ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38h16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_479811.1| Oryza sativa (japonica cultivar-group), mRNA 507 e-140
2dbj|AK099289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 507 e-140
3dbj|AK058565.1| Oryza sativa (japonica cultivar-group) cDNA clon... 507 e-140
4gb|AY108512.1| Zea mays PCO080956 mRNA sequence 341 2e-90
5dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
6dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
7gb|U19099.1|LCU19099 Lycopersicon chilense unknown protein (LC15... 82 2e-12
8gb|AC138464.19| Medicago truncatula clone mth2-29i23, complete s... 56 1e-04
9dbj|AB168559.1| Macaca fascicularis testis cDNA clone: QtsA-1304... 56 1e-04
10emb|CR666674.2|CNS0FDDK Tetraodon nigroviridis full-length cDNA 54 6e-04
11emb|CR664627.2|CNS0FBSP Tetraodon nigroviridis full-length cDNA 54 6e-04
12gb|BC064288.1| Danio rerio COP9 constitutive photomorphogenic ho... 52 0.002
13gb|BC045415.1| Danio rerio COP9 constitutive photomorphogenic ho... 52 0.002
14ref|NM_199685.1| Danio rerio COP9 constitutive photomorphogenic ... 52 0.002
15ref|XM_696986.1| PREDICTED: Danio rerio hypothetical protein LOC... 52 0.002
16gb|BC095590.1| Danio rerio cDNA clone MGC:111903 IMAGE:7416080, ... 52 0.002
17ref|XM_777925.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
18ref|XM_788402.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
19ref|XM_783474.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
20ref|XM_783677.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.009
21ref|XM_511309.1| PREDICTED: Pan troglodytes similar to COP9 comp... 48 0.034
22ref|XM_584631.2| PREDICTED: Bos taurus similar to COP9 constitut... 48 0.034
23gb|BC001891.1| Homo sapiens COP9 constitutive photomorphogenic h... 48 0.034
24ref|NM_003653.2| Homo sapiens COP9 constitutive photomorphogenic... 48 0.034
25emb|CR857080.1| Pongo pygmaeus mRNA; cDNA DKFZp468P1922 (from cl... 48 0.034
26emb|CR622277.1| full-length cDNA clone CS0DI060YM17 of Placenta ... 48 0.034
27emb|CR619826.1| full-length cDNA clone CS0DI031YO02 of Placenta ... 48 0.034
28emb|CR618089.1| full-length cDNA clone CS0DI041YI01 of Placenta ... 48 0.034
29emb|CR617410.1| full-length cDNA clone CS0DC027YB20 of Neuroblas... 48 0.034
30emb|CR616766.1| full-length cDNA clone CS0DI079YH15 of Placenta ... 48 0.034
31emb|CR613300.1| full-length cDNA clone CS0DI066YJ23 of Placenta ... 48 0.034
32emb|CR611420.1| full-length cDNA clone CS0DI016YI21 of Placenta ... 48 0.034
33emb|CR608585.1| full-length cDNA clone CS0DI032YC22 of Placenta ... 48 0.034
34emb|CR602972.1| full-length cDNA clone CS0DA007YN02 of Neuroblas... 48 0.034
35emb|CR600698.1| full-length cDNA clone CS0DE006YH01 of Placenta ... 48 0.034
36emb|CR599192.1| full-length cDNA clone CS0DK003YE18 of HeLa cell... 48 0.034
37emb|CR597915.1| full-length cDNA clone CL0BB018ZG04 of Neuroblas... 48 0.034
38emb|CR595552.1| full-length cDNA clone CS0DA012YL07 of Neuroblas... 48 0.034
39emb|CR594817.1| full-length cDNA clone CS0DI087YE04 of Placenta ... 48 0.034
40emb|CR590945.1| full-length cDNA clone CS0DJ010YM03 of T cells (... 48 0.034
41gb|AF098109.1|AF098109 Homo sapiens COP9 complex subunit 3 (COPS... 48 0.034
42gb|AF031647.1|AF031647 Homo sapiens JAB1-containing signalosome ... 48 0.034
43ref|XM_788326.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.13
44emb|AJ720483.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.53
45ref|NM_001006163.1| Gallus gallus COP9 constitutive photomorphog... 44 0.53
46gb|AC055811.20| Homo sapiens chromosome 17, clone RP11-45M22, co... 44 0.53
47emb|AJ009613.4|HSAJ9613 Homo sapiens chromosome 17 sequence from... 44 0.53
48gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosom... 42 2.1
49gb|AC115629.3| Mus musculus BAC clone RP23-74J16 from chromosome... 42 2.1
50gb|AC010064.7| Drosophila melanogaster 3L BAC RP98-22I16 (Roswel... 42 2.1
51ref|XM_794190.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
52ref|NM_079466.2| Drosophila melanogaster COP9 complex homolog su... 42 2.1
53gb|AY071575.1| Drosophila melanogaster RE63441 full length cDNA 42 2.1
54gb|AC008560.6| Homo sapiens chromosome 5 clone CTC-534A2, comple... 42 2.1
55gb|AF129081.1|AF129081 Drosophila melanogaster COP9 signalosome ... 42 2.1
56gb|AE003592.3| Drosophila melanogaster chromosome 3L, section 73... 42 2.1
57dbj|AK113755.1| Ciona intestinalis cDNA, clone:cicl008c20, full ... 42 2.1
58gb|AC142211.3| Mus musculus BAC clone RP24-501B23 from chromosom... 40 8.3
59gb|BC068179.1| Mus musculus COP9 (constitutive photomorphogenic)... 40 8.3
60ref|NM_011991.1| Mus musculus COP9 (constitutive photomorphogeni... 40 8.3
61gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 40 8.3
62gb|BC079143.1| Rattus norvegicus COP9 (constitutive photomorphog... 40 8.3
63gb|AC120052.2| Homo sapiens chromosome 8, clone CTD-2232O19, com... 40 8.3
64gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosom... 40 8.3
65gb|AC102582.9| Mus musculus chromosome 9, clone RP23-312A24, com... 40 8.3
66ref|NM_001004200.1| Rattus norvegicus COP9 (constitutive photomo... 40 8.3
67gb|AC144478.20| Medicago truncatula clone mth2-20b20, complete s... 40 8.3
68gb|AY377991.1| Triticum aestivum chloroplast-localized Ptr ToxA-... 40 8.3
69gb|AY841794.1| Aeromonas hydrophila strain AH-3 polar flagellar ... 40 8.3
70gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Ca... 40 8.3
71gb|AY736122.1| Triticum aestivum chloroplast inositol phosphatas... 40 8.3
72gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Canc... 40 8.3
73gb|AC022716.13| Homo sapiens chromosome 8, clone RP11-135I5, com... 40 8.3
74dbj|AK142318.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 8.3
75gb|AC011008.10| Homo sapiens chromosome 8, clone RP11-177H2, com... 40 8.3
76dbj|AK169747.1| Mus musculus 2 days neonate thymus thymic cells ... 40 8.3
77gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 8.3
78gb|AC154785.2| Mus musculus BAC clone RP23-92M20 from chromosome... 40 8.3
79gb|AC055712.13| Homo sapiens 3 BAC RP11-63K8 (Roswell Park Cance... 40 8.3
80dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 40 8.3
81emb|BX510986.8| Zebrafish DNA sequence from clone CH211-173P18 i... 40 8.3
82gb|AE015450.1| Mycoplasma gallisepticum strain R complete genome 40 8.3
83gb|DQ124698.1| Aeromonas hydrophila strain AH-3 FliE (fliE), Fli... 40 8.3
84gb|AF071313.1|AF071313 Mus musculus COP9 complex subunit 3 (COPS... 40 8.3
85gb|AC163288.4| Mus musculus BAC clone RP23-279M5 from chromosome... 40 8.3 
>ref|XM_479811.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1596

 Score =  507 bits (256), Expect = e-140
 Identities = 381/422 (90%), Gaps = 3/422 (0%)
 Strand = Plus / Minus

                                                                        
Query: 146  tctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatcttgcac---gt 202
            ||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||   | 
Sbjct: 1397 tctcaaaaatatttgtgcggaactgagtcgaagtcatcgtaatcgaatcttccaccacgc 1338

                                                                        
Query: 203  tcccttccactcttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgaggtc 262
            || |||||| ||||||| ||| ||||| |||||||||||||||||| |||||| || | |
Sbjct: 1337 tctcttccagtcttcattaaatatgcaggatcgcacgagatgttctcatcaatagaagac 1278

                                                                        
Query: 263  agcttcttggacaaagccatcaacctctgaatagaagagtcgatgtgctccaccatttca 322
            |||||||||||||||||||||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 1277 agcttcttggacaaagccatcaacctttgaatagacgagtcaatatgctcaaccatctca 1218

                                                                        
Query: 323  ctacttttatattgctcaggatcttcattaaagctgaccatgccatccttctggtttatc 382
            |  ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| 
Sbjct: 1217 cagcttttatattgctcaggatcttcatgaaagctgaccatcccatccttctggtttatg 1158

                                                                        
Query: 383  gttgcatagatctcaccatcttcaatcatcctaagtacatgcatctcagcttctttcggg 442
            ||||||| ||||||||||||||||||||||||||| |||||||||||||| || ||||||
Sbjct: 1157 gttgcatggatctcaccatcttcaatcatcctaagcacatgcatctcagcctccttcggg 1098

                                                                        
Query: 443  gtgttaagttgaacagagctagcaatgtcttcaagcgaaagagttaaataggtctgggtc 502
            || ||||||||||||||||| ||||| || |||||||||||||| || |||||||| |||
Sbjct: 1097 gttttaagttgaacagagctggcaatatcctcaagcgaaagagtcaagtaggtctgtgtc 1038

                                                                        
Query: 503  agcctctggatgtttcgcttgtacattgaagagagcacttgcttcacgagtccaaggttg 562
            | ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 1037 aacctctggatgtttcgcttgtacattgaggagagcacttgcttcacaagtccaaggttg 978

              
Query: 563  tt 564
            ||
Sbjct: 977  tt 976
to top
>dbj|AK099289.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126C02, full
            insert sequence
          Length = 1542

 Score =  507 bits (256), Expect = e-140
 Identities = 381/422 (90%), Gaps = 3/422 (0%)
 Strand = Plus / Minus

                                                                        
Query: 146  tctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatcttgcac---gt 202
            ||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||   | 
Sbjct: 1343 tctcaaaaatatttgtgcggaactgagtcgaagtcatcgtaatcgaatcttccaccacgc 1284

                                                                        
Query: 203  tcccttccactcttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgaggtc 262
            || |||||| ||||||| ||| ||||| |||||||||||||||||| |||||| || | |
Sbjct: 1283 tctcttccagtcttcattaaatatgcaggatcgcacgagatgttctcatcaatagaagac 1224

                                                                        
Query: 263  agcttcttggacaaagccatcaacctctgaatagaagagtcgatgtgctccaccatttca 322
            |||||||||||||||||||||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 1223 agcttcttggacaaagccatcaacctttgaatagacgagtcaatatgctcaaccatctca 1164

                                                                        
Query: 323  ctacttttatattgctcaggatcttcattaaagctgaccatgccatccttctggtttatc 382
            |  ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| 
Sbjct: 1163 cagcttttatattgctcaggatcttcatgaaagctgaccatcccatccttctggtttatg 1104

                                                                        
Query: 383  gttgcatagatctcaccatcttcaatcatcctaagtacatgcatctcagcttctttcggg 442
            ||||||| ||||||||||||||||||||||||||| |||||||||||||| || ||||||
Sbjct: 1103 gttgcatggatctcaccatcttcaatcatcctaagcacatgcatctcagcctccttcggg 1044

                                                                        
Query: 443  gtgttaagttgaacagagctagcaatgtcttcaagcgaaagagttaaataggtctgggtc 502
            || ||||||||||||||||| ||||| || |||||||||||||| || |||||||| |||
Sbjct: 1043 gttttaagttgaacagagctggcaatatcctcaagcgaaagagtcaagtaggtctgtgtc 984

                                                                        
Query: 503  agcctctggatgtttcgcttgtacattgaagagagcacttgcttcacgagtccaaggttg 562
            | ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 983  aacctctggatgtttcgcttgtacattgaggagagcacttgcttcacaagtccaaggttg 924

              
Query: 563  tt 564
            ||
Sbjct: 923  tt 922
to top
>dbj|AK058565.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-E02, full
            insert sequence
          Length = 1596

 Score =  507 bits (256), Expect = e-140
 Identities = 381/422 (90%), Gaps = 3/422 (0%)
 Strand = Plus / Minus

                                                                        
Query: 146  tctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatcttgcac---gt 202
            ||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||   | 
Sbjct: 1397 tctcaaaaatatttgtgcggaactgagtcgaagtcatcgtaatcgaatcttccaccacgc 1338

                                                                        
Query: 203  tcccttccactcttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgaggtc 262
            || |||||| ||||||| ||| ||||| |||||||||||||||||| |||||| || | |
Sbjct: 1337 tctcttccagtcttcattaaatatgcaggatcgcacgagatgttctcatcaatagaagac 1278

                                                                        
Query: 263  agcttcttggacaaagccatcaacctctgaatagaagagtcgatgtgctccaccatttca 322
            |||||||||||||||||||||||||| |||||||| ||||| || ||||| ||||| |||
Sbjct: 1277 agcttcttggacaaagccatcaacctttgaatagacgagtcaatatgctcaaccatctca 1218

                                                                        
Query: 323  ctacttttatattgctcaggatcttcattaaagctgaccatgccatccttctggtttatc 382
            |  ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| 
Sbjct: 1217 cagcttttatattgctcaggatcttcatgaaagctgaccatcccatccttctggtttatg 1158

                                                                        
Query: 383  gttgcatagatctcaccatcttcaatcatcctaagtacatgcatctcagcttctttcggg 442
            ||||||| ||||||||||||||||||||||||||| |||||||||||||| || ||||||
Sbjct: 1157 gttgcatggatctcaccatcttcaatcatcctaagcacatgcatctcagcctccttcggg 1098

                                                                        
Query: 443  gtgttaagttgaacagagctagcaatgtcttcaagcgaaagagttaaataggtctgggtc 502
            || ||||||||||||||||| ||||| || |||||||||||||| || |||||||| |||
Sbjct: 1097 gttttaagttgaacagagctggcaatatcctcaagcgaaagagtcaagtaggtctgtgtc 1038

                                                                        
Query: 503  agcctctggatgtttcgcttgtacattgaagagagcacttgcttcacgagtccaaggttg 562
            | ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 1037 aacctctggatgtttcgcttgtacattgaggagagcacttgcttcacaagtccaaggttg 978

              
Query: 563  tt 564
            ||
Sbjct: 977  tt 976
to top
>gb|AY108512.1| Zea mays PCO080956 mRNA sequence
          Length = 706

 Score =  341 bits (172), Expect = 2e-90
 Identities = 393/466 (84%), Gaps = 3/466 (0%)
 Strand = Plus / Minus

                                                                       
Query: 141 gatcatctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatcttgcac 200
           ||||| |||||||||| ||||| ||||| ||||||||||| ||||||||||||||| |||
Sbjct: 704 gatcaactcaaaaatacttgtgtggaacagagtcgaagtcgtcgtagtcgaatcttccac 645

                                                                       
Query: 201 gttcccttccactcttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgagg 260
           | ||||||||   | |||||||| |||||  ||| || || ||||||||||||||||| |
Sbjct: 644 gatcccttcc---cgtcatcaaatatgcagtatcacatgacatgttctgatcaattgaag 588

                                                                       
Query: 261 tcagcttcttggacaaagccatcaacctctgaatagaagagtcgatgtgctccaccattt 320
            || |||||||||||| ||| |||| || || ||||| | ||| || ||||||||||| |
Sbjct: 587 ccaacttcttggacaatgccgtcaatctatggatagaggtgtcaatatgctccaccatct 528

                                                                       
Query: 321 cactacttttatattgctcaggatcttcattaaagctgaccatgccatccttctggttta 380
           ||  |||||||||||| ||||||||||||| |||||||||||| |||||||| |||||||
Sbjct: 527 caacacttttatattgttcaggatcttcatgaaagctgaccattccatccttttggttta 468

                                                                       
Query: 381 tcgttgcatagatctcaccatcttcaatcatcctaagtacatgcatctcagcttctttcg 440
           | | ||||| |||||| || ||||| ||||| | |||||||||||| ||||| ||  | |
Sbjct: 467 tggatgcatggatctctccgtcttcgatcatgcgaagtacatgcatttcagcatcccttg 408

                                                                       
Query: 441 gggtgttaagttgaacagagctagcaatgtcttcaagcgaaagagttaaataggtctggg 500
           | || | |||||||||||| |||||||| |||||||| |||||||| || || |||||||
Sbjct: 407 gtgtttcaagttgaacagacctagcaatatcttcaagtgaaagagtcaagtaagtctggg 348

                                                                       
Query: 501 tcagcctctggatgtttcgcttgtacattgaagagagcacttgcttcacgagtccaaggt 560
           ||||||| |||||||| || |||||||| || ||||||||||||||||| || |||||||
Sbjct: 347 tcagcctttggatgttccgtttgtacatcgaggagagcacttgcttcaccagcccaaggt 288

                                                         
Query: 561 tgttatcagtttggaaggcctctgcatttgactggatgaatgtctc 606
           |||| |||| ||| || ||  ||| |||||| ||||||||||||||
Sbjct: 287 tgttgtcagattgaaatgctgctgaatttgattggatgaatgtctc 242
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  206 bits (104), Expect = 6e-50
 Identities = 143/156 (91%)
 Strand = Plus / Minus

                                                                           
Query: 409     catcctaagtacatgcatctcagcttctttcggggtgttaagttgaacagagctagcaat 468
               ||||||||| |||||||||||||| || |||||||| ||||||||||||||||| |||||
Sbjct: 1047399 catcctaagcacatgcatctcagcctccttcggggttttaagttgaacagagctggcaat 1047340

                                                                           
Query: 469     gtcttcaagcgaaagagttaaataggtctgggtcagcctctggatgtttcgcttgtacat 528
                || |||||||||||||| || |||||||| |||| ||||||||||||||||||||||||
Sbjct: 1047339 atcctcaagcgaaagagtcaagtaggtctgtgtcaacctctggatgtttcgcttgtacat 1047280

                                                   
Query: 529     tgaagagagcacttgcttcacgagtccaaggttgtt 564
               ||| ||||||||||||||||| ||||||||||||||
Sbjct: 1047279 tgaggagagcacttgcttcacaagtccaaggttgtt 1047244



 Score =  153 bits (77), Expect = 8e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                           
Query: 285     acctctgaatagaagagtcgatgtgctccaccatttcactacttttatattgctcaggat 344
               |||| |||||||| ||||| || ||||| ||||| ||||  |||||||||||||||||||
Sbjct: 1047598 acctttgaatagacgagtcaatatgctcaaccatctcacagcttttatattgctcaggat 1047539

                                                                           
Query: 345     cttcattaaagctgaccatgccatccttctggtttatcgttgcatagatctcaccatctt 404
               |||||| |||||||||||| ||||||||||||||||| ||||||| ||||||||||||||
Sbjct: 1047538 cttcatgaaagctgaccatcccatccttctggtttatggttgcatggatctcaccatctt 1047479

                    
Query: 405     caatc 409
               |||||
Sbjct: 1047478 caatc 1047474



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                           
Query: 214     cttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgaggtcagcttcttgga 273
               |||||| ||| ||||| |||||||||||||||||| |||||| || | ||||||||||||
Sbjct: 1048217 cttcattaaatatgcaggatcgcacgagatgttctcatcaatagaagacagcttcttgga 1048158

                              
Query: 274     caaagccatcaacct 288
               |||||||||||||||
Sbjct: 1048157 caaagccatcaacct 1048143



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                  
Query: 146     tctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatctt 196
               ||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 1048377 tctcaaaaatatttgtgcggaactgagtcgaagtcatcgtaatcgaatctt 1048327
to top
>dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1005_B05
          Length = 144799

 Score =  206 bits (104), Expect = 6e-50
 Identities = 143/156 (91%)
 Strand = Plus / Minus

                                                                         
Query: 409   catcctaagtacatgcatctcagcttctttcggggtgttaagttgaacagagctagcaat 468
             ||||||||| |||||||||||||| || |||||||| ||||||||||||||||| |||||
Sbjct: 75926 catcctaagcacatgcatctcagcctccttcggggttttaagttgaacagagctggcaat 75867

                                                                         
Query: 469   gtcttcaagcgaaagagttaaataggtctgggtcagcctctggatgtttcgcttgtacat 528
              || |||||||||||||| || |||||||| |||| ||||||||||||||||||||||||
Sbjct: 75866 atcctcaagcgaaagagtcaagtaggtctgtgtcaacctctggatgtttcgcttgtacat 75807

                                                 
Query: 529   tgaagagagcacttgcttcacgagtccaaggttgtt 564
             ||| ||||||||||||||||| ||||||||||||||
Sbjct: 75806 tgaggagagcacttgcttcacaagtccaaggttgtt 75771



 Score =  153 bits (77), Expect = 8e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                         
Query: 285   acctctgaatagaagagtcgatgtgctccaccatttcactacttttatattgctcaggat 344
             |||| |||||||| ||||| || ||||| ||||| ||||  |||||||||||||||||||
Sbjct: 76125 acctttgaatagacgagtcaatatgctcaaccatctcacagcttttatattgctcaggat 76066

                                                                         
Query: 345   cttcattaaagctgaccatgccatccttctggtttatcgttgcatagatctcaccatctt 404
             |||||| |||||||||||| ||||||||||||||||| ||||||| ||||||||||||||
Sbjct: 76065 cttcatgaaagctgaccatcccatccttctggtttatggttgcatggatctcaccatctt 76006

                  
Query: 405   caatc 409
             |||||
Sbjct: 76005 caatc 76001



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                         
Query: 214   cttcatcaaaaatgcatgatcgcacgagatgttctgatcaattgaggtcagcttcttgga 273
             |||||| ||| ||||| |||||||||||||||||| |||||| || | ||||||||||||
Sbjct: 76744 cttcattaaatatgcaggatcgcacgagatgttctcatcaatagaagacagcttcttgga 76685

                            
Query: 274   caaagccatcaacct 288
             |||||||||||||||
Sbjct: 76684 caaagccatcaacct 76670



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                
Query: 146   tctcaaaaatatttgtgcggaaccgagtcgaagtcatcgtagtcgaatctt 196
             ||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 76904 tctcaaaaatatttgtgcggaactgagtcgaagtcatcgtaatcgaatctt 76854
to top
>gb|U19099.1|LCU19099 Lycopersicon chilense unknown protein (LC15) mRNA, complete cds
          Length = 1245

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 122/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 278 gccatcaacctctgaatagaagagtcgatgtgctccaccatttcactacttttatattgc 337
           |||||||| |||| ||| || || |||||||| || | |||| |||   ||||||| |||
Sbjct: 719 gccatcaatctcttaattgatgaatcgatgtgttcaatcattccacacgttttatactgc 660

                                                                       
Query: 338 tcaggatcttcattaaagctgaccatgccatccttctggtttatcgttgcatagatctca 397
           |||||||| ||   ||| || ||||| ||||||||||| || || |||||||| ||||||
Sbjct: 659 tcaggatcctccagaaatctaaccataccatccttctgattgattgttgcatatatctca 600

                                        
Query: 398 ccatcttcaatcatcctaagtacatgcat 426
           |||||||||||||||  ||| ||||||||
Sbjct: 599 ccatcttcaatcatctgaagcacatgcat 571
to top
>gb|AC138464.19| Medicago truncatula clone mth2-29i23, complete sequence
          Length = 134105

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                         
Query: 327   ttttatattgctcaggatcttcattaaagctgaccatgccatccttctggtttatcgttg 386
             |||| |||||||||||||| ||    || || ||||| |||||||||||||| || ||||
Sbjct: 41704 ttttgtattgctcaggatcctccaagaatctcaccattccatccttctggttgattgttg 41645

                             
Query: 387   catagatctcaccatc 402
             |||| |||||||||||
Sbjct: 41644 catatatctcaccatc 41629
to top
>dbj|AB168559.1| Macaca fascicularis testis cDNA clone: QtsA-13043, similar to human
            COP9 constitutive photomorphogenic homolog subunit
            3(Arabidopsis) (COPS3), mRNA, RefSeq: NM_003653.2
          Length = 1716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1178 ctgaccataccatccttctggttaatacttgcaaaaatctcaccatcttctatcat 1123
to top
>emb|CR666674.2|CNS0FDDK Tetraodon nigroviridis full-length cDNA
          Length = 1163

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 353 aagctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           |||| |||||||||||| ||||| || ||  | ||||||||||| ||||||||||||||
Sbjct: 514 aagcagaccatgccatctttctgattaatgctagcatagatctcgccatcttcaatcat 456
to top
>emb|CR664627.2|CNS0FBSP Tetraodon nigroviridis full-length cDNA
          Length = 1169

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 353 aagctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           |||| |||||||||||| ||||| || ||  | ||||||||||| ||||||||||||||
Sbjct: 511 aagcagaccatgccatctttctgattaatgctagcatagatctcgccatcttcaatcat 453
to top
>gb|BC064288.1| Danio rerio COP9 constitutive photomorphogenic homolog subunit 3,
            mRNA (cDNA clone MGC:77615 IMAGE:6996586), complete cds
          Length = 1621

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            ||||||||| ||||||||||| ||  ||||||||||||| ||||| || |||||
Sbjct: 1138 gaccatgccgtccttctggttgatgcttgcatagatctctccatcctcgatcat 1085
to top
>gb|BC045415.1| Danio rerio COP9 constitutive photomorphogenic homolog subunit 3,
            mRNA (cDNA clone MGC:55643 IMAGE:3815221), complete cds
          Length = 1642

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            ||||||||| ||||||||||| ||  ||||||||||||| ||||| || |||||
Sbjct: 1158 gaccatgccgtccttctggttgatgcttgcatagatctctccatcctcgatcat 1105
to top
>ref|NM_199685.1| Danio rerio COP9 constitutive photomorphogenic homolog subunit 3
            (cops3), mRNA
          Length = 1642

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            ||||||||| ||||||||||| ||  ||||||||||||| ||||| || |||||
Sbjct: 1158 gaccatgccgtccttctggttgatgcttgcatagatctctccatcctcgatcat 1105
to top
>ref|XM_696986.1| PREDICTED: Danio rerio hypothetical protein LOC554555 (LOC554555),
           mRNA
          Length = 1092

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 358 gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           ||||||||| ||||||||||| ||  ||||||||||||| ||||| || |||||
Sbjct: 635 gaccatgccgtccttctggttgatgcttgcatagatctctccatcctcgatcat 582
to top
>gb|BC095590.1| Danio rerio cDNA clone MGC:111903 IMAGE:7416080, complete cds
          Length = 1642

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            ||||||||| ||||||||||| ||  ||||||||||||| ||||| || |||||
Sbjct: 1184 gaccatgccgtccttctggttgatgcttgcatagatctctccatcctcgatcat 1131
to top
>ref|XM_777925.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC577712), mRNA
          Length = 456

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 383 gttgcatagatctcaccatcttcaatcat 411
           ||||||| |||||||||||||||||||||
Sbjct: 233 gttgcatggatctcaccatcttcaatcat 205
to top
>ref|XM_788402.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC588733), partial mRNA
          Length = 315

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 383 gttgcatagatctcaccatcttcaatcat 411
           ||||||| |||||||||||||||||||||
Sbjct: 146 gttgcatggatctcaccatcttcaatcat 118
to top
>ref|XM_783474.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC583570), mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 383 gttgcatagatctcaccatcttcaatcat 411
           ||||||| |||||||||||||||||||||
Sbjct: 467 gttgcatggatctcaccatcttcaatcat 439
to top
>ref|XM_783677.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC583783), mRNA
          Length = 276

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 383 gttgcatagatctcaccatcttcaatcat 411
           ||||||| |||||||||||||||||||||
Sbjct: 134 gttgcatggatctcaccatcttcaatcat 106
to top
>ref|XM_511309.1| PREDICTED: Pan troglodytes similar to COP9 complex subunit 3
           (LOC454473), mRNA
          Length = 1385

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 356 ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 910 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 855
to top
>ref|XM_584631.2| PREDICTED: Bos taurus similar to COP9 constitutive photomorphogenic
            homolog subunit 3 (LOC507932), mRNA
          Length = 2449

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| ||||||||||| || ||  ||||| | |||||||||||||| |||||
Sbjct: 1107 ctgaccatcccatccttctgattaatacttgcaaaaatctcaccatcttctatcat 1052
to top
>gb|BC001891.1| Homo sapiens COP9 constitutive photomorphogenic homolog subunit 3
            (Arabidopsis), mRNA (cDNA clone MGC:1773 IMAGE:3537198),
            complete cds
          Length = 1584

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1167 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1112
to top
>ref|NM_003653.2| Homo sapiens COP9 constitutive photomorphogenic homolog subunit 3
            (Arabidopsis) (COPS3), mRNA
          Length = 1652

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1167 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1112
to top
>emb|CR857080.1| Pongo pygmaeus mRNA; cDNA DKFZp468P1922 (from clone DKFZp468P1922)
          Length = 1694

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1136 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1081
to top
>emb|CR622277.1| full-length cDNA clone CS0DI060YM17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1589

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1137 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1082
to top
>emb|CR619826.1| full-length cDNA clone CS0DI031YO02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1493

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1132 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1077
to top
>emb|CR618089.1| full-length cDNA clone CS0DI041YI01 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1557

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1132 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1077
to top
>emb|CR617410.1| full-length cDNA clone CS0DC027YB20 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1560

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1132 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1077
to top
>emb|CR616766.1| full-length cDNA clone CS0DI079YH15 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1583

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1183 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1128
to top
>emb|CR613300.1| full-length cDNA clone CS0DI066YJ23 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1467

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1066 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1011
to top
>emb|CR611420.1| full-length cDNA clone CS0DI016YI21 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1317

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 356 ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 923 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 868
to top
>emb|CR608585.1| full-length cDNA clone CS0DI032YC22 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1578

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1129 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1074
to top
>emb|CR602972.1| full-length cDNA clone CS0DA007YN02 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1554

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1119 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1064
to top
>emb|CR600698.1| full-length cDNA clone CS0DE006YH01 of Placenta of Homo sapiens
            (human)
          Length = 1617

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1173 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1118
to top
>emb|CR599192.1| full-length cDNA clone CS0DK003YE18 of HeLa cells Cot 25-normalized
            of Homo sapiens (human)
          Length = 1574

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1132 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1077
to top
>emb|CR597915.1| full-length cDNA clone CL0BB018ZG04 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1562

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1098 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1043
to top
>emb|CR595552.1| full-length cDNA clone CS0DA012YL07 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1573

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1132 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1077
to top
>emb|CR594817.1| full-length cDNA clone CS0DI087YE04 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1526

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1138 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1083
to top
>emb|CR590945.1| full-length cDNA clone CS0DJ010YM03 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 1530

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1099 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1044
to top
>gb|AF098109.1|AF098109 Homo sapiens COP9 complex subunit 3 (COPS3) mRNA, complete cds
          Length = 1576

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1118 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1063
to top
>gb|AF031647.1|AF031647 Homo sapiens JAB1-containing signalosome subunit 3 (SGN3) mRNA,
            complete cds
          Length = 1556

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| || ||||||||||| ||  ||||| | |||||||||||||| |||||
Sbjct: 1098 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttctatcat 1043
to top
>ref|XM_788326.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC588652), partial mRNA
          Length = 414

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 383 gttgcatagatctcaccatcttcaatc 409
           ||||||| |||||||||||||||||||
Sbjct: 326 gttgcatggatctcaccatcttcaatc 300
to top
>emb|AJ720483.1| Gallus gallus mRNA for hypothetical protein, clone 18l12
          Length = 1613

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||| ||||||||||| || ||  ||||| |||| ||||||||||| |||||
Sbjct: 1119 gaccataccatccttctgattaatacttgcaaagatttcaccatcttctatcat 1066
to top
>ref|NM_001006163.1| Gallus gallus COP9 constitutive photomorphogenic homolog subunit 3
            (Arabidopsis) (COPS3), mRNA
          Length = 1613

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 358  gaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||| ||||||||||| || ||  ||||| |||| ||||||||||| |||||
Sbjct: 1119 gaccataccatccttctgattaatacttgcaaagatttcaccatcttctatcat 1066
to top
>gb|AC055811.20| Homo sapiens chromosome 17, clone RP11-45M22, complete sequence
          Length = 143790

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 356    ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttc 405
              |||||||| || ||||||||||| ||  ||||| | ||||||||||||||
Sbjct: 111402 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttc 111451
to top
>emb|AJ009613.4|HSAJ9613 Homo sapiens chromosome 17 sequence from cosmid 5L05 region
             D17S842-D17S953 map 17p11.2, complete sequence
          Length = 43241

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 356   ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttc 405
             |||||||| || ||||||||||| ||  ||||| | ||||||||||||||
Sbjct: 15668 ctgaccataccgtccttctggttaatacttgcaaaaatctcaccatcttc 15619
to top
>gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosome 5, complete sequence
          Length = 229020

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 319    ttcactacttttatattgctc 339
              |||||||||||||||||||||
Sbjct: 115682 ttcactacttttatattgctc 115662
to top
>gb|AC115629.3| Mus musculus BAC clone RP23-74J16 from chromosome 5, complete sequence
          Length = 242126

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 319   ttcactacttttatattgctc 339
             |||||||||||||||||||||
Sbjct: 39941 ttcactacttttatattgctc 39921
to top
>gb|AC010064.7| Drosophila melanogaster 3L BAC RP98-22I16 (Roswell Park Cancer
             Institute Drosophila BAC library) complete sequence
          Length = 199396

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 503   agcctctggatgtttcgcttgtaca 527
             |||| ||||||||||||||||||||
Sbjct: 70758 agccgctggatgtttcgcttgtaca 70782
to top
>ref|XM_794190.1| PREDICTED: Strongylocentrotus purpuratus similar to COP9
           constitutive photomorphogenic homolog subunit 3
           (LOC594760), mRNA
          Length = 588

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 383 gttgcatagatctcaccatcttcaatcat 411
           |||||||  ||||||||||||||||||||
Sbjct: 248 gttgcatgaatctcaccatcttcaatcat 220
to top
>ref|NM_079466.2| Drosophila melanogaster COP9 complex homolog subunit 3 CG18332-RA
            (CSN3), mRNA
          Length = 1680

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 503  agcctctggatgtttcgcttgtaca 527
            |||| ||||||||||||||||||||
Sbjct: 1088 agccgctggatgtttcgcttgtaca 1064
to top
>gb|AY071575.1| Drosophila melanogaster RE63441 full length cDNA
          Length = 1695

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 503  agcctctggatgtttcgcttgtaca 527
            |||| ||||||||||||||||||||
Sbjct: 1088 agccgctggatgtttcgcttgtaca 1064
to top
>gb|AC008560.6| Homo sapiens chromosome 5 clone CTC-534A2, complete sequence
          Length = 129641

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 447   taagttgaacagagctagcaa 467
             |||||||||||||||||||||
Sbjct: 38665 taagttgaacagagctagcaa 38685
to top
>gb|AF129081.1|AF129081 Drosophila melanogaster COP9 signalosome subunit 3 CSN3 mRNA,
            complete cds
          Length = 1675

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 503  agcctctggatgtttcgcttgtaca 527
            |||| ||||||||||||||||||||
Sbjct: 1073 agccgctggatgtttcgcttgtaca 1049
to top
>gb|AE003592.3| Drosophila melanogaster chromosome 3L, section 73 of 83 of the complete
              sequence
          Length = 323816

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 503    agcctctggatgtttcgcttgtaca 527
              |||| ||||||||||||||||||||
Sbjct: 211066 agccgctggatgtttcgcttgtaca 211090
to top
>dbj|AK113755.1| Ciona intestinalis cDNA, clone:cicl008c20, full insert sequence
          Length = 2405

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 327  ttttatattgctcaggatctt 347
            |||||||||||||||||||||
Sbjct: 1650 ttttatattgctcaggatctt 1630
to top
>gb|AC142211.3| Mus musculus BAC clone RP24-501B23 from chromosome 8, complete sequence
          Length = 175636

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   ttcactacttttatattgct 338
             ||||||||||||||||||||
Sbjct: 69254 ttcactacttttatattgct 69235
to top
>gb|BC068179.1| Mus musculus COP9 (constitutive photomorphogenic) homolog, subunit 3
            (Arabidopsis thaliana), mRNA (cDNA clone MGC:93002
            IMAGE:30633689), complete cds
          Length = 1590

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1119 ctgaccattccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1064
to top
>ref|NM_011991.1| Mus musculus COP9 (constitutive photomorphogenic) homolog, subunit 3
            (Arabidopsis thaliana) (Cops3), mRNA
          Length = 1583

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1119 ctgaccattccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1064
to top
>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete
             sequence
          Length = 171538

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 530   gaagagagcacttgcttcac 549
             ||||||||||||||||||||
Sbjct: 48463 gaagagagcacttgcttcac 48444
to top
>gb|BC079143.1| Rattus norvegicus COP9 (constitutive photomorphogenic) homolog,
            subunit 3 (Arabidopsis thaliana), mRNA (cDNA clone
            MGC:94156 IMAGE:7128107), complete cds
          Length = 1596

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1120 ctgaccataccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1065
to top
>gb|AC120052.2| Homo sapiens chromosome 8, clone CTD-2232O19, complete sequence
          Length = 108119

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 481   aagagttaaataggtctggg 500
             ||||||||||||||||||||
Sbjct: 69199 aagagttaaataggtctggg 69218
to top
>gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosome 1, complete sequence
          Length = 177793

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 542   tgcttcacgagtccaaggtt 561
             ||||||||||||||||||||
Sbjct: 25201 tgcttcacgagtccaaggtt 25182
to top
>gb|AC102582.9| Mus musculus chromosome 9, clone RP23-312A24, complete sequence
          Length = 190790

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     ctcaggacaaggctagcttg 109
              ||||||||||||||||||||
Sbjct: 133778 ctcaggacaaggctagcttg 133797
to top
>ref|NM_001004200.1| Rattus norvegicus COP9 (constitutive photomorphogenic) homolog,
            subunit 3 (Arabidopsis thaliana) (Cops3), mRNA
          Length = 1596

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1120 ctgaccataccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1065
to top
>gb|AC144478.20| Medicago truncatula clone mth2-20b20, complete sequence
          Length = 144248

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 255   ttgaggtcagcttcttggacaaag 278
             |||||| |||||||||||||||||
Sbjct: 89566 ttgaggccagcttcttggacaaag 89543
to top
>gb|AY377991.1| Triticum aestivum chloroplast-localized Ptr ToxA-binding protein1
           (TaThf1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1130

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 tattgctcaggatcttcatt 351
           ||||||||||||||||||||
Sbjct: 437 tattgctcaggatcttcatt 418
to top
>gb|AY841794.1| Aeromonas hydrophila strain AH-3 polar flagellar assembly protein
           (flhA) gene, complete cds
          Length = 2103

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 130 cccaaggcgctgatcatctc 149
           ||||||||||||||||||||
Sbjct: 862 cccaaggcgctgatcatctc 881
to top
>gb|AC159336.13| Mus musculus 10 BAC RP24-430N21 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 180454

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    tgatcatctcaaaaatattt 159
              ||||||||||||||||||||
Sbjct: 167042 tgatcatctcaaaaatattt 167061
to top
>gb|AY736122.1| Triticum aestivum chloroplast inositol phosphatase-like protein
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 909

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 332 tattgctcaggatcttcatt 351
           ||||||||||||||||||||
Sbjct: 471 tattgctcaggatcttcatt 452
to top
>gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222518

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   tgatcatctcaaaaatattt 159
             ||||||||||||||||||||
Sbjct: 59873 tgatcatctcaaaaatattt 59892
to top
>gb|AC022716.13| Homo sapiens chromosome 8, clone RP11-135I5, complete sequence
          Length = 163495

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 481    aagagttaaataggtctggg 500
              ||||||||||||||||||||
Sbjct: 110838 aagagttaaataggtctggg 110819
to top
>dbj|AK142318.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:D330046O05 product:COP9 (constitutive
            photomorphogenic) homolog, subunit 3 (Arabidopsis
            thaliana), full insert sequence
          Length = 1557

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1105 ctgaccattccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1050
to top
>gb|AC011008.10| Homo sapiens chromosome 8, clone RP11-177H2, complete sequence
          Length = 162245

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 467   atgtcttcaagcgaaagagt 486
             ||||||||||||||||||||
Sbjct: 92264 atgtcttcaagcgaaagagt 92245
to top
>dbj|AK169747.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430018C16
           product:COP9 (constitutive photomorphogenic) homolog,
           subunit 3 (Arabidopsis thaliana), full insert sequence
          Length = 665

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 356 ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
           |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 211 ctgaccattccatccttctggttaatacttgcaaaaatttctccatcttctatcat 156
to top
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 259     ggtcagcttcttggacaaagccat 282
               |||||||| |||||||||||||||
Sbjct: 3219929 ggtcagctccttggacaaagccat 3219952
to top
>gb|AC154785.2| Mus musculus BAC clone RP23-92M20 from chromosome 12, complete sequence
          Length = 231183

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    aggacaaggctagcttgatg 112
             ||||||||||||||||||||
Sbjct: 45921 aggacaaggctagcttgatg 45940
to top
>gb|AC055712.13| Homo sapiens 3 BAC RP11-63K8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155056

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 308   tgctccaccatttcactactttta 331
             ||||||||||||||||| ||||||
Sbjct: 49868 tgctccaccatttcactgctttta 49891
to top
>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 347    tcattaaagctgaccatgcc 366
              ||||||||||||||||||||
Sbjct: 378583 tcattaaagctgaccatgcc 378564
to top
>emb|BX510986.8| Zebrafish DNA sequence from clone CH211-173P18 in linkage group 19,
             complete sequence
          Length = 157245

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 343   atcttcattaaagctgacca 362
             ||||||||||||||||||||
Sbjct: 39163 atcttcattaaagctgacca 39182
to top
>gb|AE015450.1| Mycoplasma gallisepticum strain R complete genome
          Length = 996422

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 438    tcggggtgttaagttgaaca 457
              ||||||||||||||||||||
Sbjct: 442035 tcggggtgttaagttgaaca 442016
to top
>gb|DQ124698.1| Aeromonas hydrophila strain AH-3 FliE (fliE), FliF (fliF), FliG (fliG),
             FliH (fliH), FliI (fliI), FliJ (fliJ), FliK (fliK), FliL
             (fliL), FliM (fliM), FliN (fliN), FliO (fliO), FliP
             (fliP), FliQ (fliQ), FliR (fliR), FlhB (flhB), FlhA
             (flhA), FlhF (flhF), FlhG (flhG), FliA (fliA), CheY
             (cheY), CheZ (cheZ), CheA (cheA), CheB (cheB), PomA
             (pomA), PomB (pomB), and CheW (cheW) genes, complete cds;
             and unknown genes
          Length = 29850

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   cccaaggcgctgatcatctc 149
             ||||||||||||||||||||
Sbjct: 16122 cccaaggcgctgatcatctc 16141
to top
>gb|AF071313.1|AF071313 Mus musculus COP9 complex subunit 3 (COPS3) mRNA, complete cds
          Length = 1583

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 356  ctgaccatgccatccttctggtttatcgttgcatagatctcaccatcttcaatcat 411
            |||||||| |||||||||||||| ||  ||||| | || || |||||||| |||||
Sbjct: 1119 ctgaccattccatccttctggttaatacttgcaaaaatttctccatcttctatcat 1064
to top
>gb|AC163288.4| Mus musculus BAC clone RP23-279M5 from chromosome 8, complete sequence
          Length = 222867

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 319    ttcactacttttatattgct 338
              ||||||||||||||||||||
Sbjct: 174197 ttcactacttttatattgct 174178


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,081,673
Number of Sequences: 3902068
Number of extensions: 5081673
Number of successful extensions: 85440
Number of sequences better than 10.0: 85
Number of HSP's better than 10.0 without gapping: 81
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 85258
Number of HSP's gapped (non-prelim): 181
length of query: 608
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 585
effective length of database: 17,143,297,704
effective search space: 10028829156840
effective search space used: 10028829156840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top