ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38l01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC120559.10| Mus musculus chromosome 9, clone RP24-566A4, com... 42 0.73
2gb|AC165156.3| Mus musculus BAC clone RP23-298I7 from chromosome... 42 0.73
3emb|CT009720.16| Mouse DNA sequence from clone RP23-21J17 on chr... 42 0.73
4gb|AC137978.8| Mus musculus chromosome 1, clone RP24-468M12, com... 40 2.9
5gb|AC157794.3| Mus musculus chromosome 1, clone RP24-111L14, com... 40 2.9
6emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on ch... 40 2.9
7gb|AC129933.13| Mus musculus chromosome 1, clone RP23-234P14, co... 40 2.9

>gb|AC120559.10| Mus musculus chromosome 9, clone RP24-566A4, complete sequence
          Length = 141300

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 195   aagccagtcagttgaatatat 215
             |||||||||||||||||||||
Sbjct: 33279 aagccagtcagttgaatatat 33259



to top

>gb|AC165156.3| Mus musculus BAC clone RP23-298I7 from chromosome 9, complete sequence
          Length = 198962

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 195   aagccagtcagttgaatatat 215
             |||||||||||||||||||||
Sbjct: 37388 aagccagtcagttgaatatat 37408



to top

>emb|CT009720.16| Mouse DNA sequence from clone RP23-21J17 on chromosome 9, complete
              sequence
          Length = 216098

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 195    aagccagtcagttgaatatat 215
              |||||||||||||||||||||
Sbjct: 179217 aagccagtcagttgaatatat 179237



to top

>gb|AC137978.8| Mus musculus chromosome 1, clone RP24-468M12, complete sequence
          Length = 181633

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 159   ctgcaaagtaacagagcttc 178
             ||||||||||||||||||||
Sbjct: 78376 ctgcaaagtaacagagcttc 78357



to top

>gb|AC157794.3| Mus musculus chromosome 1, clone RP24-111L14, complete sequence
          Length = 157029

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    ctgcaaagtaacagagcttc 178
              ||||||||||||||||||||
Sbjct: 111829 ctgcaaagtaacagagcttc 111848



to top

>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the
              5' end of the Lpo gene for lactoperoxidase, a novel gene,
              the Epx gene for eosinophil peroxidase, the Olfr462,
              Olfr463 and Olfr464 genes for olfactory receptors 462, 463
              and 464, a novel gene, a cytochrome c oxidase subunit VIc
              (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S.
              cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end
              of the gene for dynein light chain 2 (6720463E02Rik),
              complete sequence
          Length = 184069

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 1      caatacaatacacatcatgcagac 24
              |||||||||||||||||| |||||
Sbjct: 144224 caatacaatacacatcatacagac 144201



to top

>gb|AC129933.13| Mus musculus chromosome 1, clone RP23-234P14, complete sequence
          Length = 247595

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 159    ctgcaaagtaacagagcttc 178
              ||||||||||||||||||||
Sbjct: 239375 ctgcaaagtaacagagcttc 239356


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,777,697
Number of Sequences: 3902068
Number of extensions: 1777697
Number of successful extensions: 113221
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 113202
Number of HSP's gapped (non-prelim): 19
length of query: 227
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 205
effective length of database: 17,147,199,772
effective search space: 3515175953260
effective search space used: 3515175953260
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top