Sbjct: 39103 caacagaaacaaagtggacg 39122



to top

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 233     cgatgtaaaacatgatgacg 252
               ||||||||||||||||||||
Sbjct: 2960248 cgatgtaaaacatgatgacg 2960229



to top

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 233     cgatgtaaaacatgatgacg 252
               ||||||||||||||||||||
Sbjct: 3100509 cgatgtaaaacatgatgacg 3100490



to top

>emb|AL445563.1|MPULM01 Mycoplasma pulmonis (strain UAB CTIP) complete genome; segment 1/3
          Length = 327650

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    aactctaaaaataattcttg 45
             ||||||||||||||||||||
Sbjct: 82975 aactctaaaaataattcttg 82994



to top

>emb|BX537275.8| Zebrafish DNA sequence from clone DKEYP-120E12 in linkage group 11,
             complete sequence
          Length = 173631

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    cttggattactctagtgaaa 73
             ||||||||||||||||||||
Sbjct: 87398 cttggattactctagtgaaa 87417



to top

>gb|AC154427.2| Mus musculus BAC clone RP24-200D20 from 16, complete sequence
          Length = 163687

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    tctaaaaataattcttgggt 48
             ||||||||||||||||||||
Sbjct: 42076 tctaaaaataattcttgggt 42057



to top

>emb|AL935040.6| Zebrafish DNA sequence from clone CH211-176L21, complete sequence
          Length = 159468

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    cttggattactctagtgaaa 73
             ||||||||||||||||||||
Sbjct: 88994 cttggattactctagtgaaa 89013



to top

>emb|AL805933.7| Mouse DNA sequence from clone RP23-31P9 on chromosome X, complete
              sequence
          Length = 209410

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     tctaaaaataattcttgggt 48
              ||||||||||||||||||||
Sbjct: 155393 tctaaaaataattcttgggt 155412


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,400,065
Number of Sequences: 3902068
Number of extensions: 2400065
Number of successful extensions: 45735
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45681
Number of HSP's gapped (non-prelim): 54
length of query: 304
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 282
effective length of database: 17,147,199,772
effective search space: 4835510335704
effective search space used: 4835510335704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top