ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags38k18 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK121233.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093E21, full insert sequence Length = 935 Score = 434 bits (219), Expect = e-118 Identities = 336/375 (89%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 602 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 543 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 542 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 483 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| ||| Sbjct: 482 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 423 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| || Sbjct: 422 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 363 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 || ||||| |||||||| |||||||| || |||||||||||||||||||||||||||||| Sbjct: 362 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 303 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 302 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 243 Query: 648 atgacccccatggac 662 || || ||||||||| Sbjct: 242 atcacgcccatggac 228
>dbj|AK105044.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H05, full insert sequence Length = 1025 Score = 434 bits (219), Expect = e-118 Identities = 336/375 (89%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 671 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 612 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 611 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 552 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| ||| Sbjct: 551 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 492 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| || Sbjct: 491 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 432 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 || ||||| |||||||| |||||||| || |||||||||||||||||||||||||||||| Sbjct: 431 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 372 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 371 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 312 Query: 648 atgacccccatggac 662 || || ||||||||| Sbjct: 311 atcacgcccatggac 297
>gb|U27098.1|OSU27098 Oryza sativa vacuolar H+-ATPase (vatp-P1) mRNA, complete cds Length = 915 Score = 434 bits (219), Expect = e-118 Identities = 336/375 (89%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 612 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 553 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 552 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 493 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || ||||| |||||||| |||||||||||||| ||||| |||||||| ||||| ||| Sbjct: 492 tgctgtgcatttgccctgacaccagcatcaccgacgatgccgatggccattccggcagcg 433 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||||||||||||||||||||| || ||||| ||||||||||| |||||| || Sbjct: 432 agaccggcgaggccacaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtag 373 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 || ||||| |||||||| |||||||| || |||||||||||||||||||||||||||||| Sbjct: 372 tacggcttagccttggggttgatccctgtactgatgatgacggcgatgatgaggccgtag 313 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || |||||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 312 ataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 253 Query: 648 atgacccccatggac 662 || || ||||||||| Sbjct: 252 atcacgcccatggac 238
>gb|AF416606.1| Pennisetum glaucum vacuolar H+-ATPase 16 kDa proteolipid subunit c (VATPc) mRNA, complete cds Length = 833 Score = 406 bits (205), Expect = e-110 Identities = 334/377 (88%) Strand = Plus / Minus Query: 286 gcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagac 345 |||||||||| || ||||| ||||| |||||||| ||||||||||||||||||||||||| Sbjct: 540 gcgcctaatcggcacgggattggccagcacgggacgagaggatgatgcccacgatgagac 481 Query: 346 cgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttg 405 |||| || || ||||| |||||||||||||||||||| ||||| ||||| || ||||| | Sbjct: 480 cgtagagagcaagcgcctctgcgaaaatgagaatgagaatcattcccacaaatagcttcg 421 Query: 406 gttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcgg 465 | ||||| || || |||||||||||||| |||||||| ||||| ||||||||||| |||| Sbjct: 420 gctgttgtgcgtttgccctgactccagcgtcaccgacgatgccgatggccatgccagcgg 361 Query: 466 cgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagga 525 | ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||| Sbjct: 360 caagccccgcgagaccacaagcgagcccagacgagaggtgcgcgtagccatcgaagaggt 301 Query: 526 agtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgt 585 |||| |||||||||||||| ||||||||||| |||||||||||||| |||||||| |||| Sbjct: 300 agtatggcttggccttggggttgatcccggtactgatgatgacggcaatgatgagtccgt 241 Query: 586 agattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggcc 645 |||| |||||||| || |||||||| |||||||||||||||||||| ||||||||||||| Sbjct: 240 agataccgagcacaccagccatgaccacgggcacgatggacttcatcacgagctccggcc 181 Query: 646 gcatgacccccatggac 662 |||| || ||||||||| Sbjct: 180 gcatcacacccatggac 164
>gb|AY106139.1| Zea mays PCO154307 mRNA sequence Length = 1097 Score = 402 bits (203), Expect = e-109 Identities = 332/375 (88%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||| ||||| || ||||||||||| |||||||||||||||||||| |||||||||||| Sbjct: 732 gcctagtccgcacgagactggccggcgcgggatgagaggatgatgccgacgatgagaccg 673 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || |||||||||||||| ||||| ||||| ||||||||||| ||||| ||||||||||| Sbjct: 672 tatagggcgagcgcttcagcgaagatgaggatgaggatcatgcccacaaacagctttggc 613 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || || || |||||||| ||||||||||| || ||||||||||||||||| || || Sbjct: 612 tgctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagca 553 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 ||||| || || |||||||| || ||||| || || ||||| |||||||| |||||| || Sbjct: 552 agcccagcaagaccacaggcaaggccggacgacaggtgggcatagccgtcaaagaggtag 493 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 || |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| Sbjct: 492 tatggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtag 433 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || |||||||| || |||||||| ||||||||||||||||||||||||||||| || ||| Sbjct: 432 ataccgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgc 373 Query: 648 atgacccccatggac 662 ||||| ||||||||| Sbjct: 372 atgacacccatggac 358
>dbj|AK119725.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-H04, full insert sequence Length = 1000 Score = 387 bits (195), Expect = e-104 Identities = 327/371 (88%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 699 gcctaatccgcacgagattggcctgcgcgggatgacaggatgatgccgacgatgagccca 640 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 639 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 580 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || || || ||||||||||| || ||||| || |||||||||||||| ||||| ||| Sbjct: 579 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 520 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||||||||||||||| || || ||||| || |||||||||||||||||| || Sbjct: 519 agaccggcgaggccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 460 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| Sbjct: 459 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 400 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 399 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 340 Query: 648 atgacccccat 658 || |||||||| Sbjct: 339 atcacccccat 329
>gb|M73232.1|ASTATPASEH Avena sativa vacuolar H+-ATPase 16 kDa proteolipid subunit (vatp-P1) mRNA, complete cds Length = 821 Score = 387 bits (195), Expect = e-104 Identities = 327/371 (88%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || ||||| ||||| || |||||||| ||||||||||| || ||||| || Sbjct: 627 gcctaatcggcacgggattggccagctcgggatgataggatgatgccgacaatgaggcca 568 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || |||||||| |||||||| ||||| ||||||||||| || || |||| ||| || Sbjct: 567 tacagagcgagcgcctctgcgaagatgaggatgaggatcatgccaacaaacaacttcggc 508 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || ||||| |||||||||||||||||||| || ||||| |||||||| || || || Sbjct: 507 tgctgagcatttgccctgactccagcatcaccaacgatgccgatggccattccagcagca 448 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 ||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||| Sbjct: 447 agcccggcgaggccacatgcgagcccggatgagaggtgggcgtagccgtcgaagaggaag 388 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 ||||||||||||||||| ||||||||||| ||||||||||||||||| ||||| |||||| Sbjct: 387 tagggcttggccttggggttgatcccggtactgatgatgacggcgataatgagcccgtag 328 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || |||||||| || ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 327 ataccgagcacaccagccatgacgacgggcacgatggacttcatgacgagctccgggcgc 268 Query: 648 atgacccccat 658 ||||| ||||| Sbjct: 267 atgactcccat 257
>gb|AY106384.1| Zea mays PCO086002 mRNA sequence Length = 924 Score = 381 bits (192), Expect = e-102 Identities = 327/372 (87%) Strand = Plus / Minus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 |||||| ||||| || ||||| |||||||||||||| ||||| || |||||||||||||| Sbjct: 673 ctaatcggcgcgagattggcctgcacgggatgagagaatgataccgacgatgagaccgta 614 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 || || || ||||||||||| || || || || ||||| ||||| |||| |||||| || Sbjct: 613 cagagcaagagcttctgcgaagataaggatcagaatcatgcccacaaacaactttggctg 554 Query: 410 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 469 || ||||| ||||| ||||| || || ||||| ||||| |||||||||||||| ||||| Sbjct: 553 ctgtgcattcgccctaactccggcgtctccgacgatgccgatggccatgccggcagcgag 494 Query: 470 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 529 || |||||||| |||||||| ||||||||||| || ||||||||||||||||||||||| Sbjct: 493 gccagcgaggccgcaggcgagtccggaggagaggtgcgcgtagccgtcgaagaggaagta 434 Query: 530 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 589 ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| Sbjct: 433 gggcttggccttggggttgatcccggtggagatgatgacggcgatgatgaggccgtagat 374 Query: 590 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||| |||||||||||||||||||| ||||||||||||||||||||||| || ||||| Sbjct: 373 gccgagtactcccgccatgacgacggggacgatggacttcatgacgagctcggggcgcat 314 Query: 650 gacccccatgga 661 ||| |||||||| Sbjct: 313 gacgcccatgga 302
>dbj|AK104011.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-B07, full insert sequence Length = 1039 Score = 379 bits (191), Expect = e-102 Identities = 326/371 (87%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 742 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 683 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 682 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 623 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || || || ||||||||||| || ||||| || |||||||||||||| ||||| ||| Sbjct: 622 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 563 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||| ||||||||||| || || ||||| || |||||||||||||||||| || Sbjct: 562 agaccggcgagaccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 503 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| Sbjct: 502 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 443 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 442 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 383 Query: 648 atgacccccat 658 || |||||||| Sbjct: 382 atcacccccat 372
>dbj|AK071641.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023106A11, full insert sequence Length = 1081 Score = 379 bits (191), Expect = e-102 Identities = 326/371 (87%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 779 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 720 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 719 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 660 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 || || || || ||||||||||| || ||||| || |||||||||||||| ||||| ||| Sbjct: 659 tgctgggcgttcgccctgactccggcgtcaccaacgatgccaatggccattccggcagcg 600 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || ||||| ||||||||||| || || ||||| || |||||||||||||||||| || Sbjct: 599 agaccggcgagaccacaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtag 540 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| Sbjct: 539 tagggcttggccttggggttgatccccgtgctgatgatgactgcgatgatgaggccgtag 480 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || || ||||| || |||||||| |||||||||||||||||||| ||||||||||| ||| Sbjct: 479 atacccagcacaccagccatgaccacgggcacgatggacttcatcacgagctccgggcgc 420 Query: 648 atgacccccat 658 || |||||||| Sbjct: 419 atcacccccat 409
>ref|XM_466150.1| Oryza sativa (japonica cultivar-group), mRNA Length = 883 Score = 375 bits (189), Expect = e-100 Identities = 324/369 (87%) Strand = Plus / Minus Query: 294 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 353 ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || Sbjct: 632 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 573 Query: 354 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 413 || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| Sbjct: 572 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 513 Query: 414 gcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagcccc 473 ||||| |||||||| || || || ||||| ||||| |||||||| ||||||||||| || Sbjct: 512 gcatttgccctgacgccggcgtcgccgacgatgccgatggccatcccggcggcgaggccg 453 Query: 474 gcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggc 533 |||||||| || ||||| ||||||||||| || ||||||||||||||||||||||||||| Sbjct: 452 gcgaggccgcacgcgaggccggaggagaggtgcgcgtagccgtcgaagaggaagtagggc 393 Query: 534 ttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccg 593 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 392 ttggccttggggttgatcccggtgctgatgatgacggcgatgatgaggccgtagatcccg 333 Query: 594 agcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacc 653 ||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 332 agcaccccggccatgacgacgggcacgatggatttcatgacgagctccgggcgcatgacg 273 Query: 654 cccatggac 662 ||||||||| Sbjct: 272 cccatggac 264
>gb|AF286464.1|AF286464 Porteresia coarctata V-ATPase subunit c (PVA1) mRNA, complete cds Length = 876 Score = 369 bits (186), Expect = 8e-99 Identities = 333/382 (87%) Strand = Plus / Minus Query: 281 gcaaggcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgat 340 |||||| || ||||| || ||||| || || |||||||||||||||||||||||||| || Sbjct: 578 gcaaggtgcttaatctgcacgggattgaccagcacgggatgagaggatgatgcccacaat 519 Query: 341 gagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||||| || || || || ||||| ||||||||||| ||||||||||| |||||||| || Sbjct: 518 gagaccatacagagcaagagcttcagcgaaaatgaggatgaggatcatgcccacgaaaag 459 Query: 401 ctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgcc 460 |||||||||||| ||||| ||||| || |||||||||||||| ||||| ||||||||||| Sbjct: 458 ctttggttgttgtgcatttgccctaacaccagcatcaccgacgatgccgatggccatgcc 399 Query: 461 ggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaa 520 |||||||| || || ||||||||||| ||||| ||||||||||| ||||| || ||||| Sbjct: 398 tgcggcgagaccagcaaggccacaggcaagccctgaggagagatgcgcgtatccatcgaa 339 Query: 521 gaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgag 580 |||| |||| ||||| |||||||| || |||||||| |||||||||||||| ||||| || Sbjct: 338 gaggtagtacggcttcgccttggggttaatcccggtactgatgatgacggcaatgataag 279 Query: 581 gccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctc 640 |||||||| |||||||| || ||||||||||| |||||||||||||||||||||||||| Sbjct: 278 cccgtagataccgagcacaccagccatgacgactggcacgatggacttcatgacgagctc 219 Query: 641 cggccgcatgacccccatggac 662 || ||||| || ||||||||| Sbjct: 218 ggggcgcatcacacccatggac 197 Score = 52.0 bits (26), Expect = 0.002 Identities = 58/66 (87%), Gaps = 2/66 (3%) Strand = Plus / Minus Query: 41 tttattcaccaccaataggattaaaacccatattcccaggagcagc-aatccagcctacc 99 |||||||||||| ||||||||| ||| |||| | | |||||||||| ||||||||||| | Sbjct: 799 tttattcaccacgaataggatt-aaatccatttgctcaggagcagcaaatccagcctaac 741 Query: 100 ccaaaa 105 |||||| Sbjct: 740 ccaaaa 735
>dbj|AK099459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023C24, full insert sequence Length = 883 Score = 367 bits (185), Expect = 3e-98 Identities = 323/369 (87%) Strand = Plus / Minus Query: 294 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 353 ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || Sbjct: 632 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 573 Query: 354 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 413 || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| Sbjct: 572 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 513 Query: 414 gcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagcccc 473 ||||| |||||||| || || || ||||| ||||| ||||||| ||||||||||| || Sbjct: 512 gcatttgccctgacgccggcgtcgccgacgatgccgttggccatcccggcggcgaggccg 453 Query: 474 gcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggc 533 |||||||| || ||||| ||||||||||| || ||||||||||||||||||||||||||| Sbjct: 452 gcgaggccgcacgcgaggccggaggagaggtgcgcgtagccgtcgaagaggaagtagggc 393 Query: 534 ttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccg 593 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 392 ttggccttggggttgatcccggtgctgatgatgacggcgatgatgaggccgtagatcccg 333 Query: 594 agcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacc 653 ||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 332 agcaccccggccatgacgacgggcacgatggatttcatgacgagctccgggcgcatgacg 273 Query: 654 cccatggac 662 ||||||||| Sbjct: 272 cccatggac 264
>gb|BT017938.1| Zea mays clone EL01N0520G10.c mRNA sequence Length = 983 Score = 365 bits (184), Expect = 1e-97 Identities = 322/368 (87%) Strand = Plus / Minus Query: 291 taatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaa 350 ||||| || ||||| || || ||||||||||| ||||| || || || ||||||||||| Sbjct: 646 taatctgcccgggattgaccagcacgggatgaaaggataattccaacaatgagaccgtac 587 Query: 351 agggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgt 410 || || |||||||||||||||||||| ||||||||||| ||||| || ||||| || ||| Sbjct: 586 agagcaagcgcttctgcgaaaatgaggatgaggatcatgcccacaaaaagcttcggctgt 527 Query: 411 tgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagc 470 || ||||| |||||||||||||||||||| |||||||| ||||||||||| || || ||| Sbjct: 526 tgtgcattcgccctgactccagcatcaccaacaatgccgatggccatgccagctgcaagc 467 Query: 471 cccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtag 530 || || ||||||||||| |||||||| || || || |||||||| || || ||| ||||| Sbjct: 466 ccagcaaggccacaggcaagcccggacgaaaggtgagcgtagccatcaaaaaggtagtag 407 Query: 531 ggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagatt 590 |||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||| Sbjct: 406 ggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgagcccgtagata 347 Query: 591 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 650 |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 346 ccgagcacaccagccatgaccacgggcacgatggacttcatgacgagctccggccgcatc 287 Query: 651 acccccat 658 || ||||| Sbjct: 286 acacccat 279 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 ctggaagtgtcaccttcctt 180 |||||||||||||||||||| Sbjct: 786 ctggaagtgtcaccttcctt 767
>dbj|AK063178.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-112-A08, full insert sequence Length = 853 Score = 359 bits (181), Expect = 8e-96 Identities = 325/373 (87%) Strand = Plus / Minus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 ||||||||| || || ||||| ||||| || ||||||||||| || || || || || || Sbjct: 601 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 542 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 || || || |||||||| || || || ||||||||||| |||||||||| |||||| || Sbjct: 541 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 482 Query: 410 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 469 |||||||| ||||||||||| || || ||||| ||||| |||||||||||||||||||| Sbjct: 481 ctgcgcattggccctgactccggcgtcgccgacgatgccgatggccatgccggcggcgag 422 Query: 470 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 529 || |||||||| |||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 421 accggcgaggccgcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagta 362 Query: 530 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 589 ||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||| Sbjct: 361 gggcttggccttggggttgatgccggtggagatgatgacggcgatgatgaggccgtagat 302 Query: 590 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| |||||||||||||| |||||||||||||| || || ||||| ||||| Sbjct: 301 accgagcactccggccatgacgacggggacgatggacttcatcaccagttccgggcgcat 242 Query: 650 gacccccatggac 662 |||||||||||| Sbjct: 241 cacccccatggac 229
>gb|BT017156.1| Zea mays clone EL01N0367F12.c mRNA sequence Length = 992 Score = 343 bits (173), Expect = 5e-91 Identities = 323/373 (86%) Strand = Plus / Minus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| || Sbjct: 597 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 538 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 ||||| |||||||| || ||||| || ||||||||||| || || |||| ||| || || Sbjct: 537 gagggcaagcgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 478 Query: 410 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 469 || || || |||||||| ||||||||||| || ||||||||||||||||| || || || Sbjct: 477 ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagcaag 418 Query: 470 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 529 ||| || || |||||||| || || || || || ||||| |||||||| |||||| |||| Sbjct: 417 cccagcaagaccacaggcaaggccagacgacaggtgggcatagccgtcaaagaggtagta 358 Query: 530 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 589 |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 357 tggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtagat 298 Query: 590 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 |||||||| || |||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 297 accgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgcat 238 Query: 650 gacccccatggac 662 ||| ||||||||| Sbjct: 237 gacacccatggac 225
>gb|BT017861.1| Zea mays clone EL01N0511G07.c mRNA sequence Length = 1094 Score = 343 bits (173), Expect = 5e-91 Identities = 323/373 (86%) Strand = Plus / Minus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| || Sbjct: 681 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 622 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 ||||| |||||||| || ||||| || ||||||||||| || || |||| ||| || || Sbjct: 621 gagggcaagcgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 562 Query: 410 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgag 469 || || || |||||||| ||||||||||| || ||||||||||||||||| || || || Sbjct: 561 ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcctgcagcaag 502 Query: 470 ccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagta 529 ||| || || |||||||| || || || || || ||||| |||||||| |||||| |||| Sbjct: 501 cccagcaagaccacaggcaaggccagacgacaggtgggcatagccgtcaaagaggtagta 442 Query: 530 gggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagat 589 |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 441 tggcttggccttggggttgatcccagtgctgatgatgacggcgatgatgaggccgtagat 382 Query: 590 tccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 |||||||| || |||||||| ||||||||||||||||||||||||||||| || ||||| Sbjct: 381 accgagcacaccagccatgaccacgggcacgatggacttcatgacgagctctgggcgcat 322 Query: 650 gacccccatggac 662 ||| ||||||||| Sbjct: 321 gacacccatggac 309
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 311 bits (157), Expect = 2e-81 Identities = 208/225 (92%) Strand = Plus / Plus Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| |||||| Sbjct: 20706700 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 20706759 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 ||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 20706760 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 20706819 Query: 558 ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 617 |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||| Sbjct: 20706820 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 20706879 Query: 618 acgatggacttcatgacgagctccggccgcatgacccccatggac 662 |||||||| ||||||||||||||||| |||||||| ||||||||| Sbjct: 20706880 acgatggatttcatgacgagctccgggcgcatgacgcccatggac 20706924 Score = 73.8 bits (37), Expect = 6e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 294 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 353 ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || Sbjct: 20705311 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 20705370 Query: 354 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 413 || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| Sbjct: 20705371 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 20705430 Query: 414 gcattagccctga 426 ||||| ||||||| Sbjct: 20705431 gcatttgccctga 20705443
>dbj|AP004775.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0451A10 Length = 137046 Score = 311 bits (157), Expect = 2e-81 Identities = 208/225 (92%) Strand = Plus / Plus Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| |||||| Sbjct: 57806 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 57865 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 ||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 57866 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 57925 Query: 558 ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 617 |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||| Sbjct: 57926 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 57985 Query: 618 acgatggacttcatgacgagctccggccgcatgacccccatggac 662 |||||||| ||||||||||||||||| |||||||| ||||||||| Sbjct: 57986 acgatggatttcatgacgagctccgggcgcatgacgcccatggac 58030 Score = 73.8 bits (37), Expect = 6e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 294 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 353 ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || Sbjct: 56417 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 56476 Query: 354 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 413 || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| Sbjct: 56477 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 56536 Query: 414 gcattagccctga 426 ||||| ||||||| Sbjct: 56537 gcatttgccctga 56549
>dbj|AP005469.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0040I22 Length = 134273 Score = 311 bits (157), Expect = 2e-81 Identities = 208/225 (92%) Strand = Plus / Plus Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| ||||| |||||||| ||||||||||| || |||||||| || ||||| |||||| Sbjct: 103555 ccgacgatgccgatggccatcccggcggcgaggccggcgaggccgcacgcgaggccggag 103614 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 ||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 103615 gagaggtgcgcgtagccgtcgaagaggaagtagggcttggccttggggttgatcccggtg 103674 Query: 558 ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 617 |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||| Sbjct: 103675 ctgatgatgacggcgatgatgaggccgtagatcccgagcaccccggccatgacgacgggc 103734 Query: 618 acgatggacttcatgacgagctccggccgcatgacccccatggac 662 |||||||| ||||||||||||||||| |||||||| ||||||||| Sbjct: 103735 acgatggatttcatgacgagctccgggcgcatgacgcccatggac 103779 Score = 73.8 bits (37), Expect = 6e-10 Identities = 109/133 (81%) Strand = Plus / Plus Query: 294 tccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagg 353 ||||| ||||| || || ||||| ||||| | |||||| || || |||||||| || || Sbjct: 102166 tccgctcgggattgaccagcacgagatgacaagatgataccaacaatgagaccatagagt 102225 Query: 354 gcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgc 413 || |||||||| || || || || ||||||||||||||||| ||||| ||||| ||||| Sbjct: 102226 gcaagcgcttccgcaaagataaggatgaggatcatacccacaaacagttttggctgttga 102285 Query: 414 gcattagccctga 426 ||||| ||||||| Sbjct: 102286 gcatttgccctga 102298
>gb|AC104285.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0035J08, complete sequence Length = 117555 Score = 295 bits (149), Expect = 9e-77 Identities = 218/241 (90%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || || ||||| ||||| |||||||||||||||||||| || |||||||| Sbjct: 71771 cctgactccggcgtcgccgacgatgccgatggccatgccggcggcgagaccggcgaggcc 71830 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 |||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 71831 gcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagtagggcttggcctt 71890 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| ||||| |||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 71891 ggggttgatgccggtggagatgatgacggcgatgatgaggccgtagataccgagcactcc 71950 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||||||| Sbjct: 71951 ggccatgacgacggggacgatggacttcatcaccagttccgggcgcatcacccccatgga 72010 Query: 662 c 662 | Sbjct: 72011 c 72011 Score = 71.9 bits (36), Expect = 3e-09 Identities = 111/136 (81%) Strand = Plus / Plus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 ||||||||| || || ||||| ||||| || ||||||||||| || || || || || || Sbjct: 70561 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 70620 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 || || || |||||||| || || || ||||||||||| |||||||||| |||||| || Sbjct: 70621 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 70680 Query: 410 ttgcgcattagccctg 425 |||||||| |||||| Sbjct: 70681 ctgcgcattggccctg 70696
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 295 bits (149), Expect = 9e-77 Identities = 218/241 (90%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || || ||||| ||||| |||||||||||||||||||| || |||||||| Sbjct: 296251 cctgactccggcgtcgccgacgatgccgatggccatgccggcggcgagaccggcgaggcc 296310 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 |||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 296311 gcaggcgagaccggaggagaggtgggcgtaaccgtcgaagaggaagtagggcttggcctt 296370 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| ||||| |||||| |||||||||||||||||||||||||||||| ||||||||||| Sbjct: 296371 ggggttgatgccggtggagatgatgacggcgatgatgaggccgtagataccgagcactcc 296430 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||||||| Sbjct: 296431 ggccatgacgacggggacgatggacttcatcaccagttccgggcgcatcacccccatgga 296490 Query: 662 c 662 | Sbjct: 296491 c 296491 Score = 71.9 bits (36), Expect = 3e-09 Identities = 111/136 (81%) Strand = Plus / Plus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 ||||||||| || || ||||| ||||| || ||||||||||| || || || || || || Sbjct: 295041 ctaatccgctcgagattggcccgcacgagacgagaggatgataccaacaatcaggccata 295100 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 || || || |||||||| || || || ||||||||||| |||||||||| |||||| || Sbjct: 295101 cagagcaagagcttctgcaaagataaggatgaggatcatgcccacgaacaactttggctg 295160 Query: 410 ttgcgcattagccctg 425 |||||||| |||||| Sbjct: 295161 ctgcgcattggccctg 295176 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 453 gccatgccggcggcgagccc 472 |||||||||||||||||||| Sbjct: 5827303 gccatgccggcggcgagccc 5827284
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 280 bits (141), Expect = 6e-72 Identities = 216/241 (89%) Strand = Plus / Minus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || |||||||| Sbjct: 54434 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 54375 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| ||||| Sbjct: 54374 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 54315 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 54314 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 54255 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||| |||||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 54254 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 54195 Query: 662 c 662 | Sbjct: 54194 c 54194 Score = 163 bits (82), Expect = 9e-37 Identities = 124/138 (89%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 55510 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 55451 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 55450 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 55391 Query: 408 tgttgcgcattagccctg 425 || || ||||| |||||| Sbjct: 55390 tgctgtgcatttgccctg 55373
>gb|AY620961.1| Pennisetum glaucum vacuolar ATPase subunit c isoform gene, promoter region and complete cds Length = 3305 Score = 280 bits (141), Expect = 6e-72 Identities = 216/241 (89%) Strand = Plus / Minus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||||||||| |||||||| ||||||||||||||||| ||||| ||||||||||| || Sbjct: 2144 cctgactccagcgtcaccgacgatgccaatggccatgccagcggcaagccccgcgagtcc 2085 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||| |||||||| || ||||| || |||||||| ||||||||| |||| ||||||||||| Sbjct: 2084 acaagcgagcccagacgagaggtgcgcgtagccatcgaagaggtagtatggcttggcctt 2025 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| ||||| ||||| |||||||||||||| |||||||| |||||||| |||||||| || Sbjct: 2024 ggggttgattccggtactgatgatgacggcaatgatgagtccgtagataccgagcacacc 1965 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||| |||||||||||||||||||| ||||||||||||||||| || |||||||| Sbjct: 1964 agccatgaccacgggcacgatggacttcatcacgagctccggccgcatcacacccatgga 1905 Query: 662 c 662 | Sbjct: 1904 c 1904 Score = 137 bits (69), Expect = 5e-29 Identities = 123/141 (87%) Strand = Plus / Minus Query: 286 gcgcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagac 345 |||||||||| || ||||| ||||| |||||||| ||||||||||||||||||||||||| Sbjct: 3276 gcgcctaatcggcacgggattggccagcacgggacgagaggatgatgcccacgatgagac 3217 Query: 346 cgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttg 405 |||| || || ||||| |||||||||||||||||||| ||||| ||||| || ||||| | Sbjct: 3216 cgtagagagcaagcgcctctgcgaaaatgagaatgagaatcattcccacaaatagcttcg 3157 Query: 406 gttgttgcgcattagccctga 426 | ||||| || || ||||||| Sbjct: 3156 gctgttgtgcgtttgccctga 3136
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 280 bits (141), Expect = 6e-72 Identities = 216/241 (89%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || |||||||| Sbjct: 3359860 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 3359919 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| ||||| Sbjct: 3359920 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 3359979 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 3359980 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 3360039 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||| |||||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 3360040 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 3360099 Query: 662 c 662 | Sbjct: 3360100 c 3360100 Score = 163 bits (82), Expect = 9e-37 Identities = 124/138 (89%) Strand = Plus / Plus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 3358784 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 3358843 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 3358844 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 3358903 Query: 408 tgttgcgcattagccctg 425 || || ||||| |||||| Sbjct: 3358904 tgctgtgcatttgccctg 3358921
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 280 bits (141), Expect = 6e-72 Identities = 216/241 (89%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| |||||||||||||| ||||| |||||||| ||||| ||||| || |||||||| Sbjct: 3368565 cctgacaccagcatcaccgacgatgccgatggccattccggcagcgagaccggcgaggcc 3368624 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||||||||| || ||||| ||||||||||| |||||| |||| ||||| ||||| Sbjct: 3368625 acaggcgagcccggacgacagatgcgcgtagccgtcaaagaggtagtacggcttagcctt 3368684 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| || |||||||||||||||||||||||||||||||| |||||||| || Sbjct: 3368685 ggggttgatccctgtactgatgatgacggcgatgatgaggccgtagataccgagcacacc 3368744 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccatgga 661 |||||||| |||||||||||||||||||| ||||||||||| ||||| || |||||||| Sbjct: 3368745 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacgcccatgga 3368804 Query: 662 c 662 | Sbjct: 3368805 c 3368805 Score = 163 bits (82), Expect = 9e-37 Identities = 124/138 (89%) Strand = Plus / Plus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 |||||||| || || || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 3367489 gcctaatctgcacgagattggccggcacgggatgagaggatgatgcccacaatgagacca 3367548 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || ||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||| Sbjct: 3367549 tacagggcaagcgcttctgcgaaaatgaggatgaggatcatgcccacgaaaagctttggt 3367608 Query: 408 tgttgcgcattagccctg 425 || || ||||| |||||| Sbjct: 3367609 tgctgtgcatttgccctg 3367626
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 264 bits (133), Expect = 3e-67 Identities = 211/237 (89%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| || Sbjct: 3500503 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 3500562 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||| || || ||||| || |||||||||||||||||| |||||||||||||||| Sbjct: 3500563 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 3500622 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| || Sbjct: 3500623 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 3500682 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 3500683 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccat 3500739 Score = 125 bits (63), Expect = 2e-25 Identities = 120/139 (86%) Strand = Plus / Plus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 3498846 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 3498905 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 3498906 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 3498965 Query: 408 tgttgcgcattagccctga 426 || || || || ||||||| Sbjct: 3498966 tgctgggcgttcgccctga 3498984
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 264 bits (133), Expect = 3e-67 Identities = 211/237 (89%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| || Sbjct: 3500448 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 3500507 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||| || || ||||| || |||||||||||||||||| |||||||||||||||| Sbjct: 3500508 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 3500567 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| || Sbjct: 3500568 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 3500627 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 3500628 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccat 3500684 Score = 125 bits (63), Expect = 2e-25 Identities = 120/139 (86%) Strand = Plus / Plus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 3498791 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 3498850 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 3498851 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 3498910 Query: 408 tgttgcgcattagccctga 426 || || || || ||||||| Sbjct: 3498911 tgctgggcgttcgccctga 3498929
>emb|AL954825.3|CNS08CD1 Oryza sativa chromosome 12, . BAC OJ2007_H06 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 103647 Score = 264 bits (133), Expect = 3e-67 Identities = 211/237 (89%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| || Sbjct: 15431 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 15490 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||||||||| || || ||||| || |||||||||||||||||| |||||||||||||||| Sbjct: 15491 acaggcgaggccagatgagaggtgcgcgtagccgtcgaagaggtagtagggcttggcctt 15550 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| || Sbjct: 15551 ggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacacc 15610 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 15611 agccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccat 15667 Score = 125 bits (63), Expect = 2e-25 Identities = 120/139 (86%) Strand = Plus / Plus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 13774 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 13833 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 13834 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 13893 Query: 408 tgttgcgcattagccctga 426 || || || || ||||||| Sbjct: 13894 tgctgggcgttcgccctga 13912
>gb|BT017996.1| Zea mays clone EL01N0526E06.c mRNA sequence Length = 586 Score = 258 bits (130), Expect = 2e-65 Identities = 193/214 (90%) Strand = Plus / Minus Query: 357 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 416 |||||||||||||||||||| ||||||||||| || ||||| |||||||| ||||||||| Sbjct: 214 agcgcttctgcgaaaatgaggatgaggatcatgccaacgaaaagctttggctgttgcgca 155 Query: 417 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 476 || ||||||||||||||||||||||||||||| ||||||||||| || || ||||| ||| Sbjct: 154 tttgccctgactccagcatcaccgacaatgccgatggccatgccagctgcaagcccagcg 95 Query: 477 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 536 || |||||||| |||||||| || || ||||||||||| || |||||| ||||||||||| Sbjct: 94 agaccacaggcaagcccggacgaaaggtgggcgtagccatcaaagaggtagtagggcttg 35 Query: 537 gccttgggattgatcccggtgctgatgatgacgg 570 |||||||| |||||||| |||||||||||||||| Sbjct: 34 gccttggggttgatccccgtgctgatgatgacgg 1
>emb|AL713902.2|CNS07YQ2 Oryza sativa chromosome 12, . BAC OJ1494_F10 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 116371 Score = 250 bits (126), Expect = 5e-63 Identities = 211/238 (88%), Gaps = 1/238 (0%) Strand = Plus / Minus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 ||||||||| || ||||| || |||||||||||||| ||||| ||||| || ||||| || Sbjct: 31411 cctgactccggcgtcaccaacgatgccaatggccattccggcagcgagaccggcgagacc 31352 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaag-aggaagtagggcttggcct 540 ||||||||| || || ||||| || ||||||||||||||| ||| ||||||||||||||| Sbjct: 31351 acaggcgaggccagatgagaggtgcgcgtagccgtcgaaggaggtagtagggcttggcct 31292 Query: 541 tgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactc 600 |||| |||||||| |||||||||||||| |||||||||||||||||||| || ||||| | Sbjct: 31291 tggggttgatccccgtgctgatgatgactgcgatgatgaggccgtagatacccagcacac 31232 Query: 601 ccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 | |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 31231 cagccatgaccacgggcacgatggacttcatcacgagctccgggcgcatcacccccat 31174 Score = 125 bits (63), Expect = 2e-25 Identities = 120/139 (86%) Strand = Plus / Minus Query: 288 gcctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccg 347 ||||||||||| || || ||||| || |||||||| ||||||||||| |||||||| || Sbjct: 33068 gcctaatccgcacgagattggccagcgcgggatgacaggatgatgccgacgatgagccca 33009 Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 || || || |||||||| || |||||||| |||||||||||||||||||||||||||||| Sbjct: 33008 tagagagcaagcgcttcggcaaaaatgaggatgaggatcatacccacgaacagctttggt 32949 Query: 408 tgttgcgcattagccctga 426 || || || || ||||||| Sbjct: 32948 tgctgggcgttcgccctga 32930
>gb|AY620960.1| Pennisetum glaucum truncated vacuolar ATPase subunit c isoform mRNA, partial cds Length = 911 Score = 214 bits (108), Expect = 3e-52 Identities = 195/224 (87%) Strand = Plus / Minus Query: 431 agcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgag 490 ||||||||| |||||||||||||||||||| || ||||| || ||||| |||||||| || Sbjct: 255 agcatcaccaacaatgccaatggccatgccagcagcgagaccagcgagaccacaggcaag 196 Query: 491 cccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgat 550 || || | ||| || ||||| ||||| |||||| ||||||||||||||||||| ||||| Sbjct: 195 gccagatgtgaggtgagcgtatccgtcaaagaggtagtagggcttggccttggggttgat 136 Query: 551 cccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgac 610 |||||| ||||||||||| | ||||||||| |||||||| |||||||| || |||||||| Sbjct: 135 cccggtactgatgatgacagtgatgatgagcccgtagataccgagcacaccagccatgac 76 Query: 611 gacgggcacgatggacttcatgacgagctccggccgcatgaccc 654 ||||||| |||||||||||||||||||||| | | |||||||| Sbjct: 75 cacgggcatgatggacttcatgacgagctccaggcacatgaccc 32
>ref|NM_189368.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 498 Score = 212 bits (107), Expect = 1e-51 Identities = 299/363 (82%) Strand = Plus / Minus Query: 297 gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 356 ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | Sbjct: 491 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 432 Query: 357 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 416 ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| Sbjct: 431 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 372 Query: 417 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 476 || |||||||| || || || ||||| | ||| ||||| | |||||||||||| | | Sbjct: 371 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 312 Query: 477 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 536 || || ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | Sbjct: 311 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 252 Query: 537 gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 596 ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || ||| Sbjct: 251 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 192 Query: 597 actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 656 ||||| ||||| || || |||||||| |||||||| || |||||||||||||| |||||| Sbjct: 191 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 132 Query: 657 atg 659 ||| Sbjct: 131 atg 129
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 212 bits (107), Expect = 1e-51 Identities = 299/363 (82%) Strand = Plus / Minus Query: 297 gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 356 ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | Sbjct: 42411090 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 42411031 Query: 357 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 416 ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| Sbjct: 42411030 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 42410971 Query: 417 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 476 || |||||||| || || || ||||| | ||| ||||| | |||||||||||| | | Sbjct: 42410970 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 42410911 Query: 477 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 536 || || ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | Sbjct: 42410910 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 42410851 Query: 537 gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 596 ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || ||| Sbjct: 42410850 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 42410791 Query: 597 actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 656 ||||| ||||| || || |||||||| |||||||| || |||||||||||||| |||||| Sbjct: 42410790 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 42410731 Query: 657 atg 659 ||| Sbjct: 42410730 atg 42410728
>dbj|AP003263.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483G10 Length = 190721 Score = 212 bits (107), Expect = 1e-51 Identities = 299/363 (82%) Strand = Plus / Minus Query: 297 gcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcg 356 ||||| ||||||||||| ||||| |||||||||||||| |||||||| ||||| ||| | Sbjct: 70428 gcgcgcgactggccggcgcgggaggagaggatgatgccgacgatgaggccgtagaggcca 70369 Query: 357 agcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgca 416 ||||| || ||||| ||||| ||||||||||| || ||||||||||| || || ||||| Sbjct: 70368 agcgcctcggcgaagatgaggatgaggatcatgccgacgaacagcttgggctgctgcgcg 70309 Query: 417 ttagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcg 476 || |||||||| || || || ||||| | ||| ||||| | |||||||||||| | | Sbjct: 70308 ttggccctgacgccggcgtcgccgacgacgccgatggcgaggccggcggcgagggcgcag 70249 Query: 477 aggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttg 536 || || ||||||||| | || ||| ||| || ||||||||||| || |||| ||| | Sbjct: 70248 agccccgtggcgagccccgcggcgaggtggacggagccgtcgaagtggtagtacggcatc 70189 Query: 537 gccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagc 596 ||| | || ||||| |||||| |||||||||| |||||||||||||||||||| || ||| Sbjct: 70188 gccgtcgggttgatgccggtggtgatgatgacagcgatgatgaggccgtagatccccagc 70129 Query: 597 actcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgaccccc 656 ||||| ||||| || || |||||||| |||||||| || |||||||||||||| |||||| Sbjct: 70128 actccggccatcaccaccggcacgatcgacttcatcaccagctccggccgcatcaccccc 70069 Query: 657 atg 659 ||| Sbjct: 70068 atg 70066
>emb|X92374.1|ZMATP162 Z.mays mRNA for V-type H+-ATPase, clone 16-2 Length = 228 Score = 192 bits (97), Expect = 1e-45 Identities = 190/221 (85%) Strand = Plus / Minus Query: 399 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 458 ||||| || ||||| ||||| |||||||||||||||||||| ||||| || || |||||| Sbjct: 221 agcttcggctgttgtgcattcgccctgactccagcatcaccaacaattccgattgccatg 162 Query: 459 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 518 || || | | ||| || ||||||||||| |||||||| || || || |||||||| || Sbjct: 161 ccagctggcaacccagcaaggccacaggcaagcccggacgaaaggtgagcgtagccatca 102 Query: 519 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 578 || ||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 101 aaaaggtagtagggcttggccttggggttgatcccagtgctgatgatgacggcgatgatg 42 Query: 579 aggccgtagattccgagcactcccgccatgacgacgggcac 619 || |||||||| |||||||| || |||||||| |||||||| Sbjct: 41 agcccgtagataccgagcacaccagccatgaccacgggcac 1
>gb|U16244.1|KDU16244 Kalanchoe daigremontiana V-type H+-ATPase 16 kDa subunit mRNA, complete cds Length = 820 Score = 192 bits (97), Expect = 1e-45 Identities = 292/357 (81%) Strand = Plus / Minus Query: 302 ggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgc 361 |||||||||||| ||||| || | |||||||||||||||||| ||||| ||||| ||||| Sbjct: 497 ggactggccggctcgggaggacaagatgatgcccacgatgaggccgtagagggccagcgc 438 Query: 362 ttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagc 421 ||| || || ||||| ||||||||||| |||||||| || || ||||| || || || || Sbjct: 437 ttccgcaaagatgaggatgaggatcattcccacgaagagtttcggttgctgagcgttggc 378 Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| ||||| ||||| || || ||||||||||| || |||| ||| || || ||||| Sbjct: 377 cctgacaccagcgtcaccaacgattccaatggccattccagcggagagtccagcaaggcc 318 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||| || | || || || | ||||| || |||||||| ||| |||||| ||||||||| Sbjct: 317 acaagccaagccagacgacaagtgggcatatccgtcgaacaggtagtaggacttggcctt 258 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 ||| || |||||||| |||||||| |||||||| || || || || || || | |||||| Sbjct: 257 ggggttaatcccggtactgatgataacggcgataatcagaccataaatacccaacactcc 198 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 |||||||| || ||||| ||||||||||| || ||||| |||| ||| |||||||| Sbjct: 197 tgccatgaccaccggcacaatggacttcatcaccagctctggcctcatcacccccat 141
>emb|X92375.1|ZMATP164 Z.mays mRNA for V-type H+-ATPase, clone 16-4 Length = 228 Score = 176 bits (89), Expect = 6e-41 Identities = 188/221 (85%) Strand = Plus / Minus Query: 399 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 458 ||||| || ||||| ||||| |||||||||||| ||||||| ||||| || || ||||| Sbjct: 221 agcttcggctgttgtgcattcgccctgactccaccatcaccaacaattccgattgccatt 162 Query: 459 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 518 || || | | ||| || || |||||||| || ||||| || || ||||| |||||||| Sbjct: 161 cctgcaggcaacccagcaagaccacaggcaaggccggacgacaggtgggcatagccgtca 102 Query: 519 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 578 |||||| |||| |||||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 101 aagaggtagtatggcttggccttggggttgatcccagtgctgatgatgacggcgatgatg 42 Query: 579 aggccgtagattccgagcactcccgccatgacgacgggcac 619 ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 41 aggccgtagataccgagcacaccagccatgaccacgggcac 1
>ref|NM_106215.2| Arabidopsis thaliana AVA-P; ATPase AT1G75630 (AVA-P) mRNA, complete cds Length = 759 Score = 135 bits (68), Expect = 2e-28 Identities = 212/260 (81%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 507 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 448 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 437 || || ||||| ||||| |||||||| |||||||||||||| || || || ||||||||| Sbjct: 447 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 388 Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || Sbjct: 387 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 328 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || Sbjct: 327 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 268 Query: 558 ctgatgatgacggcgatgat 577 |||||||| || |||||||| Sbjct: 267 ctgatgataacagcgatgat 248
>gb|AY389658.1| Hyacinthus orientalis vacuolar H+-ATPase proteolipid 16 kDa subunit mRNA, partial cds Length = 757 Score = 135 bits (68), Expect = 2e-28 Identities = 284/356 (79%) Strand = Plus / Minus Query: 303 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 362 |||||||| || || ||||||||||||||||| || || ||||| || ||||| || ||| Sbjct: 464 gactggccagcccgagatgagaggatgatgccaacaatcagaccatatagggcaagagct 405 Query: 363 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 422 || ||||||||||||||||| ||||||||||| || ||||| || || || ||||| || Sbjct: 404 tcggcgaaaatgagaatgagaatcatacccacaaatagcttgggctgctgtgcattggct 345 Query: 423 ctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcca 482 | |||||| ||||||||||| || ||||| |||||||| |||| ||||| || || ||| Sbjct: 344 cggactcctgcatcaccgacgataccaatagccatgccagcggacagcccagctagccca 285 Query: 483 caggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttg 542 || || | || || ||||| || ||||| || ||||| | | || | ||| || || Sbjct: 284 caagctaaaccagaagagaggtgagcgtacccatcgaacaaataataagacttcgcgtta 225 Query: 543 ggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactccc 602 || |||||||| || ||||| || || || ||||| || ||||| || || | |||||| Sbjct: 224 gggttgatcccagtactgataatcaccgctatgatcagcccgtatatccccaaaactccc 165 Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 ||||| || || |||||||| |||||||| ||||||||||||||||| || ||||| Sbjct: 164 gccataaccaccggcacgatcgacttcatcacgagctccggccgcatcactcccat 109
>gb|AY098985.1| Arabidopsis thaliana At1g75630/F10A5_17 mRNA, complete cds Length = 501 Score = 135 bits (68), Expect = 2e-28 Identities = 212/260 (81%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 473 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 414 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 437 || || ||||| ||||| |||||||| |||||||||||||| || || || ||||||||| Sbjct: 413 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 354 Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || Sbjct: 353 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 294 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || Sbjct: 293 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 234 Query: 558 ctgatgatgacggcgatgat 577 |||||||| || |||||||| Sbjct: 233 ctgatgataacagcgatgat 214
>gb|AF424574.1|AF424574 Arabidopsis thaliana At1g75630/F10A5_17 mRNA, complete cds Length = 749 Score = 135 bits (68), Expect = 2e-28 Identities = 212/260 (81%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 497 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 438 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 437 || || ||||| ||||| |||||||| |||||||||||||| || || || ||||||||| Sbjct: 437 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 378 Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || Sbjct: 377 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 318 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || Sbjct: 317 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 258 Query: 558 ctgatgatgacggcgatgat 577 |||||||| || |||||||| Sbjct: 257 ctgatgataacagcgatgat 238
>gb|L44584.1|ATHAVAPC Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, complete cds Length = 689 Score = 135 bits (68), Expect = 2e-28 Identities = 212/260 (81%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 507 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 448 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 437 || || ||||| ||||| |||||||| |||||||||||||| || || || ||||||||| Sbjct: 447 atcagaatcattcccacaaacagcttcggttgttgcgcattcgctctaacaccagcatca 388 Query: 438 ccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggag 497 ||||| || ||||| ||||| || || | ||| || || || ||||| || ||||| || Sbjct: 387 ccgacgattccaatagccataccagcagagagaccagcaagaccacaagctagcccagaa 328 Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || ||||| ||||| ||| | || | |||||||||||| || ||||| || Sbjct: 327 gagagatgagcatagccatcgaataggtaataagacttggccttggggttaatcccagta 268 Query: 558 ctgatgatgacggcgatgat 577 |||||||| || |||||||| Sbjct: 267 ctgatgataacagcgatgat 248
>gb|M95063.1|MZEORFD Zea mays putative proteolipid subunit of vacuolar H+ ATPase mRNA, partial cds Length = 202 Score = 133 bits (67), Expect = 8e-28 Identities = 145/171 (84%) Strand = Plus / Minus Query: 290 ctaatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgta 349 |||||| |||||||||||||||||||| || |||||||| ||||| ||||||||||| || Sbjct: 177 ctaatctgcgcgggactggccggcacgagacgagaggataatgccgacgatgagaccata 118 Query: 350 aagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttg 409 ||||| || ||||| || ||||| || ||||||||||| || || |||| ||| || || Sbjct: 117 gagggcaagtgcttcagcaaaaataaggatgaggatcatgccaacaaacaacttcggctg 58 Query: 410 ttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgcc 460 || || || |||||||| ||||||||||| || ||||||||||||||||| Sbjct: 57 ctgagcgttcgccctgacaccagcatcaccaacgatgccaatggccatgcc 7
>ref|NM_101846.2| Arabidopsis thaliana AVA-P2; ATPase AT1G19910 (AVA-P2) mRNA, complete cds Length = 788 Score = 129 bits (65), Expect = 1e-26 Identities = 200/245 (81%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 538 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 479 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| ||| Sbjct: 478 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 419 Query: 441 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 500 ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| ||| Sbjct: 418 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 359 Query: 501 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 560 ||||| || ||||| ||||| || |||| | ||||||||| || ||||| ||||| ||| Sbjct: 358 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 299 Query: 561 atgat 565 ||||| Sbjct: 298 atgat 294
>gb|BT024867.1| Arabidopsis thaliana At1g19910 gene, complete cds Length = 498 Score = 129 bits (65), Expect = 1e-26 Identities = 200/245 (81%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 467 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 408 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| ||| Sbjct: 407 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 348 Query: 441 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 500 ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| ||| Sbjct: 347 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 288 Query: 501 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 560 ||||| || ||||| ||||| || |||| | ||||||||| || ||||| ||||| ||| Sbjct: 287 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 228 Query: 561 atgat 565 ||||| Sbjct: 227 atgat 223
>gb|L44585.1|ATHAVAPD Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2e) mRNA, complete cds Length = 665 Score = 129 bits (65), Expect = 1e-26 Identities = 200/245 (81%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 475 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 416 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| ||| Sbjct: 415 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 356 Query: 441 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 500 ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| ||| Sbjct: 355 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 296 Query: 501 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 560 ||||| || ||||| ||||| || |||| | ||||||||| || ||||| ||||| ||| Sbjct: 295 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 236 Query: 561 atgat 565 ||||| Sbjct: 235 atgat 231
>gb|L44582.1|ATHAVAPA Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) mRNA, complete cds Length = 692 Score = 129 bits (65), Expect = 1e-26 Identities = 200/245 (81%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 443 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 384 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 || ||||| ||||| |||| ||| |||||||| ||||| || || || || ||||| ||| Sbjct: 383 agaatcattcccacaaacaacttaggttgttgtgcattcgctctaacaccggcatcgccg 324 Query: 441 acaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggag 500 ||||| ||||| ||||| ||||||| ||| || ||||| ||||| || || ||||| ||| Sbjct: 323 acaattccaatagccataccggcggagagaccagcgagaccacaagcaagaccggaagag 264 Query: 501 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 560 ||||| || ||||| ||||| || |||| | ||||||||| || ||||| ||||| ||| Sbjct: 263 agatgagcatagccatcgaatagatagtaagacttggccttagggttgattccggtactg 204 Query: 561 atgat 565 ||||| Sbjct: 203 atgat 199
>gb|AF193814.1|AF193814 Dendrobium crumenatum vacuolar H+-ATP synthase 16kDa proteolipid subunit mRNA, complete cds Length = 896 Score = 127 bits (64), Expect = 5e-26 Identities = 292/368 (79%) Strand = Plus / Minus Query: 291 taatccgcgcgggactggccggcacgggatgagaggatgatgcccacgatgagaccgtaa 350 |||||||| || || ||||| || || || ||||| |||||||| || |||||||| || Sbjct: 567 taatccgcacgagattggccagcccgagaagagagaatgatgccaacaatgagaccatag 508 Query: 351 agggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgt 410 ||||| || ||||| || ||||| ||||| || ||||| || || || || ||||| || Sbjct: 507 agggcaagagcttcagcaaaaataagaataagaatcatgcctacaaagagttttggctgc 448 Query: 411 tgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagc 470 || ||||||||||| || |||||||||||||| || ||||| ||||| || || | || Sbjct: 447 tgagcattagccctcacaccagcatcaccgacgatcccaatagccataccagctgataga 388 Query: 471 cccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtag 530 || || |||||||| || || ||||| || || || ||||| ||||| || ||| | || Sbjct: 387 ccagcaaggccacacgcaaggccggaagataggtgagcgtatccgtcaaaaaggtaataa 328 Query: 531 ggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagatt 590 | ||||||||||||||| || || ||||| || || || || || || | ||||| || Sbjct: 327 gacttggccttgggattaattcccgtgctaataatcaccgcaataatcaatccgtaaata 268 Query: 591 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 650 ||||| || || |||||||| |||||||| || |||||||| || ||||||||||||||| Sbjct: 267 ccgagaacaccagccatgaccacgggcacaattgacttcataacaagctccggccgcatg 208 Query: 651 acccccat 658 |||||||| Sbjct: 207 acccccat 200
>gb|AF303372.1| Tortula ruralis vacuolar-type H(+)-ATPase subunit c mRNA, complete cds Length = 830 Score = 123 bits (62), Expect = 8e-25 Identities = 137/162 (84%) Strand = Plus / Minus Query: 501 agatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctg 560 ||||| ||||||||||| || | | |||| ||||||| |||||| ||||| || |||||| Sbjct: 401 agatgcgcgtagccgtcaaacacgtagtacggcttggacttggggttgattcctgtgctg 342 Query: 561 atgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggcacg 620 || || || || || || || |||||||| || ||||||||||||||||| ||||||||| Sbjct: 341 ataatcacagcaataatcagtccgtagatacccagcactcccgccatgaccacgggcacg 282 Query: 621 atggacttcatgacgagctccggccgcatgacccccatggac 662 ||||||||||| |||||||| || ||||| || ||||||||| Sbjct: 281 atggacttcatcacgagctcggggcgcatcacacccatggac 240 Score = 54.0 bits (27), Expect = 6e-04 Identities = 108/135 (80%) Strand = Plus / Minus Query: 326 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 385 ||||||||||||||| |||||||| | || ||||| || ||||||||||| || | ||| Sbjct: 576 gatgatgcccacgatcagaccgtacaaagcaagcgcctcagcgaaaatgaggatcaagat 517 Query: 386 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 445 ||| || | |||||||| || || ||||| || |||||| | || | ||| || || || Sbjct: 516 catgccaccaaacagcttgggctgctgcgcgttggccctgccaccgggatctcccaccat 457 Query: 446 gccaatggccatgcc 460 |||||||||| |||| Sbjct: 456 gccaatggccctgcc 442
>ref|NM_120052.2| Arabidopsis thaliana ATPase AT4G38920 mRNA, complete cds Length = 1028 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 577 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 518 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 517 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 458 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 457 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 398 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 397 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 339
>gb|AY093249.1| Arabidopsis thaliana H+-transporting ATPase 16K chain P2, vacuolar (F19H22.20) mRNA, complete cds Length = 667 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 458 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 399 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 398 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 339 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 338 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 279 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 278 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 220
>gb|AY090271.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds Length = 495 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 458 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 399 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 398 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 339 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 338 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 279 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 278 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 220
>gb|AY059836.1| Arabidopsis thaliana H+-transporting ATPase 16K chain P2, vacuolar (F19H22.20) mRNA, complete cds Length = 1028 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 577 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 518 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 517 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 458 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 457 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 398 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 397 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 339
>gb|AF412097.1|AF412097 Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds Length = 879 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 568 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 509 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 508 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 449 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 448 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 389 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 388 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 330
>gb|AY049249.1| Arabidopsis thaliana AT4g38920/F19H22_20 mRNA, complete cds Length = 914 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 569 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 510 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 509 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 450 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 449 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 390 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 389 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 331
>emb|BX828233.1|CNS0A338 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH66ZB12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 890 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 545 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 486 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 485 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 426 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 425 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 366 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 365 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 307
>gb|AY087112.1| Arabidopsis thaliana clone 31833 mRNA, complete sequence Length = 911 Score = 117 bits (59), Expect = 5e-23 Identities = 194/239 (81%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 568 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 509 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatg 446 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || || || Sbjct: 508 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaacgata 449 Query: 447 ccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgg 506 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 448 cctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatga 389 Query: 507 gcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || |||||||| || |||||||| |||||||| Sbjct: 388 gcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggtactgatgat 330
>dbj|AB024276.1| Citrus unshiu (CitVATP c-3) mRNA for vacuolar H+-ATPase c subunit, complete cds Length = 982 Score = 117 bits (59), Expect = 5e-23 Identities = 248/311 (79%) Strand = Plus / Minus Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 ||||| || |||||||| || || || |||||||||||||| || ||||| ||||| || Sbjct: 511 taaagtgccagcgcttcggcaaagatcagaatgaggatcatcccaacgaaaagcttcggc 452 Query: 408 tgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcggcg 467 ||||| |||||||| ||||| |||||||||||||| || ||||| ||||| || |||| | Sbjct: 451 tgttgagcattagctctgacaccagcatcaccgacgatcccaattgccataccagcggag 392 Query: 468 agccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaag 527 || || || |||||||| ||||| || || |||||||| |||||||| ||||| ||| | Sbjct: 391 agaccagcaaggccacaagcgaggccagaagagagatgcgcgtagccatcgaaaaggtaa 332 Query: 528 tagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtag 587 || | |||||||| || || || ||||| || || || || || || || | ||||| Sbjct: 331 taagatttggccttagggttaattccggtactaataataacagcaataatcaaaccgtaa 272 Query: 588 attccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgc 647 || || | ||||||||||| || ||||||||||| || ||||| || |||||||||| | Sbjct: 271 atacccaaaactcccgccataacaacgggcacgatcgatttcatcacaagctccggcctc 212 Query: 648 atgacccccat 658 || || ||||| Sbjct: 211 atcactcccat 201
>gb|AF022926.1|AF022926 Vigna radiata adenosine triphosphatase mRNA, complete cds Length = 956 Score = 115 bits (58), Expect = 2e-22 Identities = 214/266 (80%) Strand = Plus / Minus Query: 303 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 362 ||||| |||||||| || || |||||||| || || |||||||| || ||||| || ||| Sbjct: 567 gactgaccggcacgagaagacaggatgataccaacaatgagaccatacagggcaagagct 508 Query: 363 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 422 || || || ||||| ||||| ||||| || ||||| |||||||| || || ||||| || Sbjct: 507 tcggcaaagatgaggatgagaatcattccaacgaaaagctttggctgctgtgcattggct 448 Query: 423 ctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcca 482 || || ||||||||||| ||||| ||||| |||||||| || | |||||| || || ||| Sbjct: 447 ctaacaccagcatcaccaacaataccaatagccatgccagcagagagcccagccagccca 388 Query: 483 caggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttg 542 ||||| || || ||||||||||| || || || || |||||| | || | ||||||||| Sbjct: 387 caggcaagaccagaggagagatgtgcataaccatcaaagaggtaataagatttggccttg 328 Query: 543 ggattgatcccggtgctgatgatgac 568 ||||| || || || ||||||||||| Sbjct: 327 ggattaatgccagtactgatgatgac 302
>emb|AJ843122.1| Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene) Length = 700 Score = 113 bits (57), Expect = 8e-22 Identities = 225/281 (80%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| |||||||| || ||||||||||| || ||||| |||||||||||||| |||||| Sbjct: 542 gcttcagcgaaaataaggatgaggatcattccaacgaaaagctttggttgttgtgcatta 483 Query: 420 gccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgagg 479 ||||| || |||||||| || ||||| ||||| ||||| || || || | || || ||| Sbjct: 482 gccctcacaccagcatctcccacaattccaatagccataccagcagccaagccagcaagg 423 Query: 480 ccacaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcc 539 ||||| || ||||| || ||||||||||| || || || || ||| |||| | ||||||| Sbjct: 422 ccacaagcaagcccagatgagagatgggcatatccatcaaacaggtagtatgacttggcc 363 Query: 540 ttgggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcact 599 || || ||||| || |||||||| || || || || || | |||||||| || | ||| Sbjct: 362 tttgggttgataccagtgctgataataacagcaataatcaaaccgtagatacccaacaca 303 Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctc 640 || |||||||| || ||||| || || |||||||| ||||| Sbjct: 302 ccagccatgaccactggcacaatcgatttcatgacaagctc 262
>gb|AF022925.1|AF022925 Vigna radiata adenosine triphosphatase mRNA, partial cds Length = 680 Score = 111 bits (56), Expect = 3e-21 Identities = 209/260 (80%) Strand = Plus / Minus Query: 399 agctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatg 458 |||||||| ||||| ||||| || || || || || || || || ||||||||||||||| Sbjct: 329 agctttggctgttgggcatttgctctaacaccggcgtcgccaacgatgccaatggccatg 270 Query: 459 ccggcggcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcg 518 || |||| ||| || ||||| ||||| || || || || || ||||| |||||||| ||| Sbjct: 269 ccagcggagagaccagcgagaccacaagcaagaccagaagacagatgagcgtagccatcg 210 Query: 519 aagaggaagtagggcttggccttgggattgatcccggtgctgatgatgacggcgatgatg 578 || || |||| | |||||||| || || || || ||||||||||| || |||||||| Sbjct: 209 aacagatagtacgatttggccttagggttaattcccgtgctgatgatcactgcgatgatc 150 Query: 579 aggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagc 638 | ||||||||| || ||||||||||||||||| || ||||| || || ||||| || ||| Sbjct: 149 aagccgtagatgccaagcactcccgccatgacaaccggcacaatcgatttcatcaccagc 90 Query: 639 tccggccgcatgacccccat 658 ||||||| ||| || ||||| Sbjct: 89 tccggcctcatcacgcccat 70
>dbj|AB024275.1| Citrus unshiu (CitVATP c-2) mRNA for vacuolar H+-ATPase c subunit, complete cds Length = 813 Score = 103 bits (52), Expect = 7e-19 Identities = 118/140 (84%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| |||||||||||||| ||||| ||||| ||||| || || |||||| Sbjct: 630 gatgagaggatgattcccacgatgagaccataaagagcgagagcttcggcaaagatgaga 571 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatca 437 || || ||||| ||||| |||| ||| || || || || |||||||| ||||| |||||| Sbjct: 570 ataagaatcattcccacaaacaacttaggctgctgtgcgttagccctaactcccgcatca 511 Query: 438 ccgacaatgccaatggccat 457 || ||||| ||||| ||||| Sbjct: 510 ccaacaattccaatagccat 491
>ref|NM_119638.2| Arabidopsis thaliana ATPase/ hydrogen-transporting ATPase, rotational mechanism AT4G34720 mRNA, complete cds Length = 1024 Score = 97.6 bits (49), Expect = 4e-17 Identities = 178/221 (80%) Strand = Plus / Minus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 570 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 511 Query: 405 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 464 || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || Sbjct: 510 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 451 Query: 465 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 524 | ||| || || || ||||| || || || || |||||||| ||||| || || |||||| Sbjct: 450 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 391 Query: 525 aagtagggcttggccttgggattgatcccggtgctgatgat 565 |||| | ||| |||||||| || |||||||| |||||||| Sbjct: 390 tagtaagacttagccttggggttaatcccggtactgatgat 350
>gb|AY127950.1| Arabidopsis thaliana AT4g34720/T4L20_300 mRNA, complete cds Length = 495 Score = 97.6 bits (49), Expect = 4e-17 Identities = 178/221 (80%) Strand = Plus / Minus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 440 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 381 Query: 405 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 464 || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || Sbjct: 380 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 321 Query: 465 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 524 | ||| || || || ||||| || || || || |||||||| ||||| || || |||||| Sbjct: 320 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 261 Query: 525 aagtagggcttggccttgggattgatcccggtgctgatgat 565 |||| | ||| |||||||| || |||||||| |||||||| Sbjct: 260 tagtaagacttagccttggggttaatcccggtactgatgat 220
>gb|AF372872.1|AF372872 Arabidopsis thaliana AT4g34720/T4L20_300 mRNA, complete cds Length = 831 Score = 97.6 bits (49), Expect = 4e-17 Identities = 178/221 (80%) Strand = Plus / Minus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 503 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 444 Query: 405 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 464 || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || Sbjct: 443 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 384 Query: 465 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 524 | ||| || || || ||||| || || || || |||||||| ||||| || || |||||| Sbjct: 383 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 324 Query: 525 aagtagggcttggccttgggattgatcccggtgctgatgat 565 |||| | ||| |||||||| || |||||||| |||||||| Sbjct: 323 tagtaagacttagccttggggttaatcccggtactgatgat 283
>gb|AY086410.1| Arabidopsis thaliana clone 24998 mRNA, complete sequence Length = 911 Score = 97.6 bits (49), Expect = 4e-17 Identities = 178/221 (80%) Strand = Plus / Minus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 571 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 512 Query: 405 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 464 || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || Sbjct: 511 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 452 Query: 465 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 524 | ||| || || || ||||| || || || || |||||||| ||||| || || |||||| Sbjct: 451 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 392 Query: 525 aagtagggcttggccttgggattgatcccggtgctgatgat 565 |||| | ||| |||||||| || |||||||| |||||||| Sbjct: 391 tagtaagacttagccttggggttaatcccggtactgatgat 351
>gb|L44581.1|ATHAVAP Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) mRNA, complete cds Length = 825 Score = 97.6 bits (49), Expect = 4e-17 Identities = 178/221 (80%) Strand = Plus / Minus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 487 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 428 Query: 405 ggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggccatgccggcg 464 || || || ||||| |||||||| || |||||||| ||||| ||||||||||| || || Sbjct: 427 ggctgctgagcatttgccctgacaccggcatcaccaacaatcccaatggccattccagct 368 Query: 465 gcgagccccgcgaggccacaggcgagcccggaggagagatgggcgtagccgtcgaagagg 524 | ||| || || || ||||| || || || || |||||||| ||||| || || |||||| Sbjct: 367 gagagaccagcaagaccacaagcaagaccagacgagagatgtgcgtatccatcaaagagg 308 Query: 525 aagtagggcttggccttgggattgatcccggtgctgatgat 565 |||| | ||| |||||||| || |||||||| |||||||| Sbjct: 307 tagtaagacttagccttggggttaatcccggtactgatgat 267
>emb|BX841550.1|CNS09YFN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS95ZC06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 896 Score = 95.6 bits (48), Expect = 2e-16 Identities = 193/240 (80%), Gaps = 1/240 (0%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 555 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 496 Query: 387 atacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccga-caat 445 ||||| ||||| |||||||| ||||| ||||| |||||||| |||||||| || | | || Sbjct: 495 ataccaacgaaaagctttggctgttgagcattggccctgacaccagcatcgccaaccgat 436 Query: 446 gccaatggccatgccggcggcgagccccgcgaggccacaggcgagcccggaggagagatg 505 || |||||||| || || | || || || || ||||| || || || || |||||||| Sbjct: 435 acctatggccattccagctgaaagaccagctagcccacaagcaagaccagaagagagatg 376 Query: 506 ggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtgctgatgat 565 || || |||||||||||| |||||| || ||||| || || |||||||| |||||||| Sbjct: 375 agcatatccgtcgaagaggtagtaggatttagccttcgggttaatcccggtactgatgat 316
>gb|DQ235180.1| Solanum tuberosum clone 160C10 vacuolar proton ATPase proteolipid subunit-like protein mRNA, complete cds Length = 832 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| ||||||||||||||||||||||| || || || ||||| |||||||| |||||| Sbjct: 474 gcttcagcgaaaatgagaatgaggatcattccaacaaaaagcttgggttgttgtgcatta 415 Query: 420 gccctgactccagcatcaccgacaatgccaatggccat 457 ||||| || |||||||| || ||||| ||||| ||||| Sbjct: 414 gccctaacaccagcatctccaacaataccaatagccat 377
>gb|DQ191632.1| Solanum tuberosum vacuolar proton ATPase proteolipid subunit-like protein mRNA, complete cds Length = 845 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| ||||||||||||||||||||||| || || || ||||| |||||||| |||||| Sbjct: 479 gcttcagcgaaaatgagaatgaggatcattccaacaaaaagcttgggttgttgtgcatta 420 Query: 420 gccctgactccagcatcaccgacaatgccaatggccat 457 ||||| || |||||||| || ||||| ||||| ||||| Sbjct: 419 gccctaacaccagcatctccaacaataccaatagccat 382
>gb|BT012782.1| Lycopersicon esculentum clone 113772R, mRNA sequence Length = 1106 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| ||||||||||||||||||||||| || || || ||||| |||||||| |||||| Sbjct: 713 gcttcagcgaaaatgagaatgaggatcatcccaacaaaaagcttgggttgttgtgcatta 654 Query: 420 gccctgactccagcatcaccgacaatgccaatggccat 457 ||||| || |||||||| || ||||| ||||| ||||| Sbjct: 653 gccctaacaccagcatctccaacaataccaatagccat 616
>gb|AF010228.1|AF010228 Lycopersicon esculentum vacuolar proton ATPase proteolipid subunit mRNA, complete cds Length = 946 Score = 91.7 bits (46), Expect = 3e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| ||||||||||||||||||||||| || || || ||||| |||||||| |||||| Sbjct: 512 gcttcagcgaaaatgagaatgaggatcattccgacaaaaagcttgggttgttgtgcatta 453 Query: 420 gccctgactccagcatcaccgacaatgccaatggccat 457 ||||| || |||||||| || ||||| ||||| ||||| Sbjct: 452 gccctaacaccagcatctccaacaataccaatagccat 415
>dbj|AB024274.1| Citrus unshiu (CitVATP c-1) mRNA for vacuolar H+-ATPase c subunit, complete cds Length = 842 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 369 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgact 428 |||||||||||||| ||||| || || || ||||||||||| || |||||||| ||||| Sbjct: 467 aaaatgagaatgagaatcattccaacaaaaagctttggttgctgtgcattagctctgaca 408 Query: 429 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 488 ||||||||||| || |||||||| ||||| || || | ||| || |||||||| || ||| Sbjct: 407 ccagcatcaccaacgatgccaatagccataccagcagagagaccagcgaggccgcaagcg 348 Query: 489 agcccggaggagagatgggcgtagccgtcgaa 520 || || || || | ||| |||||||| ||||| Sbjct: 347 agacccgaagacaaatgagcgtagccatcgaa 316
>emb|X95752.1|NTPROTATP N.tabacum mRNA for c subunit of V-type ATPase (980 bp) Length = 980 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 303 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 362 |||||||| ||||| || ||||| |||||||| || || || || ||||| || || ||| Sbjct: 546 gactggccagcacgagaagagagaatgatgccaacaataaggccataaagagccagggct 487 Query: 363 tctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagcc 422 || |||||||| ||||| || ||||| || || || |||||||| |||||||||||||| Sbjct: 486 tcagcgaaaataagaatcagaatcatcccaacaaagagctttggctgttgcgcattagct 427 Query: 423 ctgactccagcatcaccgacaatgccaatggccat 457 || || ||||||||||| || || || |||||||| Sbjct: 426 ctaacaccagcatcaccaacgattccgatggccat 392
>emb|X98851.1|BVSUBCATP B.vulgaris mRNA for subunit c of V-type ATPase Length = 1097 Score = 83.8 bits (42), Expect = 7e-13 Identities = 156/194 (80%) Strand = Plus / Minus Query: 312 gcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaa 371 |||||||| ||||||||||| || || || |||||||| | || | ||||| |||||| Sbjct: 617 gcacgggaagagaggatgataccaacaataagaccgtacaaagccaaagcttcagcgaaa 558 Query: 372 atgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgactcca 431 ||||||||||||||||| || ||||| ||||| || || || || || || ||||| || Sbjct: 557 atgagaatgaggatcattccaacgaaaagcttgggctgctgggcgtttgctctgacaccg 498 Query: 432 gcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagc 491 ||||| |||||||| || ||||||||||| || | ||| || || || ||||| ||||| Sbjct: 497 gcatcgccgacaataccgatggccatgccagcagagagaccagcaagaccacaagcgaga 438 Query: 492 ccggaggagagatg 505 || || |||||||| Sbjct: 437 ccagaagagagatg 424
>gb|AC006434.5|AC006434 Genomic sequence for Arabidopsis thaliana BAC F10A5, complete sequence Length = 129547 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Plus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 57311 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 57370 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcatt 418 || || ||||| ||||| |||||||| |||||||||||||| Sbjct: 57371 atcagaatcattcccacaaacagcttcggttgttgcgcatt 57411 Score = 65.9 bits (33), Expect = 2e-07 Identities = 120/149 (80%) Strand = Plus / Plus Query: 429 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 488 |||||||||||||| || ||||| ||||| || || | ||| || || || ||||| || Sbjct: 58202 ccagcatcaccgacgattccaatagccataccagcagagagaccagcaagaccacaagct 58261 Query: 489 agcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattg 548 ||||| || |||||||| || ||||| ||||| ||| | || | |||||||||||| || Sbjct: 58262 agcccagaagagagatgagcatagccatcgaataggtaataagacttggccttggggtta 58321 Query: 549 atcccggtgctgatgatgacggcgatgat 577 ||||| || |||||||| || |||||||| Sbjct: 58322 atcccagtactgatgataacagcgatgat 58350
>gb|AF153677.1|AF153677 Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa subunit c isoform 4 (AVAP4) gene, complete cds Length = 2762 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| || || |||||||| || || || |||||||| || || |||||| Sbjct: 1813 gatgagaggatgataccaacaatgagaccatacagtgcaagcgcttccgcaaagatgaga 1754 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcatt 418 || || ||||| ||||| |||||||| |||||||||||||| Sbjct: 1753 atcagaatcattcccacaaacagcttcggttgttgcgcatt 1713 Score = 81.8 bits (41), Expect = 3e-12 Identities = 122/149 (81%) Strand = Plus / Minus Query: 429 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 488 ||||||||||||||||| ||||||||||| || || | ||| || || || ||||| || Sbjct: 924 ccagcatcaccgacaatcccaatggccataccagcagagagaccagcaagaccacaagct 865 Query: 489 agcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattg 548 ||||| || |||||||| || ||||| ||||| ||| | || | |||||||||||| || Sbjct: 864 agcccagaagagagatgagcatagccatcgaataggtaataagacttggccttggggtta 805 Query: 549 atcccggtgctgatgatgacggcgatgat 577 ||||| || |||||||| || |||||||| Sbjct: 804 atcccagtactgatgataacagcgatgat 776
>dbj|AB036923.1| Citrus unshiu Cit-VATP c-2 gene for vacuolar H+-ATPase c subunit, complete cds Length = 1909 Score = 81.8 bits (41), Expect = 3e-12 Identities = 92/109 (84%) Strand = Plus / Minus Query: 318 gatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgaga 377 |||||||||||||| |||||||||||||| ||||| ||||| ||||| || || |||||| Sbjct: 1881 gatgagaggatgattcccacgatgagaccataaagagcgagagcttcggcaaagatgaga 1822 Query: 378 atgaggatcatacccacgaacagctttggttgttgcgcattagccctga 426 || || ||||| ||||| |||| ||| || || || || |||||||||| Sbjct: 1821 ataagaatcattcccacaaacaacttaggctgctgtgcgttagccctga 1773
>emb|AJ002061.1|BVSCVTATP Beta vulgaris mRNA for subunit c of V-type ATPase Length = 912 Score = 79.8 bits (40), Expect = 1e-11 Identities = 109/132 (82%) Strand = Plus / Minus Query: 326 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 385 ||||||||| || ||||||||||| || || || ||||| || || |||||||| ||||| Sbjct: 549 gatgatgccgacaatgagaccgtagagagcaagtgcttcagcaaagatgagaataaggat 490 Query: 386 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 445 ||| || ||||| |||||||| || || ||||| || || || ||||||||||| ||||| Sbjct: 489 catcccgacgaaaagctttggctgctgtgcattggctctaacaccagcatcaccaacaat 430 Query: 446 gccaatggccat 457 ||||| ||||| Sbjct: 429 accaatagccat 418
>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90 Length = 198987 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 62971 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 62912 Query: 387 atacccacgaacagctttggttgttgcgcattagccctg 425 ||||| ||||| |||||||| ||||| ||||| |||||| Sbjct: 62911 ataccaacgaaaagctttggctgttgagcattggccctg 62873 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || || |||||||||||| |||||| || |||||||| || |||||||| Sbjct: 62463 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 62404 Query: 558 ctgatgat 565 |||||||| Sbjct: 62403 ctgatgat 62396
>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project) Length = 100469 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 24961 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 24902 Query: 387 atacccacgaacagctttggttgttgcgcattagccctg 425 ||||| ||||| |||||||| ||||| ||||| |||||| Sbjct: 24901 ataccaacgaaaagctttggctgttgagcattggccctg 24863 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || || |||||||||||| |||||| || |||||||| || |||||||| Sbjct: 24453 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 24394 Query: 558 ctgatgat 565 |||||||| Sbjct: 24393 ctgatgat 24386
>gb|L44583.1|ATHAVAPB Arabidopsis thaliana vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p) gene, complete cds Length = 2546 Score = 77.8 bits (39), Expect = 4e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 327 atgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatc 386 ||||| || |||||||||||||| || || || ||||| ||||||||||| || || ||| Sbjct: 2118 atgatcccgacgatgagaccgtatagagcaagagcttcagcgaaaatgaggataagaatc 2059 Query: 387 atacccacgaacagctttggttgttgcgcattagccctg 425 ||||| ||||| |||||||| ||||| ||||| |||||| Sbjct: 2058 ataccaacgaaaagctttggctgttgagcattggccctg 2020 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 498 gagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatcccggtg 557 |||||||| || || |||||||||||| |||||| || |||||||| || |||||||| Sbjct: 1611 gagagatgagcatatccgtcgaagaggtagtaggatttagccttggggttaatcccggta 1552 Query: 558 ctgatgat 565 |||||||| Sbjct: 1551 ctgatgat 1544
>gb|AY261522.1| Suaeda maritima subsp. salsa vacuolar H(+)-ATPase subunit c mRNA, complete cds Length = 952 Score = 75.8 bits (38), Expect = 2e-10 Identities = 74/86 (86%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 ||||| ||||||||||| ||||||||||| || ||||| ||||| || || || ||||| Sbjct: 508 gcttcagcgaaaatgaggatgaggatcattccaacgaaaagcttgggctgctgggcattg 449 Query: 420 gccctgactccagcatcaccgacaat 445 || ||||| ||||||||||||||||| Sbjct: 448 gctctgacaccagcatcaccgacaat 423
>gb|AC152103.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A1, complete sequence Length = 40624 Score = 73.8 bits (37), Expect = 6e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 582 ccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctcc 641 ||||| || |||||||| ||||||||||| || || |||||||| ||||| || | |||| Sbjct: 14253 ccgtatatcccgagcacgcccgccatgaccaccgggacgatggatttcatcaccaactcc 14194 Query: 642 ggccgcatgacccccatggac 662 |||||||| |||||||||||| Sbjct: 14193 ggccgcatcacccccatggac 14173
>gb|AY610014.1| Sus scrofa clone Clu_560.scr.msk.p1.Contig3, mRNA sequence Length = 1146 Score = 73.8 bits (37), Expect = 6e-10 Identities = 67/77 (87%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| |||| ||||| ||||| ||| Sbjct: 597 gagaggatgagggcaacgatgagaccgtagaggccgagcacttccgcgaagatgaggatg 538 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 537 aggatcatgcccacgaa 521 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| ||||| | |||||||||||||| ||||| ||||||||||| Sbjct: 324 gccatgaccacggggatgatggacttcatgatcagctctggccgcatgac 275
>dbj|AB036924.1| Citrus unshiu Cit-VATP c-3 gene for vacuolar H+-ATPase c subunit, complete cds Length = 1369 Score = 73.8 bits (37), Expect = 6e-10 Identities = 187/237 (78%) Strand = Plus / Minus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| |||||||||||||| || ||||| ||||| || |||| ||| || || ||||| Sbjct: 497 cctgacaccagcatcaccgacgatcccaattgccataccagcggagagaccagcaaggcc 438 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||| ||||| || || |||||||| |||||||| ||||| ||| | || | |||||||| Sbjct: 437 acaagcgaggccagaagagagatgcgcgtagccatcgaaaaggtaataagatttggcctt 378 Query: 542 gggattgatcccggtgctgatgatgacggcgatgatgaggccgtagattccgagcactcc 601 || || || ||||| || || || || || || || | ||||| || || | ||||| Sbjct: 377 agggttaattccggtactaataataacagcaataatcaaaccgtaaatacccaaaactcc 318 Query: 602 cgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgacccccat 658 |||||| || ||||||||||| || ||||| || |||||||||| ||| || ||||| Sbjct: 317 cgccataacaacgggcacgatcgatttcatcacaagctccggcctcatcactcccat 261 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Minus Query: 348 taaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggt 407 ||||| || |||||||| || || || |||||||||||||| || ||||| ||||| || Sbjct: 1311 taaagtgccagcgcttcggcaaagatcagaatgaggatcatcccaacgaaaagcttcggc 1252 Query: 408 tgttgcgcattagc 421 ||||| |||||||| Sbjct: 1251 tgttgagcattagc 1238
>emb|X94999.1|MCVTATPC M.crystallinum mRNA for V-type ATPase c subunit Length = 991 Score = 71.9 bits (36), Expect = 3e-09 Identities = 108/132 (81%) Strand = Plus / Minus Query: 326 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 385 |||||| || || ||||||||||| || || |||||||| || || |||||||| || || Sbjct: 576 gatgataccgacaatgagaccgtagagagcaagcgcttcagcaaagatgagaataagaat 517 Query: 386 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 445 ||| |||||||| || ||||| || || ||||| || || || ||||||||||| ||||| Sbjct: 516 cattcccacgaaaagttttggctgctgagcattggctctaacaccagcatcaccaacaat 457 Query: 446 gccaatggccat 457 ||||| ||||| Sbjct: 456 accaatagccat 445
>gb|U13670.1|GHU13670 Gossypium hirsutum vacuolar H+-ATPase proteolipid (16 kDa) subunit (cva16-4) mRNA, complete cds Length = 895 Score = 71.9 bits (36), Expect = 3e-09 Identities = 99/120 (82%) Strand = Plus / Minus Query: 326 gatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggat 385 |||||||||||||||||| |||||||| || | ||||| || || ||||| || ||||| Sbjct: 550 gatgatgcccacgatgaggccgtaaagagccaaagcttcagcaaagatgaggataaggat 491 Query: 386 catacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaat 445 ||| || || || || ||||| || || |||||||| ||||| ||||||||||| ||||| Sbjct: 490 cattccaacaaaaagttttggctgctgtgcattagctctgacaccagcatcaccaacaat 431
>gb|U13669.1|GHU13669 Gossypium hirsutum vacuolar H+-ATPase proteolipid (16 kDa) subunit (cva16-2) mRNA, complete cds Length = 809 Score = 69.9 bits (35), Expect = 1e-08 Identities = 161/203 (79%) Strand = Plus / Minus Query: 372 atgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgactcca 431 ||||| || |||||||| || || || |||||||| || || || ||||| ||||| ||| Sbjct: 500 atgaggataaggatcattccaacaaaaagctttggctgctgtgcgttagctctgacacca 441 Query: 432 gcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcgagc 491 ||||| |||||||| ||||| ||||| || || | ||||| || |||||||| || || Sbjct: 440 gcatcgccgacaattccaattgccattccagcagaaagcccagcaaggccacaagcaaga 381 Query: 492 ccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggccttgggattgatc 551 || || || ||||||||||| || ||||| ||| | || | |||||||| ||||||||| Sbjct: 380 ccagaagaaagatgggcgtaaccatcgaaaaggtaatacgatttggccttaggattgatc 321 Query: 552 ccggtgctgatgatgacggcgat 574 || || || || ||||| ||||| Sbjct: 320 ccagtactaataatgacagcgat 298
>gb|AY826922.1| Heterocapsa triquetra clone HTVATP1 vacuolar ATP synthase mRNA, complete cds Length = 592 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 559 tgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacggg 616 |||||||||| ||| |||||||||||||||| ||||| ||||| ||||| |||||||| Sbjct: 271 tgatgatgactgcggtgatgaggccgtagatgccgaggactcctgccatcacgacggg 214
>gb|AC007797.7|AC007797 Arabidopsis thaliana chromosome I BAC F6F9 genomic sequence, complete sequence Length = 119942 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 8425 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 8484 Query: 381 aggatcatacccacgaacagctttggttgttgcgcatt 418 || ||||| ||||| |||| ||| |||||||| ||||| Sbjct: 8485 agaatcattcccacaaacaacttaggttgttgtgcatt 8522
>gb|U59737.1|ATU59737 Arabidopsis thaliana ATP sulfurylase (APS2) gene, complete cds, and vacuolar H+-pumping ATPase 16 kDa proteolipid (AVA-P2est) gene, partial cds Length = 3918 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || ||||| || || |||||||| Sbjct: 3374 gagaggatgataccaacaatgagaccgtacagggcaagtgcttcagcaaagatgagaatc 3433 Query: 381 aggatcatacccacgaacagctttggttgttgcgcatt 418 || ||||| ||||| |||| ||| |||||||| ||||| Sbjct: 3434 agaatcattcccacaaacaacttaggttgttgtgcatt 3471
>gb|L16884.1|HELATPASEV Heliothis virescens 17kDa H+-ATPase V-type subunit mRNA, complete cds Length = 1015 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||||||||| | |||||||||||||| |||||| |||||||| Sbjct: 252 cccgccatgacgacgggaatgatggacttcatgatgagctcaggccgcat 203
>gb|BC007759.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c, mRNA (cDNA clone MGC:12873 IMAGE:4127653), complete cds Length = 1069 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 564 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 505 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 504 aggatcatgcccacgaa 488 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 621 atggacttcatgacgagctccggccgcatgac 652 ||||||||||||| |||||||||||||||| Sbjct: 273 atggacttcatgatctgctccggccgcatgac 242
>gb|BC007389.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c, mRNA (cDNA clone MGC:16271 IMAGE:3831016), complete cds Length = 1134 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 580 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 521 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 520 aggatcatgcccacgaa 504 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 307 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 258
>gb|BT014562.1| Lycopersicon esculentum clone 134016F, mRNA sequence Length = 947 Score = 65.9 bits (33), Expect = 2e-07 Identities = 81/97 (83%) Strand = Plus / Minus Query: 369 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagccctgact 428 ||||| ||||| | ||||||||| || || || ||||||||||| ||||| || || || Sbjct: 514 aaaataagaatcaagatcataccaacaaagagttttggttgttgtgcatttgctctaaca 455 Query: 429 ccagcatcaccgacaatgccaatggccatgccggcgg 465 ||||||||||| ||||| ||||| ||||| ||||||| Sbjct: 454 ccagcatcaccaacaattccaatagccattccggcgg 418
>gb|BT007459.1| Synthetic construct Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c mRNA, partial cds Length = 468 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>gb|BT007155.1| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c mRNA, complete cds Length = 468 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>emb|CR622720.1| full-length cDNA clone CS0DM012YP05 of Fetal liver of Homo sapiens (human) Length = 1035 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 544 aggatcatgcccacgaa 528 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282
>emb|CR616665.1| full-length cDNA clone CS0DF036YP04 of Fetal brain of Homo sapiens (human) Length = 869 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 390 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 331 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 330 aggatcatgcccacgaa 314 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 117 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 68
>emb|CR616464.1| full-length cDNA clone CS0DC002YJ21 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 989 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 508 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 449 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 448 aggatcatgcccacgaa 432 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 235 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 186
>emb|CR613683.1| full-length cDNA clone CS0DD001YD19 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 730 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 281 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 222 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 221 aggatcatgcccacgaa 205
>emb|CR608280.1| full-length cDNA clone CS0DC018YA15 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1042 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 595 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 536 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 535 aggatcatgcccacgaa 519 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 322 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 273
>emb|CR603009.1| full-length cDNA clone CS0DK007YM15 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 627 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 144 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 85 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 84 aggatcatgcccacgaa 68
>emb|CR601237.1| full-length cDNA clone CS0DC029YE21 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1062 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 585 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 526 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 525 aggatcatgcccacgaa 509 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 312 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 263
>emb|CR600796.1| full-length cDNA clone CS0DI019YH17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 949 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 547 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 488 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 487 aggatcatgcccacgaa 471 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 274 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 225
>emb|CR599331.1| full-length cDNA clone CS0DH005YC07 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1018 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 581 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 522 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 521 aggatcatgcccacgaa 505 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 308 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 259
>emb|CR599309.1| full-length cDNA clone CS0DI067YF17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1057 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 544 aggatcatgcccacgaa 528 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282
>emb|CR597229.1| full-length cDNA clone CS0DN004YA02 of Adult brain of Homo sapiens (human) Length = 1046 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 568 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 509 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 508 aggatcatgcccacgaa 492 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 295 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 246
>emb|CR592409.1| full-length cDNA clone CS0DI067YN17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1057 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 604 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 545 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 544 aggatcatgcccacgaa 528 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 331 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 282
>emb|CR592150.1| full-length cDNA clone CS0DF014YE05 of Fetal brain of Homo sapiens (human) Length = 1071 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 592 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 533 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 532 aggatcatgcccacgaa 516 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 319 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 270
>emb|CR590083.1| full-length cDNA clone CS0DJ004YP02 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 992 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 513 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 454 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 453 aggatcatgcccacgaa 437 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 240 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 191
>ref|NM_001694.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c (ATP6V0C), mRNA Length = 1126 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 610 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 551 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 550 aggatcatgcccacgaa 534 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 337 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 288
>emb|CR541951.1| Homo sapiens full open reading frame cDNA clone RZPDo834E0134D for gene ATP6V0C, ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c; complete cds, without stopcodon Length = 465 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>emb|CR541930.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0334D for gene ATP6V0C, ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c; complete cds, incl. stopcodon Length = 468 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>gb|BC004537.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c, mRNA (cDNA clone MGC:3723 IMAGE:3618755), complete cds Length = 1077 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 576 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 517 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 516 aggatcatgcccacgaa 500 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 303 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 254
>gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, complete sequence Length = 157518 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 73505 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 73564 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 73565 aggatcatgcccacgaa 73581 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Plus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 73917 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 73966
>gb|AY892471.1| Synthetic construct Homo sapiens clone FLH014562.01L ATPase H+ transporting lysosomal 16kDa V0 subunit c (ATP6V0C) mRNA, partial cds Length = 468 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>gb|AY889986.1| Synthetic construct Homo sapiens clone FLH014566.01X ATPase lysosomal V0 subunit c (ATP6V0C) mRNA, complete cds Length = 468 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 185 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 136
>gb|BC009290.2| Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c, mRNA (cDNA clone MGC:16615 IMAGE:4111426), complete cds Length = 1113 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 597 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 538 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 537 aggatcatgcccacgaa 521 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 324 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 275
>gb|M62762.1|HUMPCHSUCA Human vacuolar H+ ATPase proton channel subunit mRNA, complete cds Length = 1162 Score = 65.9 bits (33), Expect = 2e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || ||||| |||||||| Sbjct: 688 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcgaagatgagaatc 629 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 628 aggatcatgcccacgaa 612 Score = 44.1 bits (22), Expect = 0.58 Identities = 43/50 (86%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| |||||||||||||||| Sbjct: 415 gccatgaccactgggatgatggacttcatgatctgctccggccgcatgac 366
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 63.9 bits (32), Expect = 6e-07 Identities = 116/144 (80%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| || |||||||| ||||| ||||||||||| || || | ||| || || || || Sbjct: 23230 cctgacaccggcatcaccaacaatcccaatggccattccagctgagagaccagcaagacc 23289 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||| || || || || |||||||| ||||| || || |||||| |||| | ||| ||||| Sbjct: 23290 acaagcaagaccagacgagagatgtgcgtatccatcaaagaggtagtaagacttagcctt 23349 Query: 542 gggattgatcccggtgctgatgat 565 ||| || |||||||| |||||||| Sbjct: 23350 ggggttaatcccggtactgatgat 23373 Score = 44.1 bits (22), Expect = 0.58 Identities = 67/82 (81%) Strand = Plus / Plus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 23056 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 23115 Query: 405 ggttgttgcgcattagccctga 426 || || || ||||| ||||||| Sbjct: 23116 ggctgctgagcatttgccctga 23137
>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project) Length = 125502 Score = 63.9 bits (32), Expect = 6e-07 Identities = 116/144 (80%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| || |||||||| ||||| ||||||||||| || || | ||| || || || || Sbjct: 104462 cctgacaccggcatcaccaacaatcccaatggccattccagctgagagaccagcaagacc 104521 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaagaggaagtagggcttggcctt 541 ||| || || || || |||||||| ||||| || || |||||| |||| | ||| ||||| Sbjct: 104522 acaagcaagaccagacgagagatgtgcgtatccatcaaagaggtagtaagacttagcctt 104581 Query: 542 gggattgatcccggtgctgatgat 565 ||| || |||||||| |||||||| Sbjct: 104582 ggggttaatcccggtactgatgat 104605 Score = 44.1 bits (22), Expect = 0.58 Identities = 67/82 (81%) Strand = Plus / Plus Query: 345 ccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaacagcttt 404 |||||||| || ||||||||||||||||| || || || ||||| || || || ||||| Sbjct: 104288 ccgtaaagagcaagcgcttctgcgaaaataaggataagaatcatcccaacaaagagctta 104347 Query: 405 ggttgttgcgcattagccctga 426 || || || ||||| ||||||| Sbjct: 104348 ggctgctgagcatttgccctga 104369
>dbj|AP006639.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT25N16, TM0216, complete sequence Length = 95667 Score = 63.9 bits (32), Expect = 6e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| ||||||||||| ||||| ||||| ||||||||||| | |||||| || || || Sbjct: 93902 cctgacaccagcatcaccaacaataccaatagccatgccggcagagagcccagcaagccc 93961 Query: 482 acaggcgagcccggaggagagatg 505 ||||| || || ||||||||||| Sbjct: 93962 gcaggcaagaccagaggagagatg 93985 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 302 ggactggccggcacgggatgagaggatgatgcccacgatgagacc 346 |||||| || ||||| || ||||||||||| || ||||||||||| Sbjct: 92922 ggactgaccagcacgagaagagaggatgataccgacgatgagacc 92966
>gb|AY190685.1| Pagrus major ATPase H+ transporting lysosomal vacuolar proton pump mRNA, complete cds Length = 676 Score = 60.0 bits (30), Expect = 1e-05 Identities = 42/46 (91%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggcc 645 ||||||||||||||||| | ||| |||||||||| ||||||||||| Sbjct: 387 cccgccatgacgacggggatgattgacttcatgatgagctccggcc 342
>emb|X65051.1|MSVATP16S M.sexta mRNA for vacuolar ATPase 16 kD proteolipid subunit Length = 1428 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||||||||| | |||||||||||||| ||||| |||||||| Sbjct: 238 cccgccatgacgacggggatgatggacttcatgatcagctcgggccgcat 189
>gb|BC102659.1| Bos taurus proteolipid protein, mRNA (cDNA clone MGC:127859 IMAGE:30956944), complete cds Length = 1187 Score = 60.0 bits (30), Expect = 1e-05 Identities = 54/62 (87%) Strand = Plus / Minus Query: 336 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 395 |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| |||||| Sbjct: 602 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 543 Query: 396 aa 397 || Sbjct: 542 aa 541 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| | ||| ||||||||||| Sbjct: 347 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 295
>emb|BX816345.1|CNS0ABM3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH42ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1207 Score = 60.0 bits (30), Expect = 1e-05 Identities = 81/98 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 ||||||||||| || || ||||||||||| ||||| || |||| || || |||||||| Sbjct: 1017 gagaggatgataccaacaatgagaccgtacagggcaagttcttcagcaaagatgagaatc 958 Query: 381 aggatcatacccacgaacagctttggttgttgcgcatt 418 || ||||| ||||| |||| ||| |||||||| ||||| Sbjct: 957 agaatcattcccacaaacaacttaggttgttgtgcatt 920
>ref|NM_001017954.1| Bos taurus ATPase, H+ transporting, lysosomal, V0 subunit c (ATP6V0C), mRNA Length = 1133 Score = 60.0 bits (30), Expect = 1e-05 Identities = 54/62 (87%) Strand = Plus / Minus Query: 336 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 395 |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| |||||| Sbjct: 575 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 516 Query: 396 aa 397 || Sbjct: 515 aa 514 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| | ||| ||||||||||| Sbjct: 320 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 268
>gb|AY246555.1| Spodoptera littoralis H(+)-ATPase C subunit mRNA, partial cds Length = 314 Score = 60.0 bits (30), Expect = 1e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||||||||| | |||||| ||||||| |||||| |||||||| Sbjct: 78 cccgccatgacgacgggaatgatggatttcatgatgagctcgggccgcat 29
>gb|J03835.1|BOVATPPLC Bovine proteolipid protein of the H+ -ATPase of chromaffin granules mRNA, complete cds Length = 1133 Score = 60.0 bits (30), Expect = 1e-05 Identities = 54/62 (87%) Strand = Plus / Minus Query: 336 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 395 |||||||||||||| ||| ||||| | || ||||| ||||| ||||||||||| |||||| Sbjct: 575 acgatgagaccgtagaggccgagcacctcggcgaagatgaggatgaggatcatgcccacg 516 Query: 396 aa 397 || Sbjct: 515 aa 514 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| | ||| ||||||||||| Sbjct: 320 cccgccatgaccaccgggatgatggacttcatgatcatctctggccgcatgac 268
>dbj|AB028204.1| Porphyra yezoensis mRNA for vacuolar-ATPase c subunit, complete cds Length = 921 Score = 60.0 bits (30), Expect = 1e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 351 agggcgagcgcttctgcgaaaatgagaatgaggatcat 388 |||||||||||||| |||||||||||||| |||||||| Sbjct: 614 agggcgagcgcttcagcgaaaatgagaatcaggatcat 577 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 582 ccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctcc 641 |||||||| |||||||| ||||||||||| ||||| | |||| | ||| || |||||| Sbjct: 389 ccgtagataccgagcacacccgccatgaccacgggaatgatgcagcgcatcaccagctcc 330 Query: 642 ggccgcatgacccccatggac 662 || |||||||| ||||||||| Sbjct: 329 gggcgcatgacacccatggac 309
>emb|CR728680.2|CNS0GP72 Tetraodon nigroviridis full-length cDNA Length = 1423 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 382 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 330
>emb|CR723295.2|CNS0GL1H Tetraodon nigroviridis full-length cDNA Length = 1424 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 382 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 330
>emb|CR719662.2|CNS0GI8K Tetraodon nigroviridis full-length cDNA Length = 861 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 362 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 310
>emb|CR703907.2|CNS0G633 Tetraodon nigroviridis full-length cDNA Length = 858 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 364 cccgccatgaccacagggatgatggacttcatgatgagctccggcctcatgac 312
>emb|CR649696.2|CNS0F09Y Tetraodon nigroviridis full-length cDNA Length = 852 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 358 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 306
>emb|CR648948.2|CNS0EZP6 Tetraodon nigroviridis full-length cDNA Length = 853 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 ||||||||||| || || | |||||||||||||| ||||||||||| |||||| Sbjct: 358 cccgccatgaccactgggatgatggacttcatgatgagctccggcctcatgac 306
>dbj|D21104.1|RICAK23 Oryza sativa mRNA for H+-ATPase, partial sequence Length = 307 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 612 acgggcacgatggacttcatgacgagctccggc 644 |||||||||||||||||||| |||||||||||| Sbjct: 306 acgggcacgatggacttcatcacgagctccggc 274
>gb|AC148293.6| Medicago truncatula clone mth2-16c13, complete sequence Length = 117793 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 303 gactggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgct 362 |||||||||||||| || || | ||| || || || ||||||||||||||||| || ||| Sbjct: 18755 gactggccggcacgtgaagacaagataataccaacaatgagaccgtaaagggcaagagct 18814 Query: 363 tctgcgaaaatgagaatgaggatcatacccacgaacagctttgg 406 || || || ||||| || |||||||| || ||||| || ||||| Sbjct: 18815 tcagcaaagatgaggataaggatcattccaacgaaaagttttgg 18858
>emb|AJ879499.1| Phaseolus vulgaris SCAR-RADP fragment SG14 Length = 671 Score = 56.0 bits (28), Expect = 2e-04 Identities = 79/96 (82%) Strand = Plus / Plus Query: 429 ccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggccacaggcg 488 ||||||||||| ||||| ||||| |||||||| || | ||||| || | ||||||||| Sbjct: 449 ccagcatcaccaacaataccaatagccatgcctgcagacagcccagccaagccacaggca 508 Query: 489 agcccggaggagagatgggcgtagccgtcgaagagg 524 || || ||||||||||| ||||| || || |||||| Sbjct: 509 agaccagaggagagatgtgcgtaaccatcaaagagg 544
>emb|BX817547.1|CNS0AB6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL2ZD03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 706 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 390 cccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgacaatgcca 449 ||||| || ||||| |||||||||||||| || || || |||||||||||||| || ||| Sbjct: 416 cccacaaagagcttcggttgttgcgcattcgctctcacaccagcatcaccgacgattcca 357 Query: 450 atggccat 457 || ||||| Sbjct: 356 atagccat 349 Score = 40.1 bits (20), Expect = 9.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 533 cttggccttgggattgatcccggtgctgatga 564 |||||||||||| || ||||| |||||||||| Sbjct: 273 cttggccttggggttaatcccagtgctgatga 242
>ref|XM_859597.1| PREDICTED: Canis familiaris similar to Vacuolar ATP synthase 16 kDa proteolipid subunit, transcript variant 2 (LOC479877), mRNA Length = 1140 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 339 atgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaa 397 ||||||||||| ||| ||||| | || ||||||||||| || |||||||| |||||||| Sbjct: 587 atgagaccgtagaggccgagcacctcggcgaaaatgaggatcaggatcatgcccacgaa 529
>ref|XM_537002.2| PREDICTED: Canis familiaris similar to Vacuolar ATP synthase 16 kDa proteolipid subunit, transcript variant 1 (LOC479877), mRNA Length = 1131 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 339 atgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacgaa 397 ||||||||||| ||| ||||| | || ||||||||||| || |||||||| |||||||| Sbjct: 578 atgagaccgtagaggccgagcacctcggcgaaaatgaggatcaggatcatgcccacgaa 520
>ref|XM_947896.1| Theileria annulata strain Ankara vacuolar H+-ATPase subunit (TA07825) partial mRNA Length = 501 Score = 54.0 bits (27), Expect = 6e-04 Identities = 72/87 (82%) Strand = Plus / Minus Query: 573 atgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatg 632 |||||||| |||||||||||||| || || ||||| | ||||| | ||| ||||||||| Sbjct: 209 atgatgagaccgtagattccgagaacaccggccataataacggggatgatcgacttcatg 150 Query: 633 acgagctccggccgcatgacccccatg 659 ||||| || || ||||| || |||||| Sbjct: 149 acgagatcagggcgcatcacacccatg 123
>ref|XM_510748.1| PREDICTED: Pan troglodytes similar to Vacuolar ATP synthase 16 kDa proteolipid subunit (LOC453837), mRNA Length = 521 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 603 gccatgacgacgggcacgatggacttcatgacgagctccggccgcatgac 652 |||||||| || || | |||||||||||||| ||||||||||||||||| Sbjct: 227 gccatgaccactgggatgatggacttcatgatcagctccggccgcatgac 178
>gb|AY617308.1| Sterkiella histriomuscorum clone UGC1O0001_L09_R genomic sequence Length = 1046 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 414 gcattagccctgactccagcatcaccgacaatgccaat 451 |||||||| |||||||| |||||||||||||| ||||| Sbjct: 709 gcattagctctgactcctgcatcaccgacaataccaat 672
>gb|BC067156.1| Danio rerio ATPase, H+ transporting, lysosomal, V0 subunit c, mRNA (cDNA clone MGC:76969 IMAGE:6525380), complete cds Length = 1201 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| ||||| | |||||||||||||| ||||| |||||||| Sbjct: 307 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 258
>gb|BC063154.1| Rattus norvegicus ATPase, H transporting, lysosomal V0 subunit c, mRNA (cDNA clone MGC:72710 IMAGE:6918203), complete cds Length = 1186 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 616 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 557 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 |||||||| ||||||||||| || || || ||| | ||| ||| |||||||| ||| Sbjct: 556 aggatcatgcccacgaacagtcgaggctgctgggcagtgccccggacaccagcatctccg 497 Query: 441 acaatgccaatggc 454 |||||||||||||| Sbjct: 496 acaatgccaatggc 483
>ref|NM_130823.2| Rattus norvegicus ATPase, H transporting, lysosomal V0 subunit c (Atp6v0c), mRNA Length = 1186 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 616 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 557 Query: 381 aggatcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccg 440 |||||||| ||||||||||| || || || ||| | ||| ||| |||||||| ||| Sbjct: 556 aggatcatgcccacgaacagtcgaggctgctgggcagtgccccggacaccagcatctccg 497 Query: 441 acaatgccaatggc 454 |||||||||||||| Sbjct: 496 acaatgccaatggc 483
>emb|BX908778.5| Zebrafish DNA sequence from clone CH211-193E17 in linkage group 3, complete sequence Length = 138862 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| ||||| | |||||||||||||| ||||| |||||||| Sbjct: 64423 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 64472
>gb|AY099523.1| Danio rerio vacuolar ATP synthase 16 kDa proteolipid subunit (atp6l) mRNA, complete cds Length = 902 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| ||||| | |||||||||||||| ||||| |||||||| Sbjct: 351 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 302
>ref|NM_173255.1| Danio rerio ATPase, H+ transporting, lysosomal, V0 subunit c (atp6v0c), mRNA Length = 902 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| ||||| | |||||||||||||| ||||| |||||||| Sbjct: 351 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 302
>emb|CR387933.10| Zebrafish DNA sequence from clone DKEY-81L17 in linkage group 3, complete sequence Length = 182618 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 ||||||||||| ||||| | |||||||||||||| ||||| |||||||| Sbjct: 112270 cccgccatgaccacgggaatgatggacttcatgatcagctctggccgcat 112221
>dbj|AB003942.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase proteolipid subunit, complete cds Length = 826 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/74 (83%) Strand = Plus / Minus Query: 384 atcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgaca 443 |||||||| || |||||||| ||||||| |||||||| | || ||||||||||| ||| Sbjct: 476 atcataccgacaaacagcttaggttgttaggcattagcacgcacaccagcatcacccaca 417 Query: 444 atgccaatggccat 457 || ||||| ||||| Sbjct: 416 attccaatagccat 403
>ref|XM_530928.1| PREDICTED: Pan troglodytes LOC462697 (LOC462697), mRNA Length = 837 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 620 gatggacttcatgacgagctccggccgcatgac 652 |||||||||||||| ||||||||||||||||| Sbjct: 33 gatggacttcatgatcagctccggccgcatgac 65
>gb|AC149546.14| Medicago truncatula clone mth2-70o13, complete sequence Length = 124127 Score = 50.1 bits (25), Expect = 0.009 Identities = 91/113 (80%) Strand = Plus / Plus Query: 306 tggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttct 365 ||||| || ||||| |||||||||||||| || || || ||||| | || | ||| || Sbjct: 27259 tggccagcgcgggaagagaggatgatgccaacaataagtccgtacaacgccaacgcctcg 27318 Query: 366 gcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatt 418 ||||||||||| ||||| ||||| || || || |||||||| ||||| ||||| Sbjct: 27319 gcgaaaatgaggatgagaatcattccaacaaaaagctttggctgttgagcatt 27371
>emb|AL049843.18|HSJ392M17 Human DNA sequence from clone RP3-392M17 on chromosome 6p12.3-21.2 Contains an ATPase H+ transporting lysosomal (ATP6C) pseudogene, the RDS gene for retinal degeneration slow (retinitis pigmentosa 7), the 3' end of the UBR2 gene for ubiquitin protein ligase E3 component n-recognin 2 and a CpG island, complete sequence Length = 110900 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 620 gatggacttcatgacgagctccggccgcatgac 652 |||||||||||||| ||||||||||||||||| Sbjct: 12754 gatggacttcatgatcagctccggccgcatgac 12786
>gb|AC174351.5| Medicago truncatula clone mth2-7h5, complete sequence Length = 109873 Score = 50.1 bits (25), Expect = 0.009 Identities = 91/113 (80%) Strand = Plus / Plus Query: 306 tggccggcacgggatgagaggatgatgcccacgatgagaccgtaaagggcgagcgcttct 365 ||||| || ||||| |||||||||||||| || || || ||||| | || | ||| || Sbjct: 94150 tggccagcgcgggaagagaggatgatgccaacaataagtccgtacaacgccaacgcctcg 94209 Query: 366 gcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatt 418 ||||||||||| ||||| ||||| || || || |||||||| ||||| ||||| Sbjct: 94210 gcgaaaatgaggatgagaatcattccaacaaaaagctttggctgttgagcatt 94262
>ref|NM_001009195.1| Ovis aries vacuolar ATPase 16kDa subunit c (ATP6V0C), mRNA Length = 468 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || || || ||||| || Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcaaagatgaggata 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382
>gb|AF027705.1|AF027705 Ovis aries vacuolar ATPase 16kDa subunit c mRNA, complete cds Length = 468 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||||| | | |||||||||||||| ||| ||||| | || || || ||||| || Sbjct: 458 gagaggatgagggcgacgatgagaccgtagaggccgagcacctcggcaaagatgaggata 399 Query: 381 aggatcatacccacgaa 397 |||||||| |||||||| Sbjct: 398 aggatcatgcccacgaa 382
>dbj|AB036922.1| Citrus unshiu Cit-VATP c-1 gene for vacuolar H+-ATPase c subunit, complete cds Length = 1060 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 369 aaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattagc 421 |||||||||||||| ||||| || || || ||||||||||| || |||||||| Sbjct: 981 aaaatgagaatgagaatcattccaacaaaaagctttggttgctgtgcattagc 929 Score = 46.1 bits (23), Expect = 0.15 Identities = 80/99 (80%) Strand = Plus / Minus Query: 422 cctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgaggcc 481 |||||| ||||||||||| || |||||||| ||||| || || | ||| || |||||||| Sbjct: 443 cctgacaccagcatcaccaacgatgccaatagccataccagcagagagaccagcgaggcc 384 Query: 482 acaggcgagcccggaggagagatgggcgtagccgtcgaa 520 || ||||| || || || | ||| |||||||| ||||| Sbjct: 383 gcaagcgagacccgaagacaaatgagcgtagccatcgaa 345
>gb|AC166573.2| Mus musculus BAC clone RP23-153H18 from chromosome 17, complete sequence Length = 193004 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Plus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 153764 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 153823 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 153824 aggatcatgcccacgaacag 153843
>ref|XM_460869.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F12683g) partial mRNA Length = 483 Score = 48.1 bits (24), Expect = 0.037 Identities = 45/52 (86%) Strand = Plus / Minus Query: 403 ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggc 454 |||||||||||||| || | ||||| || |||||||| ||||| |||||||| Sbjct: 370 ttggttgttgcgcagtacctctgacaccggcatcaccaacaattccaatggc 319
>gb|AC117577.16| Mus musculus chromosome 17, clone RP23-35F19, complete sequence Length = 198548 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 188224 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 188165 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 188164 aggatcatgcccacgaacag 188145
>gb|BT012440.1| Drosophila melanogaster RH30178 full insert cDNA Length = 2812 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 518 cttcggcgaagatgagaatcaggatcatgcccacgaacag 479
>gb|AY232009.1| Drosophila yakuba clone yak-ad_Vha16 mRNA sequence Length = 477 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 430 cttcggcgaagatgagaatcaggatcatgcccacgaacag 391
>gb|AC153623.8| Mus musculus 6 BAC RP23-459F14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 205825 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 132410 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 132351 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 132350 aggatcatgcccacgaacag 132331
>gb|BC099475.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA (cDNA clone IMAGE:30938468), partial cds Length = 1130 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 546 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 487 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 486 aggatcatgcccacgaacag 467
>gb|BC083129.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA (cDNA clone IMAGE:6440462), partial cds Length = 1147 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 583 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 524 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 523 aggatcatgcccacgaacag 504
>gb|BC057084.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA (cDNA clone IMAGE:5708539) Length = 2392 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 2020 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 1961 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 1960 aggatcatgcccacgaacag 1941
>emb|BX035037.1|CNS08Z75 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 329 cttcggcgaaaatgaggatcaggatcataccgacgaacag 290
>emb|BX023184.1|CNS08Q1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 535 cttcggcgaaaatgaggatcaggatcataccgacgaacag 574
>emb|BX023183.1|CNS08Q1V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 493 cttcggcgaaaatgaggatcaggatcataccgacgaacag 454
>emb|BX022537.1|CNS08PJX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 930 cttcggcgaaaatgaggatcaggatcataccgacgaacag 969
>emb|BX022536.1|CNS08PJW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 645 cttcggcgaaaatgaggatcaggatcataccgacgaacag 606
>emb|BX020878.1|CNS08O9U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 557 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 441 cttcggcgaaaatgaggatcaggatcataccgacgaacag 402
>emb|BX016528.1|CNS08KX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 626 cttcggcgaaaatgaggatcaggatcataccgacgaacag 587
>emb|BX011628.1|CNS08H4W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 536 cttcggcgaaaatgaggatcaggatcataccgacgaacag 575
>emb|BX011627.1|CNS08H4V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 498 cttcggcgaaaatgaggatcaggatcataccgacgaacag 459
>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii Length = 2336804 Score = 48.1 bits (24), Expect = 0.037 Identities = 45/52 (86%) Strand = Plus / Minus Query: 403 ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggc 454 |||||||||||||| || | ||||| || |||||||| ||||| |||||||| Sbjct: 1012849 ttggttgttgcgcagtacctctgacaccggcatcaccaacaattccaatggc 1012798
>emb|X77936.1|DMCSDUC D.melanogaster (Canton S) ductin, subunit C proteolipid gene Length = 7252 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 6660 cttcggcgaagatgagaatcaggatcatgcccacgaacag 6621
>ref|NM_009729.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C (Atp6v0c), mRNA Length = 1153 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 605 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 546 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 545 aggatcatgcccacgaacag 526
>ref|NM_165476.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RD, transcript variant D (Vha16), mRNA Length = 1142 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 535 cttcggcgaagatgagaatcaggatcatgcccacgaacag 496
>ref|NM_165475.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RC, transcript variant C (Vha16), mRNA Length = 1307 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 700 cttcggcgaagatgagaatcaggatcatgcccacgaacag 661
>ref|NM_165474.1| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RB, transcript variant B (Vha16), mRNA Length = 1159 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 552 cttcggcgaagatgagaatcaggatcatgcccacgaacag 513
>ref|NM_057453.3| Drosophila melanogaster Vacuolar H+ ATPase 16kD subunit CG3161-RA, transcript variant A (Vha16), mRNA Length = 1200 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 593 cttcggcgaagatgagaatcaggatcatgcccacgaacag 554
>dbj|AK146159.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730024L21 product:ATPase, H+ transporting, V0 subunit C, full insert sequence Length = 1117 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 569 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 510 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 509 aggatcatgcccacgaacag 490
>dbj|AK170346.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630049E13 product:ATPase, H+ transporting, V0 subunit C, full insert sequence Length = 918 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 569 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 510 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 509 aggatcatgcccacgaacag 490
>gb|AF356008.1|AF356008 Mus musculus vacuolar proton-translocating ATPase 16 kDa subunit gene, complete cds Length = 6186 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 6103 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 6044 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 6043 aggatcatgcccacgaacag 6024
>dbj|AK002871.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610040L07 product:ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16 kDa, full insert sequence Length = 940 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 591 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 532 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 531 aggatcatgcccacgaacag 512
>dbj|AK002570.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610011P10 product:ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16 kDa, full insert sequence Length = 1160 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 612 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 553 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 552 aggatcatgcccacgaacag 533
>dbj|AK028239.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:2900002E12 product:ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16 kDa, full insert sequence Length = 1141 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 593 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 534 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 533 aggatcatgcccacgaacag 514
>gb|AC007593.5|AC007593 Drosophila melanogaster, chromosome 2R, region 42E-43A, BAC clone BACR01C10, complete sequence Length = 173702 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 86091 cttcggcgaagatgagaatcaggatcatgcccacgaacag 86130
>ref|XM_559193.1| Anopheles gambiae str. PEST ENSANGP00000027550 (ENSANGG00000020729), partial mRNA Length = 819 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 430 cttcggcgaaaatgaggatcaggatcataccgacgaacag 391 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatga 633 ||||||||||| ||||| | |||||||||||||| Sbjct: 194 cccgccatgacaacgggaatgatggacttcatga 161
>ref|XM_311406.2| Anopheles gambiae str. PEST ENSANGP00000025336 (ENSANGG00000020729), partial mRNA Length = 777 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || ||||||||||| |||||||| Sbjct: 529 cttcggcgaaaatgaggatcaggatcataccgacgaacag 490 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatga 633 ||||||||||| ||||| | |||||||||||||| Sbjct: 293 cccgccatgacaacgggaatgatggacttcatga 260
>gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 of 73 of the complete sequence Length = 415717 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 372959 cttcggcgaagatgagaatcaggatcatgcccacgaacag 372998
>gb|U13842.1|MMU13842 Mus musculus vacuolar adenosine triphosphatase subunit c gene, complete cds Length = 1129 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 580 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 521 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 520 aggatcatgcccacgaacag 501
>emb|CT010502.13| Mouse DNA sequence from clone RP23-27H19 on chromosome 17, complete sequence Length = 246273 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 25109 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 25050 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 25049 aggatcatgcccacgaacag 25030
>emb|X55979.1|DMVHATP Drosophila mRNA for vacuolar H+-ATPase Length = 1138 Score = 48.1 bits (24), Expect = 0.037 Identities = 36/40 (90%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 546 cttcggcgaagatgagaatcaggatcatgcccacgaacag 507
>gb|M64298.1|MUSMVP Mouse vacuolar H(+)-ATPase (mvp) mRNA, complete cds Length = 1153 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 605 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 546 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 545 aggatcatgcccacgaacag 526
>dbj|D10874.1|RATSDHATP Rattus norvegicus mRNA for H(+)-transporting ATPase, complete cds Length = 1082 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 553 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 494 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 493 aggatcatgcccacgaacag 474
>dbj|AB059662.1| Mus musculus mvp gene for vacuolar H+-ATPase 16-kDa proteolipid subunit, complete cds Length = 10813 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 321 gagaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatg 380 |||||||| | | |||||||||||||||| ||| | ||| | || || || ||||| || Sbjct: 9126 gagaggattagggccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatc 9067 Query: 381 aggatcatacccacgaacag 400 |||||||| ||||||||||| Sbjct: 9066 aggatcatgcccacgaacag 9047
>dbj|AB028205.1| Porphyra yezoensis gene for vacuolar-ATPase c subunit, complete cds Length = 1562 Score = 48.1 bits (24), Expect = 0.037 Identities = 60/72 (83%) Strand = Plus / Minus Query: 591 ccgagcactcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcatg 650 |||||||| ||||||||||| ||||| | |||| | ||| || |||||||| |||||| Sbjct: 196 ccgagcacacccgccatgaccacgggaatgatgcagcgcatcaccagctccgggcgcatg 137 Query: 651 acccccatggac 662 || ||||||||| Sbjct: 136 acacccatggac 125 Score = 44.1 bits (22), Expect = 0.58 Identities = 28/30 (93%) Strand = Plus / Minus Query: 359 cgcttctgcgaaaatgagaatgaggatcat 388 |||||| |||||||||||||| |||||||| Sbjct: 1281 cgcttcagcgaaaatgagaatcaggatcat 1252
>dbj|AB003938.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase proteolipid subunit, complete cds Length = 825 Score = 48.1 bits (24), Expect = 0.037 Identities = 84/104 (80%) Strand = Plus / Minus Query: 558 ctgatgatgacggcgatgatgaggccgtagattccgagcactcccgccatgacgacgggc 617 |||||||||||||| || || |||||||| || || | ||| |||||||| || || ||| Sbjct: 345 ctgatgatgacggcaataatcaggccgtaaatacccaacacacccgccataacaaccggc 286 Query: 618 acgatggacttcatgacgagctccggccgcatgacccccatgga 661 || ||||| ||||| || || || || ||||| || |||||||| Sbjct: 285 acaatggatttcatcactagttcagggcgcatcacacccatgga 242
>ref|NM_205554.1| Danio rerio zgc:77708 (zgc:77708), mRNA Length = 1775 Score = 46.1 bits (23), Expect = 0.15 Identities = 44/51 (86%) Strand = Plus / Minus Query: 599 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 |||||||||||| || || | |||||||||||||| |||||||| ||||| Sbjct: 357 tcccgccatgaccacaggaatgatggacttcatgatcagctccggacgcat 307
>ref|XM_956325.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 16 KDA PROTEOLIPID SUBUNIT (NCU01332.1) partial mRNA Length = 444 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 |||| |||||||||||||| || ||||| || ||||| || | |||||||| ||| | Sbjct: 373 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 314 Query: 421 ccctgactccagcatcaccgacaatgccaat 451 | | ||| ||||||||||||||||| ||||| Sbjct: 313 cacggacaccagcatcaccgacaataccaat 283
>ref|XM_326824.1| Neurospora crassa OR74A VACUOLAR ATP SYNTHASE 16 KDA PROTEOLIPID SUBUNIT (NCU01332.1) partial mRNA Length = 444 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 |||| |||||||||||||| || ||||| || ||||| || | |||||||| ||| | Sbjct: 373 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 314 Query: 421 ccctgactccagcatcaccgacaatgccaat 451 | | ||| ||||||||||||||||| ||||| Sbjct: 313 cacggacaccagcatcaccgacaataccaat 283
>ref|XM_567918.1| Cryptococcus neoformans var. neoformans JEC21 hydrogen ion transporter (CNK03340) partial mRNA Length = 709 Score = 46.1 bits (23), Expect = 0.15 Identities = 113/143 (79%) Strand = Plus / Minus Query: 336 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcatacccacg 395 |||||||| |||||||| | || |||| ||||||||||| || |||||||| || || Sbjct: 515 acgatgagcccgtaaagaccaagaacttcggcgaaaatgaggataaggatcatcccgaca 456 Query: 396 aacagctttggttgttgcgcattagccctgactccagcatcaccgacaatgccaatggcc 455 |||| | | || || || || || ||||||| || ||||||||||| || || ||||| Sbjct: 455 aacaacctaggctgctgggccgtacccctgacacccgcatcaccgacgataccgatggca 396 Query: 456 atgccggcggcgagccccgcgag 478 | |||||||||||| || ||||| Sbjct: 395 aagccggcggcgagaccggcgag 373
>ref|XM_758859.1| Theileria parva strain Muguga chromosome 4 vacuolar ATPase subunit (TP04_0317) partial mRNA Length = 719 Score = 46.1 bits (23), Expect = 0.15 Identities = 71/87 (81%) Strand = Plus / Minus Query: 573 atgatgaggccgtagattccgagcactcccgccatgacgacgggcacgatggacttcatg 632 ||||||||||| ||||| ||||| || || ||||| | ||||| | ||| ||||||||| Sbjct: 359 atgatgaggccatagataccgagaacaccagccataataacgggaatgatagacttcatg 300 Query: 633 acgagctccggccgcatgacccccatg 659 ||||| || || ||||| || |||||| Sbjct: 299 acgagatcagggcgcatcacacccatg 273
>gb|BC050939.1| Mus musculus ATPase, H+ transporting, lysosomal V0 subunit C, mRNA (cDNA clone IMAGE:6820042), partial cds Length = 918 Score = 46.1 bits (23), Expect = 0.15 Identities = 56/67 (83%) Strand = Plus / Minus Query: 334 ccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcataccca 393 |||||||||||||||| ||| | ||| | || || || ||||| || |||||||| |||| Sbjct: 540 ccacgatgagaccgtagaggccaagcacctccgcaaagatgaggatcaggatcatgccca 481 Query: 394 cgaacag 400 ||||||| Sbjct: 480 cgaacag 474
>emb|AL590075.8| Human DNA sequence from clone RP11-462L13 on chromosome X, complete sequence Length = 135711 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 209 tcaaaattagaacttttcaaagcttcc 235 |||||| |||||||||||||||||||| Sbjct: 35579 tcaaaaatagaacttttcaaagcttcc 35553
>emb|AL451017.1|NC12F11 Neurospora crassa DNA linkage group V Cosmid contig 12F11 Length = 74317 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 |||| |||||||||||||| || ||||| || ||||| || | |||||||| ||| | Sbjct: 36780 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 36721 Query: 421 ccctgactccagcatcaccgacaatgccaat 451 | | ||| ||||||||||||||||| ||||| Sbjct: 36720 cacggacaccagcatcaccgacaataccaat 36690
>gb|BC065849.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:77708 IMAGE:7000508), complete cds Length = 1775 Score = 46.1 bits (23), Expect = 0.15 Identities = 44/51 (86%) Strand = Plus / Minus Query: 599 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 |||||||||||| || || | |||||||||||||| |||||||| ||||| Sbjct: 357 tcccgccatgaccacaggaatgatggacttcatgatcagctccggacgcat 307
>gb|BC093130.1| Danio rerio zgc:77708, mRNA (cDNA clone MGC:111904 IMAGE:7427484), complete cds Length = 919 Score = 46.1 bits (23), Expect = 0.15 Identities = 44/51 (86%) Strand = Plus / Minus Query: 599 tcccgccatgacgacgggcacgatggacttcatgacgagctccggccgcat 649 |||||||||||| || || | |||||||||||||| |||||||| ||||| Sbjct: 378 tcccgccatgaccacaggaatgatggacttcatgatcagctccgggcgcat 328
>gb|AC009430.2|AC009430 Homo sapiens, clone RP11-45O17, complete sequence Length = 156454 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Plus Query: 209 tcaaaattagaacttttcaaagcttcc 235 |||||| |||||||||||||||||||| Sbjct: 116687 tcaaaaatagaacttttcaaagcttcc 116713
>gb|L07105.1|NEUVMA3A Neurospora crassa proteolipid subunit of vacuolar ATPase (vma3) gene, complete cds Length = 2631 Score = 46.1 bits (23), Expect = 0.15 Identities = 74/91 (81%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 |||| |||||||||||||| || ||||| || ||||| || | |||||||| ||| | Sbjct: 1649 cttcggcgaaaatgagaataagaatcatgccgacgaagagtctgggttgttgagcagttc 1590 Query: 421 ccctgactccagcatcaccgacaatgccaat 451 | | ||| ||||||||||||||||| ||||| Sbjct: 1589 cacggacaccagcatcaccgacaataccaat 1559
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 44.1 bits (22), Expect = 0.58 Identities = 49/58 (84%) Strand = Plus / Plus Query: 421 ccctgactccagcatcaccgacaatgccaatggccatgccggcggcgagccccgcgag 478 ||||||| || ||||||||||| || || ||||| | |||||||||||| || ||||| Sbjct: 982962 ccctgacacccgcatcaccgacgataccgatggcaaagccggcggcgagaccggcgag 983019
>ref|XM_718009.1| Candida albicans SC5314 vacuolar ATPase subunit c (CaO19_5886), mRNA Length = 309 Score = 44.1 bits (22), Expect = 0.58 Identities = 76/94 (80%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 ||||||||||||| | ||| | ||||||||| || |||| |||||||||| ||| || Sbjct: 238 cttctgcgaaaatcaaaatcaagatcataccaacaaacaatcttggttgttgggcagtac 179 Query: 421 ccctgactccagcatcaccgacaatgccaatggc 454 | ||||| || || ||||| ||||| |||||||| Sbjct: 178 ctctgacaccggcgtcaccaacaataccaatggc 145
>ref|XM_717862.1| Candida albicans SC5314 vacuolar ATPase subunit c (CaO19_13307), mRNA Length = 309 Score = 44.1 bits (22), Expect = 0.58 Identities = 76/94 (80%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcattag 420 ||||||||||||| | ||| | ||||||||| || |||| |||||||||| ||| || Sbjct: 238 cttctgcgaaaatcaaaatcaagatcataccaacaaacaatcttggttgttgggcagtac 179 Query: 421 ccctgactccagcatcaccgacaatgccaatggc 454 | ||||| || || ||||| ||||| |||||||| Sbjct: 178 ctctgacaccggcgtcaccaacaataccaatggc 145
>gb|AY488488.1| Capsicum annuum V-type ATPase c subunit mRNA, complete cds Length = 640 Score = 44.1 bits (22), Expect = 0.58 Identities = 61/74 (82%) Strand = Plus / Minus Query: 384 atcatacccacgaacagctttggttgttgcgcattagccctgactccagcatcaccgaca 443 ||||| || ||||| |||||||| |||||||| || || || || ||||| ||||| || Sbjct: 358 atcatcccgacgaaaagctttggctgttgcgcgttggctctaacaccagcgtcaccaacg 299 Query: 444 atgccaatggccat 457 || ||||||||||| Sbjct: 298 attccaatggccat 285
>ref|XM_390178.1| Gibberella zeae PH-1 chromosome 1 VATL_NEUCR Vacuolar ATP synthase 16 kDa proteolipid subunit (FG10002.1) partial mRNA Length = 486 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 429 ccagcatcaccgacaatgccaatggc 454 ||||||||||||||||| |||||||| Sbjct: 347 ccagcatcaccgacaataccaatggc 322
>ref|XM_385030.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG04854.1) partial mRNA Length = 501 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 426 actccagcatcaccgacaatgccaat 451 |||||||||||||||||||| ||||| Sbjct: 383 actccagcatcaccgacaattccaat 358 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 369 aaaatgagaatgaggatcataccc 392 |||||||||||||||| ||||||| Sbjct: 440 aaaatgagaatgaggaccataccc 417
>gb|AF008924.1| Aedes aegypti V-ATPase C-subunit mRNA, complete cds Length = 854 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 600 cccgccatgacgacgggcacgatggacttcatga 633 ||||||||||| ||||| | |||||||||||||| Sbjct: 350 cccgccatgacaacgggaatgatggacttcatga 317 Score = 40.1 bits (20), Expect = 9.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaacag 400 |||| ||||||||||| || || |||||||| |||||||| Sbjct: 586 cttcagcgaaaatgaggatcagaatcataccgacgaacag 547
>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome Length = 5373180 Score = 44.1 bits (22), Expect = 0.58 Identities = 25/26 (96%) Strand = Plus / Minus Query: 53 caataggattaaaacccatattccca 78 |||||||||||||| ||||||||||| Sbjct: 1247333 caataggattaaaaaccatattccca 1247308
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 460 cggcggcgagccccgcgaggcc 481 |||||||||||||||||||||| Sbjct: 1046763 cggcggcgagccccgcgaggcc 1046784
>dbj|AB003940.1| Acetabularia acetabulum mRNA for vacuolar type H+-ATPase proteolipid subunit, complete cds Length = 752 Score = 44.1 bits (22), Expect = 0.58 Identities = 52/62 (83%) Strand = Plus / Minus Query: 360 gcttctgcgaaaatgagaatgaggatcatacccacgaacagctttggttgttgcgcatta 419 |||||||||||||| | ||| | ||||||||| || |||| || |||||||| |||||| Sbjct: 506 gcttctgcgaaaatcaaaatcaagatcataccaacaaacaatttaggttgttgggcatta 447 Query: 420 gc 421 || Sbjct: 446 gc 445
>gb|AF331918.1| Homo sapiens 19 19q13.3 carnitine acyltransferase-like protein 1 (CATL1) gene, complete cds; nuclear gene for mitochondrial product, alternatively spliced Length = 25804 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 gagaccgtaaagggcgagcgc 361 ||||||||||||||||||||| Sbjct: 1263 gagaccgtaaagggcgagcgc 1283
>ref|XM_471460.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1518 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 553 cggtgctgatgatgacggcga 573 ||||||||||||||||||||| Sbjct: 1329 cggtgctgatgatgacggcga 1349
>ref|XM_655600.1| Aspergillus nidulans FGSC A4 vacuolar ATP synthase 16 kDa proteolipid subunit (AN3088.2), mRNA Length = 486 Score = 42.1 bits (21), Expect = 2.3 Identities = 45/53 (84%) Strand = Plus / Minus Query: 336 acgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaatgaggatcat 388 ||||||||||||||||| | || |||| |||||||||||||| || ||||| Sbjct: 440 acgatgagaccgtaaagacccagaacttcagcgaaaatgagaataagaatcat 388
>gb|AF480884.1| Chimpanzee cytomegalovirus, complete genome Length = 241087 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 561 atgatgacggcgatgatgagg 581 ||||||||||||||||||||| Sbjct: 134316 atgatgacggcgatgatgagg 134336
>ref|XM_505831.1| Yarrowia lipolytica CLIB122, YALI0F24475g predicted mRNA Length = 495 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaa 397 |||| |||||||||||||| || |||||||| ||||| Sbjct: 424 cttcggcgaaaatgagaataagaatcataccaacgaa 388
>ref|XM_962866.1| PREDICTED: Tribolium castaneum similar to Vacuolar ATP synthase 16 kDa proteolipid subunit (Ductin) (VHA16K) (LOC656327), mRNA Length = 877 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaa 397 |||| ||||||||||| ||||||||||| || ||||| Sbjct: 529 cttcagcgaaaatgaggatgaggatcattccgacgaa 493
>emb|AJ312686.1|HSA312686 Homo sapiens partial LIMD1 gene for LIM domains containing 1, exons 1-2, complete sequence Length = 85000 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 catattcccaggagcagcaat 89 ||||||||||||||||||||| Sbjct: 64255 catattcccaggagcagcaat 64235
>gb|AC011495.8| Homo sapiens chromosome 19 clone CTB-33G10, complete sequence Length = 209844 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 gagaccgtaaagggcgagcgc 361 ||||||||||||||||||||| Sbjct: 115760 gagaccgtaaagggcgagcgc 115780
>gb|AC111399.4| Rattus norvegicus Mcs BAC CH230-138L13 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 210984 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 559 tgatgatgacggcgatgatga 579 ||||||||||||||||||||| Sbjct: 73703 tgatgatgacggcgatgatga 73723
>ref|XM_627909.1| Cryptosporidium parvum Iowa II vacuolar ATP synthetase subunit (cgd1_520), partial mRNA Length = 498 Score = 42.1 bits (21), Expect = 2.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 403 ttggttgttgcgcattagccctgactccagcatcaccgacaatgccaat 451 |||||||||| ||| ||| || || ||||||||||||||||| ||||| Sbjct: 373 ttggttgttgagcagcagctctaacaccagcatcaccgacaataccaat 325
>gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's Hospital Oakland Research Institute) complete sequence Length = 213875 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 559 tgatgatgacggcgatgatga 579 ||||||||||||||||||||| Sbjct: 157264 tgatgatgacggcgatgatga 157284
>ref|NM_070587.2| Caenorhabditis elegans Y43D4A.5 (Y43D4A.5) mRNA, complete cds Length = 4947 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 caaaattagaacttttcaaag 230 ||||||||||||||||||||| Sbjct: 168 caaaattagaacttttcaaag 188
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 553 cggtgctgatgatgacggcga 573 ||||||||||||||||||||| Sbjct: 11137398 cggtgctgatgatgacggcga 11137418
>gb|AF222689.1|AF222689 Homo sapiens protein arginine N-methyltransferase 1 (HRMT1L2) gene, complete cds, alternatively spliced Length = 15382 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 341 gagaccgtaaagggcgagcgc 361 ||||||||||||||||||||| Sbjct: 15309 gagaccgtaaagggcgagcgc 15329
>emb|X52002.1|TM15KDAM T.marmorata 15 kDa mRNA from a mediatophore Length = 616 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 426 actccagcatcaccgacaatgccaatggc 454 |||||||||||||| || ||||||||||| Sbjct: 417 actccagcatcacctactatgccaatggc 389
>emb|AL132846.1|CEY43D4A Caenorhabditis elegans YAC Y43D4A, complete sequence Length = 59321 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 210 caaaattagaacttttcaaag 230 ||||||||||||||||||||| Sbjct: 33144 caaaattagaacttttcaaag 33164
>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09, complete sequence Length = 141580 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 553 cggtgctgatgatgacggcga 573 ||||||||||||||||||||| Sbjct: 6022 cggtgctgatgatgacggcga 6042
>gb|U53182.1|PCU53182 Pleurochrysis carterae V-type ATPase 16 kD proteolipid subunit mRNA, partial cds Length = 668 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 323 gaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaat 379 |||||| | ||| ||||||||||||||||| | ||||| || ||||| |||||||| Sbjct: 309 gaggatcaggccgacgatgagaccgtaaagtccaagcgcctccgcgaagatgagaat 253
>gb|U48365.1|PCU48365 Pleurochrysis carterae V-type ATPase 16 kDa proteolipid subunit mRNA, complete cds Length = 889 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 323 gaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaat 379 |||||| | ||| ||||||||||||||||| | ||||| || ||||| |||||||| Sbjct: 473 gaggatcaggccgacgatgagaccgtaaagtccaagcgcctccgcgaagatgagaat 417
>gb|U81519.1|PCU81519 Pleurochrysis carterae vacuolar-type H(+)-ATPase incompletely processed mRNA, complete cds Length = 1378 Score = 42.1 bits (21), Expect = 2.3 Identities = 48/57 (84%) Strand = Plus / Minus Query: 323 gaggatgatgcccacgatgagaccgtaaagggcgagcgcttctgcgaaaatgagaat 379 |||||| | ||| ||||||||||||||||| | ||||| || ||||| |||||||| Sbjct: 990 gaggatcaggccgacgatgagaccgtaaagtccaagcgcctccgcgaagatgagaat 934
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Plus Query: 361 cttctgcgaaaatgagaatgaggatcatacccacgaa 397 |||| |||||||||||||| || |||||||| ||||| Sbjct: 3185791 cttcggcgaaaatgagaataagaatcataccaacgaa 3185827
>ref|XM_476085.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 4425 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 453 gccatgccggcggcgagccc 472 |||||||||||||||||||| Sbjct: 1025 gccatgccggcggcgagccc 1006 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,732,413 Number of Sequences: 3902068 Number of extensions: 5732413 Number of successful extensions: 122058 Number of sequences better than 10.0: 281 Number of HSP's better than 10.0 without gapping: 276 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 120791 Number of HSP's gapped (non-prelim): 1254 length of query: 662 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 639 effective length of database: 17,143,297,704 effective search space: 10954567232856 effective search space used: 10954567232856 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
