ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38g09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 902 0.0
2emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 688 0.0
3emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 654 0.0
4gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 654 0.0
5emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 630 e-177
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 626 e-176
7emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 519 e-144
8emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 408 e-110
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 392 e-106
10emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 392 e-106
11gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 391 e-105
12gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 391 e-105
13emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 365 1e-97
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 325 1e-85
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 238 2e-59
16gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 238 2e-59
17gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 238 2e-59
18emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 238 2e-59
19gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 232 1e-57
20gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 224 3e-55
21gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 224 3e-55
22gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 216 7e-53
23emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 190 4e-45
24emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 174 3e-40
25emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 117 5e-23
26gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 111 3e-21
27dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 111 3e-21
28dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
29dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
30gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 111 3e-21
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 107 5e-20
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 107 5e-20
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 5e-20
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 107 5e-20
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 107 5e-20
36gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 100 1e-17
37emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 100 1e-17
38dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 1e-17
39dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 1e-17
40emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 100 1e-17
41gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 100 1e-17
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 92 3e-15
43gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 92 3e-15
44gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 80 1e-11
45emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 80 1e-11
46emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 80 1e-11
47emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 80 1e-11
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 80 1e-11
49dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
50dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
51gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 80 1e-11
52gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 78 4e-11
53emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 76 2e-10
54dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
55dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 72 3e-09
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 72 3e-09
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 72 3e-09
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 72 3e-09
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 3e-09
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 3e-09
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 72 3e-09
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 72 3e-09
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 72 3e-09
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 72 3e-09
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 72 3e-09
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 72 3e-09
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 72 3e-09
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 72 3e-09
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 72 3e-09
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 72 3e-09
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 72 3e-09
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 3e-09
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 72 3e-09
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 3e-09
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 72 3e-09
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 3e-09
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 72 3e-09
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 3e-09
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 72 3e-09
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 72 3e-09
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 3e-09
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 72 3e-09
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 3e-09
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 1e-08
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 64 7e-07
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 64 7e-07
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 64 7e-07
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 64 7e-07
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 64 7e-07
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 64 7e-07
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 64 7e-07
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 64 7e-07
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 64 7e-07
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 64 7e-07
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 64 7e-07
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 64 7e-07
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 64 7e-07
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 64 7e-07
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 64 7e-07
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 64 7e-07
106gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 56 2e-04
107gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 50 0.010
108gb|AC007023.3|AC007023 Homo sapiens clone DJ0635B05, complete se... 46 0.16
109gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta... 44 0.61
110gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, com... 44 0.61
111gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, com... 44 0.61
112gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 42 2.4
113emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 2.4
114emb|AL158158.14| Human DNA sequence from clone RP11-427L11 on ch... 42 2.4
115gb|AF548001.1| Homo sapiens thioredoxin (TXN) gene, complete cds 42 2.4
116dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
117dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
118gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 42 2.4
119dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
120dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
121dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
122gb|AY109327.1| Zea mays CL468_1 mRNA sequence 42 2.4
123emb|X54541.1|HSTRXE4E5 H.sapiens Trx gene for thioredoxin, exon ... 42 2.4
124emb|X70288.1|HSTHDC H.sapiens gene for thioredoxin, exons 4 and 5 42 2.4
125gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 42 2.4
126gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 9.6
127ref|XM_638808.1| Dictyostelium discoideum hypothetical protein (... 40 9.6
128ref|XM_628905.1| Dictyostelium discoideum hypothetical protein (... 40 9.6
129gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, com... 40 9.6
130gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Can... 40 9.6
131gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromo... 40 9.6
132gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosom... 40 9.6
133gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI... 40 9.6
134gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, comp... 40 9.6
135gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete s... 40 9.6
136emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on ch... 40 9.6
137emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on ch... 40 9.6
138emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on ch... 40 9.6
139gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete s... 40 9.6
140dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130 40 9.6
141gb|AC110774.3| Homo sapiens BAC clone RP11-254A24 from 4, comple... 40 9.6
142gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, comple... 40 9.6
143gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 40 9.6
144emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in l... 40 9.6
145gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete... 40 9.6
146dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
147gb|AC127089.4| Homo sapiens BAC clone RP13-590E7 from 4, complet... 40 9.6
148gb|AC157095.9| Mus musculus 6 BAC RP24-350P11 (Roswell Park Canc... 40 9.6
149gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041... 40 9.6
150gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, com... 40 9.6
151gb|AC148962.4| Atelerix albiventris clone LB4-372K23, complete s... 40 9.6
152dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
153dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
154gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complet... 40 9.6
155dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 9.6
156dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 9.6
157emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 9.6
158gb|AC158526.3| Mus musculus BAC clone RP23-288A9 from chromosome... 40 9.6
159dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 40 9.6

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  902 bits (455), Expect = 0.0
 Identities = 462/463 (99%), Gaps = 1/463 (0%)
 Strand = Plus / Minus

                                                                        
Query: 237  aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 296
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395

                                                                        
Query: 297  tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 356
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335

                                                                        
Query: 357  gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 416
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275

                                                                        
Query: 417  gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 476
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 1215

                                                                        
Query: 477  gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 536
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1214 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 1155

                                                                        
Query: 537  taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 596
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 1095

                                                                        
Query: 597  gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 656
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 1035

                                                       
Query: 657  gccattttcgatcacaagctagcaatagtagtggtggtgagct 699
            |||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1034 gcca-tttcgatcacaagctagcaatagtagtggtggtgagct 993



 Score =  291 bits (147), Expect = 2e-75
 Identities = 156/158 (98%), Gaps = 1/158 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgcgagcaggcatagcctgagtatatgatacatatatnaaaagtgcacatggtacaaagt 60
            |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1689 cgcgagcaggcatagc-tgagtatatgatacatatatcaaaagtgcacatggtacaaagt 1631

                                                                        
Query: 61   acaacaaactcacgattcctctcaaaggaagtaaatattaattataacatcgatacaaca 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1630 acaacaaactcacgattcctctcaaaggaagtaaatattaattataacatcgatacaaca 1571

                                                  
Query: 121  gtgtgccggccatgcagagctggctcaacgtacgtact 158
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1570 gtgtgccggccatgcagagctggctcaacgtacgtact 1533



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                    
Query: 179  ccacatggagataatatatgagagcatttattcatatata 218
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  688 bits (347), Expect = 0.0
 Identities = 398/415 (95%)
 Strand = Plus / Minus

                                                                       
Query: 237 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 296
           ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380

                                                                       
Query: 297 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320

                                                                       
Query: 357 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 416
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260

                                                                       
Query: 417 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 476
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccg 200

                                                                       
Query: 477 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 536
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 199 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 140

                                                                       
Query: 537 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 596
           ||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 139 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcg 80

                                                                  
Query: 597 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 651
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 79  gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 25



 Score =  190 bits (96), Expect = 4e-45
 Identities = 123/132 (93%), Gaps = 4/132 (3%)
 Strand = Plus / Minus

                                                                       
Query: 31  catatatnaaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaa 90
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 658 catatatcaaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaa 599

                                                                       
Query: 91  gtaaatattaatta----taacatcgatacaacagtgtgccggccatgcagagctggctc 146
           |||||||| |||||    ||||||||||||||||| |||  |||||||||||||||||||
Sbjct: 598 gtaaatataaattataattaacatcgatacaacagagtgttggccatgcagagctggctc 539

                       
Query: 147 aacgtacgtact 158
           ||||||||||||
Sbjct: 538 aacgtacgtact 527



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 179 ccacatggagataatatatgagagcatttattcatatata 218
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  654 bits (330), Expect = 0.0
 Identities = 354/362 (97%)
 Strand = Plus / Minus

                                                                        
Query: 300  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 359
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967

                                                                        
Query: 360  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 966  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907

                                                                        
Query: 420  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 479
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847

                                                                        
Query: 480  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 539
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 846  agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787

                                                                        
Query: 540  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 599
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 786  gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 727

                                                                        
Query: 600  acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 659
            |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 726  acgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 667

              
Query: 660  at 661
            ||
Sbjct: 666  at 665



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 17   ctgagtatatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactca 72
            |||||| |||||| ||||||| || |||||||||| |||||||||||| |||||||
Sbjct: 1276 ctgagtgtatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 1221



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 125  gccggccatgcagagctggctcaacgtacg 154
            |||||||||||||| |||||||||| ||||
Sbjct: 1167 gccggccatgcagaactggctcaacatacg 1138



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  654 bits (330), Expect = 0.0
 Identities = 354/362 (97%)
 Strand = Plus / Minus

                                                                        
Query: 300  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 359
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363

                                                                        
Query: 360  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 419
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303

                                                                        
Query: 420  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 479
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243

                                                                        
Query: 480  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 539
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183

                                                                        
Query: 540  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 599
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2182 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 2123

                                                                        
Query: 600  acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 659
            |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2122 acgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 2063

              
Query: 660  at 661
            ||
Sbjct: 2062 at 2061



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 17   ctgagtatatgatacatatatnaaaagtgcacatggtacaaagtacaacaaactca 72
            |||||| |||||| ||||||| || |||||||||| |||||||||||| |||||||
Sbjct: 2672 ctgagtgtatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 2617



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 125  gccggccatgcagagctggctcaacgtacg 154
            |||||||||||||| |||||||||| ||||
Sbjct: 2563 gccggccatgcagaactggctcaacatacg 2534



to top

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  630 bits (318), Expect = e-177
 Identities = 351/362 (96%)
 Strand = Plus / Minus

                                                                       
Query: 300 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 359
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362

                                                                       
Query: 360 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 419
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302

                                                                       
Query: 420 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 479
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242

                                                                       
Query: 480 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 539
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182

                                                                       
Query: 540 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 599
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 181 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggct 122

                                                                       
Query: 600 acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 659
           ||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||
Sbjct: 121 acgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagcc 62

             
Query: 660 at 661
           ||
Sbjct: 61  at 60



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 59/66 (89%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 6   gcaggcatagcctgagtatatgatacatatatnaaaagtgcacatggtacaaagtacaac 65
           ||||||||||| ||||| |||||| ||||||| || ||||||||||||||||| ||||| 
Sbjct: 700 gcaggcatagc-tgagtgtatgattcatatatcaacagtgcacatggtacaaaatacaat 642

                 
Query: 66  aaactc 71
           ||||||
Sbjct: 641 aaactc 636



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 194 atatgagagcatttattcatatata 218
           |||||||||||||||||||||||||
Sbjct: 498 atatgagagcatttattcatatata 474



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 125 gccggccatgcagagctggctcaac 149
           |||||||||||||| ||||||||||
Sbjct: 581 gccggccatgcagaactggctcaac 557



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  626 bits (316), Expect = e-176
 Identities = 428/463 (92%), Gaps = 3/463 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 296
           ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || ||
Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451

                                                                       
Query: 297 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 356
            | |||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||
Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391

                                                                       
Query: 357 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 416
           |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | 
Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331

                                                                       
Query: 417 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 476
           |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271

                                                                       
Query: 477 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 536
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 270 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 211

                                                                       
Query: 537 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 596
           ||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 210 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcg 151

                                                                       
Query: 597 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 656
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  || 
Sbjct: 150 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagaacgg 91

                                                      
Query: 657 gccattttcgatcacaagctagcaatagtagtggtggtgagct 699
           |||| |||||||  |||||||||||||||||||||||||||||
Sbjct: 90  gcca-tttcgat--caagctagcaatagtagtggtggtgagct 51



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 185 ggagataatatatgagagcatttattcatatata 218
           ||||||||||||||||| ||||||||||||||||
Sbjct: 573 ggagataatatatgagatcatttattcatatata 540



to top

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  519 bits (262), Expect = e-144
 Identities = 275/278 (98%), Gaps = 1/278 (0%)
 Strand = Plus / Minus

                                                                       
Query: 422 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 481
           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 482 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 541
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 542 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 601
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106

                                                                       
Query: 602 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcca- 47

                                                 
Query: 662 tttcgatcacaagctagcaatagtagtggtggtgagct 699
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 46  tttcgatcacaagctagcaatagtagtggtggtgagct 9



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  408 bits (206), Expect = e-110
 Identities = 357/405 (88%), Gaps = 3/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 295  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 354
            |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577

                                                                        
Query: 355  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 414
            |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517

                                                                        
Query: 415  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 474
            | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457

                                                                        
Query: 475  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 534
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397

                                                                        
Query: 535  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 594
            ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 1396 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 1337

                                                                        
Query: 595  tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 654
            || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 1336 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 1277

                                                         
Query: 655  gagccattttcgatcacaagctagcaatagtagtggtggtgagct 699
            | |||| | |||||  ||||||||||||||||||||| |||||||
Sbjct: 1276 gggcca-tctcgat--caagctagcaatagtagtggtagtgagct 1235



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 37/38 (97%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 106  aacatcgatacaacagtgt-gccggccatgcagagctg 142
            ||||||||||||||||||| ||||||||||||||||||
Sbjct: 1819 aacatcgatacaacagtgtggccggccatgcagagctg 1782



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 31   catatatnaaaagtgcacatggtacaaagtaca 63
            ||||||| |||||| ||||||||||||||||||
Sbjct: 1880 catatatcaaaagtacacatggtacaaagtaca 1848



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 194  atatgagagcatttattcata 214
            |||||||||||||||||||||
Sbjct: 1745 atatgagagcatttattcata 1725



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  392 bits (198), Expect = e-106
 Identities = 355/405 (87%), Gaps = 3/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 295 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 354
           |||| ||||| ||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374

                                                                       
Query: 355 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 414
           |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314

                                                                       
Query: 415 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 474
           | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254

                                                                       
Query: 475 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 534
            ||| || ||| | |||||||||||||||||| ||| |||  |||||||||||||||| |
Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194

                                                                       
Query: 535 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 594
           ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 193 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 134

                                                                       
Query: 595 tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 654
           || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 133 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 74

                                                        
Query: 655 gagccattttcgatcacaagctagcaatagtagtggtggtgagct 699
           | |||| | |||||  ||||||||||||||||||||| |||||||
Sbjct: 73  gggcca-tctcgat--caagctagcaatagtagtggtagtgagct 32



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 31  catatatnaaaagtgcacatggtacaaagtacaacaaactc 71
           ||||||| |||||| |||||||||||||||||| |||||||
Sbjct: 680 catatatcaaaagtacacatggtacaaagtacagcaaactc 640



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 106 aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 158
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 619 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 566



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 192 atatatgagagcatttattcatatata 218
           |||||||||||||||||||||||||||
Sbjct: 542 atatatgagagcatttattcatatata 516



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  392 bits (198), Expect = e-106
 Identities = 355/405 (87%), Gaps = 3/405 (0%)
 Strand = Plus / Minus

                                                                        
Query: 295  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 354
            |||| ||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||
Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565

                                                                        
Query: 355  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 414
            |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| 
Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505

                                                                        
Query: 415  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 474
            | |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||
Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445

                                                                        
Query: 475  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 534
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385

                                                                        
Query: 535  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 594
            ||||||||||||| ||||||||||||||||||||||||||||| || | |||||| || |
Sbjct: 1384 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcctccg 1325

                                                                        
Query: 595  tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 654
            || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 1324 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 1265

                                                         
Query: 655  gagccattttcgatcacaagctagcaatagtagtggtggtgagct 699
            | |||| | |||||  ||||||||||||||||||||| |||||||
Sbjct: 1264 gggcca-tctcgat--caagctagcaatagtagtggtagtgagct 1223



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 31   catatatnaaaagtgcacatggtacaaagtaca 63
            ||||||| |||||| ||||||||||||||||||
Sbjct: 1868 catatatcaaaagtacacatggtacaaagtaca 1836



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 106  aacatcgatacaacagtgtg-ccggccatgcagagctg 142
            |||||||||| ||||||||| |||||||||||||||||
Sbjct: 1807 aacatcgatataacagtgtggccggccatgcagagctg 1770



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 194  atatgagagcatttattcatatata 218
            |||||||||||||||||||||||||
Sbjct: 1733 atatgagagcatttattcatatata 1709



to top

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 373
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 374 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 433
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 434 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 493
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 494 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 553
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 554 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 613
           |||||||||||||||||||||||| || | |||||| || |||||| |||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 614 ggccaccatggcgaccagcacgagctgag 642
           |||||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20



to top

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 373
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 374 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 433
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 434 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 493
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 494 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 553
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 554 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 613
           |||||||||||||||||||||||| || | |||||| || |||||| |||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 614 ggccaccatggcgaccagcacgagctgag 642
           |||||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 295 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 354
           |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273

                                                                       
Query: 355 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 414
           | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213

                                                                       
Query: 415 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 474
           | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153

                                                                       
Query: 475 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 534
            ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93

                                                                       
Query: 535 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 594
           ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 92  cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 33

                                           
Query: 595 tggctacgaggagcatagcggccaccatggcg 626
           || || ||||||||||||| ||||||| ||||
Sbjct: 32  tgactgcgaggagcatagcagccaccacggcg 1



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 31  catatatnaaaagtgcacatggtacaaagtacaacaaactc 71
           ||||||| |||||| |||||||||||||||||| |||||||
Sbjct: 577 catatatcaaaagtacacatggtacaaagtacagcaaactc 537



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 106 aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 158
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 516 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 463



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 194 atatgagagcatttattcatatata 218
           |||||||||||||||||||||||||
Sbjct: 437 atatgagagcatttattcatatata 413



to top

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  325 bits (164), Expect = 1e-85
 Identities = 302/348 (86%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 373
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 374 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 433
           | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 434 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 493
           ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 494 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 553
            |||||||||||| |||| ||  ||| |||| ||||||| |||||||||||||| |||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 554 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 613
           |||||||||||||||||| || |||||||| || ||||| ||||||  ||||| ||| ||
Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtctgtggctgtgaggaccattgc 49

                                                           
Query: 614 ggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
            ||||| | || || || |||||| |||| ||||||||| || |||||
Sbjct: 48  tgccacgagggtgaacaacacgagttgagcagctgcagcacgggccat 1



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  238 bits (120), Expect = 2e-59
 Identities = 294/352 (83%)
 Strand = Plus / Minus

                                                                        
Query: 310  tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
            |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149

                                                                        
Query: 370  cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
            ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089

                                                                        
Query: 430  tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
            ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029

                                                                        
Query: 490  cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
            | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 3028 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 2969

                                                                        
Query: 550  ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
             |  || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||
Sbjct: 2968 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 2909

                                                                
Query: 610  tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
            | || ||||||| |||||||||||||||||  || ||||||| |||||||||
Sbjct: 2908 ttgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccat 2857



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                           
Query: 112  gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 158
            |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 3394 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  238 bits (120), Expect = 2e-59
 Identities = 294/352 (83%)
 Strand = Plus / Minus

                                                                       
Query: 310 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372

                                                                       
Query: 370 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312

                                                                       
Query: 430 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252

                                                                       
Query: 490 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 251 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 192

                                                                       
Query: 550 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
           || ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||
Sbjct: 191 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 132

                                                               
Query: 610 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | || ||||||| ||||||||||||||||| ||||||||||| |||||||||
Sbjct: 131 ttgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccat 80



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 47  acatggtacaaagtacaacaaactc 71
           |||| ||||||||||||||||||||
Sbjct: 680 acatcgtacaaagtacaacaaactc 656



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  238 bits (120), Expect = 2e-59
 Identities = 294/352 (83%)
 Strand = Plus / Minus

                                                                       
Query: 310 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
           |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353

                                                                       
Query: 370 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
           ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293

                                                                       
Query: 430 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
           ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233

                                                                       
Query: 490 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
           | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 232 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 173

                                                                       
Query: 550 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
            |  || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||
Sbjct: 172 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 113

                                                               
Query: 610 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | || ||||||| |||||||||||||||||  || ||||||| |||||||||
Sbjct: 112 ttgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccat 61



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                          
Query: 112 gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 158
           |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 598 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 42  agtgcacatggtacaaagtacaacaaactc 71
           ||||||||||||||||||||||||||||||
Sbjct: 679 agtgcacatggtacaaagtacaacaaactc 650



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  238 bits (120), Expect = 2e-59
 Identities = 294/352 (83%)
 Strand = Plus / Minus

                                                                       
Query: 310 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313

                                                                       
Query: 370 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253

                                                                       
Query: 430 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193

                                                                       
Query: 490 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 192 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 133

                                                                       
Query: 550 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
           || ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||
Sbjct: 132 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 73

                                                               
Query: 610 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | || ||||||| ||||||||||||||||| ||||||||||| |||||||||
Sbjct: 72  ttgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccat 21



to top

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  232 bits (117), Expect = 1e-57
 Identities = 285/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 380
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 381 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 440
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 441 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 500
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 501 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 560
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 561 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 620
           ||| ||||||||||||||||||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 621 atggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | |||||||||||||||||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  224 bits (113), Expect = 3e-55
 Identities = 260/309 (84%)
 Strand = Plus / Minus

                                                                       
Query: 353 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 412
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 413 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 472
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 473 gccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 532
           |||||||| |||| |||||||||||||||||||| ||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 533 ggcataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 592
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70

                                                                       
Query: 593 ggtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagc 652
           || |||||| ||||| |  || ||||||| ||||||||||||||||| |||||||| || 
Sbjct: 69  ggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctgtagt 10

                    
Query: 653 gcgagccat 661
           |||||||||
Sbjct: 9   gcgagccat 1



to top

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  224 bits (113), Expect = 3e-55
 Identities = 284/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 321 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 380
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 381 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 440
           || || || |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 441 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 500
           |  ||||||||||| ||||||||| | |||  |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 501 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 560
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||| ||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 561 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 620
           ||||||||||| ||||||  |||||||||||||| |||| |||||| ||| || ||||||
Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgccgccacc 42

                                                    
Query: 621 atggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | ||||||||||||||| | ||||||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagtttagtagctgcagtgcgagccat 1



to top

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  216 bits (109), Expect = 7e-53
 Identities = 283/341 (82%)
 Strand = Plus / Minus

                                                                       
Query: 321 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 380
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 381 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 440
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 441 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 500
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 501 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 560
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 561 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 620
           ||| ||||||||||||||| ||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 621 atggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | |||||||||||||||||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  190 bits (96), Expect = 4e-45
 Identities = 288/352 (81%)
 Strand = Plus / Minus

                                                                       
Query: 310 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
           |||||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||
Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295

                                                                       
Query: 370 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
           ||||| |||||||||| || |||||| |||| |||||   | | || ||  | |||||||
Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235

                                                                       
Query: 430 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175

                                                                       
Query: 490 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 174 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 115

                                                                       
Query: 550 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
           ||| |||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||
Sbjct: 114 ggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagca 55

                                                               
Query: 610 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | || ||||||| |||||||||| ||||||  || ||||||| |||||||||
Sbjct: 54  ttgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccat 3



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 111 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 155
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 527 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 484



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  174 bits (88), Expect = 3e-40
 Identities = 286/352 (81%)
 Strand = Plus / Minus

                                                                       
Query: 310 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 369
           |||||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |
Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366

                                                                       
Query: 370 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 429
           ||||| |||||||||| || |||||| | || |||||   | | || ||  | |||||||
Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306

                                                                       
Query: 430 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 489
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246

                                                                       
Query: 490 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 549
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 245 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 186

                                                                       
Query: 550 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 609
           ||| |||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||
Sbjct: 185 ggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagca 126

                                                               
Query: 610 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           | || ||||||| |||||||||| ||||||  || ||||||| |||||||||
Sbjct: 125 ttgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccat 74



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 111 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 155
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 598 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 555



to top

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  117 bits (59), Expect = 5e-23
 Identities = 168/203 (82%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 301 agcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggga 360
           |||| ||| |||||||| | |||||||||||||||||    |||||||| | ||||||||
Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372

                                                                       
Query: 361 cgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcag 420
           |||||||||||||| |||||||||| || |||||| |||| |||||   | | || ||| 
Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313

                                                                       
Query: 421 cgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcca 480
           | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  ||||||||
Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253

                                  
Query: 481 gtctcttgacgccgctgcagcag 503
            ||||||||| ||||| ||||||
Sbjct: 252 atctcttgactccgctacagcag 230



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 97/113 (85%), Gaps = 2/113 (1%)
 Strand = Plus / Minus

                                                                       
Query: 549 gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagc 608
           |||| |||||||||||||||||| ||||||| ||||  |||||||| |||||||||||||
Sbjct: 185 gggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgaggagc 128

                                                                
Query: 609 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 661
           || || ||||||| ||  |||||| ||||||  || ||||||| |||||||||
Sbjct: 127 attgccgccaccaggggcaccagcgcgagcttggttgctgcagtgcgagccat 75



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 111 cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 155
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 582 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 539



to top

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                         
Query: 325   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 384
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 385   ttccggcggccttgccagcgtttagccc 412
             | | |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 325      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 384
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 385      ttccggcggccttgccagcgtttagccc 412
                | | |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 387    ccggcggccttgccagcgtttagccc 412
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 387    ccggcggccttgccagcgtt 406
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 387    ccggcg 392
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 487    tgacgccgctgcagcaggcc 506
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576



to top

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 325 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 384
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 385 ttccggcggccttgccagcgtttagccc 412
           | | |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372



to top

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 325 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 384
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 385 ttccggcggccttgccagcgtttagccc 412
           | | |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 325      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 384
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 385      ttccggcggccttgccagcgtttagccc 412
                | | |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 387    ccggcggccttgccagcgtttagccc 412
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 387    ccggcggccttgccagcgtt 406
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 387    ccggcg 392
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 487    tgacgccgctgcagcaggcc 506
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 387    ccggcggccttgccagcgtttagccc 412
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 387    ccggcggccttgccagcgtt 406
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 387    ccggcg 392
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 487    tgacgccgctgcagcaggcc 506
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428



to top

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 387    ccggcggccttgccagcgtttagccc 412
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 387    ccggcggccttgccagcgtt 406
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 327    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 387    ccggcg 392
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 487    tgacgccgctgcagcaggcc 506
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428



to top

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 387   ccggcggccttgccagcgtttagccc 412
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 387   ccggcggccttgccagcgtt 406
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 387   ccggcg 392
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 487   tgacgccgctgcagcaggcc 506
             ||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggcc 46706



to top

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341



to top

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



to top

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                        
Query: 327  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 387  ccggcggccttgccagcgtttagccc 412
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360



to top

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237



to top

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 387   ccggcggccttgccagcgtttagccc 412
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 387   ccggcggccttgccagcgtt 406
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 387   ccggcg 392
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 487   tgacgccgctgcagcaggcc 506
             ||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggcc 50396



to top

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353



to top

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288



to top

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 77/86 (89%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||| 
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 387 ccggcggccttgccagcgtttagccc 412
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328



to top

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggcc 281



to top

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggcc 513



to top

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 561 gagctcacctgaccgcaggagatggccgc 589
           ||||||||||| |||||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggccgc 26



to top

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 561 gagctcacctgaccgcaggagatggccgc 589
           ||||||||||| |||||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726



to top

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggcc 143



to top

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggcc 466



to top

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggcc 249



to top

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggcc 231



to top

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 339 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttg 398
           |||| |||||||| |||||||| ||||||||||||| |||||||||| | |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                      
Query: 399 ccagcgtttag 409
           || ||||||||
Sbjct: 265 ccggcgtttag 255



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggcc 149



to top

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 387 ccggcggccttgcc 400
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                            
Query: 327      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 387      ccggcg 392
                ||||||
Sbjct: 14437004 ccggcg 14436999



to top

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 327   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 387   ccggcg 392
             ||||||
Sbjct: 45502 ccggcg 45497



to top

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344



to top

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254



to top

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 483 ctcttgacgccgctgcagcag 503
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 483 ctcttgacgccgctgcagcag 503
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140



to top

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355



to top

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 483 ctcttgacgccgctgcagcag 503
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266



to top

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265



to top

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335



to top

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 344 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagc 403
           |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 404 gtt 406
           |||
Sbjct: 157 gtt 159



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggcc 268



to top

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 387 ccggcg 392
           ||||||
Sbjct: 370 ccggcg 365



to top

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 327  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 387  ccggcg 392
            ||||||
Sbjct: 3456 ccggcg 3451



to top

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 387 ccggcg 392
           ||||||
Sbjct: 372 ccggcg 367



to top

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 387 ccggcg 392
           ||||||
Sbjct: 374 ccggcg 369



to top

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 374 ctggcggc 367



to top

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||| 
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 487 tgacgccgctgcagcaggcc 506
           ||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggcc 226



to top

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| || 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239



to top

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 356 ctggcggc 349



to top

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 281 ctggcggc 274



to top

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 380 ctggcggc 373



to top

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 395 ctggcggc 388



to top

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 393 ctggcggc 386



to top

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 390 ctggcggc 383



to top

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 387 ccggcggccttgccagcgtt 406
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336



to top

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 204 ctggcggc 197



to top

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 391 ctggcggc 384



to top

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 327 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 386
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||| 
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 387 ccggcggc 394
           | ||||||
Sbjct: 259 ctggcggc 252



to top

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 344  gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 392
            ||||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722



to top

>gb|AC007023.3|AC007023 Homo sapiens clone DJ0635B05, complete sequence
          Length = 148454

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 673   agctagcaatagtagtggtggtg 695
             |||||||||||||||||||||||
Sbjct: 24018 agctagcaatagtagtggtggtg 23996



to top

>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA
           clone IMAGE:4504353), partial cds
          Length = 4763

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 490 cgccgctgcagcaggccacagg 511
           ||||||||||||||||||||||
Sbjct: 367 cgccgctgcagcaggccacagg 388



to top

>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence
          Length = 43869

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 490   cgccgctgcagcaggccacagg 511
             ||||||||||||||||||||||
Sbjct: 43282 cgccgctgcagcaggccacagg 43303



to top

>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 490   cgccgctgcagcaggccacagg 511
             ||||||||||||||||||||||
Sbjct: 52943 cgccgctgcagcaggccacagg 52964



to top

>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete
             sequence
          Length = 171538

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 552   ctcaaggcagagctcacctgaccgc 576
             |||||||||||| ||||||||||||
Sbjct: 24731 ctcaaggcagagatcacctgaccgc 24755



to top

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the 3'
              end of the PRKCZ gene for protein kinase C zeta, a novel
              gene, a novel gene (FLJ31031), the SKI gene for v-ski
              sarcoma viral oncogene homolog (avian) and five CpG
              islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 559    cagagctcacctgaccgcagg 579
              |||||||||||||||||||||
Sbjct: 113726 cagagctcacctgaccgcagg 113706



to top

>emb|AL158158.14| Human DNA sequence from clone RP11-427L11 on chromosome 9q31.2-32
            Contains the TXN gene for thioredoxin, the gene for a
            novel protein similar to thioredoxin, the 3' end of the
            gene for the likely ortholog of mouse polydom (POLYDOM)
            and two CpG islands, complete sequence
          Length = 194835

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 82   tcaaaggaagtaaatattaat 102
            |||||||||||||||||||||
Sbjct: 9384 tcaaaggaagtaaatattaat 9364



to top

>gb|AF548001.1| Homo sapiens thioredoxin (TXN) gene, complete cds
          Length = 15100

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 82    tcaaaggaagtaaatattaat 102
             |||||||||||||||||||||
Sbjct: 12943 tcaaaggaagtaaatattaat 12963



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 488      gacgccgctgcagcaggccac 508
                |||||||||||||||||||||
Sbjct: 41554621 gacgccgctgcagcaggccac 41554641



to top

>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0614D08
          Length = 147548

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 488    gacgccgctgcagcaggccac 508
              |||||||||||||||||||||
Sbjct: 110914 gacgccgctgcagcaggccac 110934



to top

>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 577  aggagatggccgcgtcggtgg 597
            |||||||||||||||||||||
Sbjct: 1709 aggagatggccgcgtcggtgg 1729



to top

>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0660F12
          Length = 147203

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 488    gacgccgctgcagcaggccac 508
              |||||||||||||||||||||
Sbjct: 122820 gacgccgctgcagcaggccac 122840



to top

>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 321 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 373
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397



to top

>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 321 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 373
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397



to top

>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 483  ctcttgacgccgctgcagcag 503
            |||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagcag 2785



to top

>emb|X54541.1|HSTRXE4E5 H.sapiens Trx gene for thioredoxin, exon 4 and exon 5
          Length = 1404

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 82  tcaaaggaagtaaatattaat 102
           |||||||||||||||||||||
Sbjct: 60  tcaaaggaagtaaatattaat 80



to top

>emb|X70288.1|HSTHDC H.sapiens gene for thioredoxin, exons 4 and 5
          Length = 1394

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 82  tcaaaggaagtaaatattaat 102
           |||||||||||||||||||||
Sbjct: 31  tcaaaggaagtaaatattaat 51



to top

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 483 ctcttgacgccgctgcagcag 503
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 613    cggccaccatggcgaccagc 632
              ||||||||||||||||||||
Sbjct: 608556 cggccaccatggcgaccagc 608575



to top

>ref|XM_638808.1| Dictyostelium discoideum hypothetical protein (DDB0167912), partial
           mRNA
          Length = 1989

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 676 tagcaatagtagtggtggtg 695
           ||||||||||||||||||||
Sbjct: 117 tagcaatagtagtggtggtg 136



to top

>ref|XM_628905.1| Dictyostelium discoideum hypothetical protein (DDB0219917), partial
            mRNA
          Length = 2928

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 676  tagcaatagtagtggtggtg 695
            ||||||||||||||||||||
Sbjct: 1005 tagcaatagtagtggtggtg 1024



to top

>gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, complete sequence
          Length = 186258

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 87    ggaagtaaatattaattata 106
             ||||||||||||||||||||
Sbjct: 19775 ggaagtaaatattaattata 19794



to top

>gb|AC153594.15| Mus musculus 10 BAC RP23-98N14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208555

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 22     tatatgatacatatatnaaaagt 44
              |||||||||||||||| ||||||
Sbjct: 174158 tatatgatacatatataaaaagt 174180



to top

>gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromosome 16, complete
              sequence
          Length = 161327

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 674    gctagcaatagtagtggtgg 693
              ||||||||||||||||||||
Sbjct: 153458 gctagcaatagtagtggtgg 153439



to top

>gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosome 18, complete
             sequence
          Length = 170129

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    ggaagtaaatattaattata 106
             ||||||||||||||||||||
Sbjct: 23067 ggaagtaaatattaattata 23048



to top

>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete sequence
          Length = 213633

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 674    gctagcaatagtagtggtgg 693
              ||||||||||||||||||||
Sbjct: 182524 gctagcaatagtagtggtgg 182505



to top

>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence
          Length = 215866

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 674   gctagcaatagtagtggtgg 693
             ||||||||||||||||||||
Sbjct: 30167 gctagcaatagtagtggtgg 30186



to top

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 41    aagtgcacatggtacaaagtacaa 64
             ||||||||||||||||||| ||||
Sbjct: 70159 aagtgcacatggtacaaagcacaa 70182



to top

>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 128843

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 180    cacatggagataatatatga 199
              ||||||||||||||||||||
Sbjct: 114026 cacatggagataatatatga 114007



to top

>emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on chromosome 13, complete
             sequence
          Length = 132436

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    aaggaagtaaatattaatta 104
             ||||||||||||||||||||
Sbjct: 74392 aaggaagtaaatattaatta 74373



to top

>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG
             island, complete sequence
          Length = 162575

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 184   tggagataatatatgagagc 203
             ||||||||||||||||||||
Sbjct: 31942 tggagataatatatgagagc 31961



to top

>gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete sequence
          Length = 150117

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 41    aagtgcacatggtacaaagtacaa 64
             ||||||||||||||||||| ||||
Sbjct: 66671 aagtgcacatggtacaaagcacaa 66694



to top

>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130
          Length = 3692

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 289  agcaaggatgacagcaagtg 308
            ||||||||||||||||||||
Sbjct: 1826 agcaaggatgacagcaagtg 1807



to top

>gb|AC110774.3| Homo sapiens BAC clone RP11-254A24 from 4, complete sequence
          Length = 121016

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    tcctctcaaaggaagtaaat 96
             ||||||||||||||||||||
Sbjct: 18205 tcctctcaaaggaagtaaat 18186



to top

>gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, complete sequence
          Length = 118837

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    agtaaatattaattataaca 109
             ||||||||||||||||||||
Sbjct: 82647 agtaaatattaattataaca 82628



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 41      aagtgcacatggtacaaagtacaa 64
               ||||||||||||||||||| ||||
Sbjct: 1753936 aagtgcacatggtacaaagcacaa 1753959



to top

>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2,
             complete sequence
          Length = 146298

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 184   tggagataatatatgagagc 203
             ||||||||||||||||||||
Sbjct: 85666 tggagataatatatgagagc 85685



to top

>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence
          Length = 109398

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 289    agcaaggatgacagcaagtg 308
              ||||||||||||||||||||
Sbjct: 100675 agcaaggatgacagcaagtg 100694



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 450      ttgtcagcggtgctctgggc 469
                ||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggc 11569482



to top

>gb|AC127089.4| Homo sapiens BAC clone RP13-590E7 from 4, complete sequence
          Length = 25804

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 674   gctagcaatagtagtggtgg 693
             ||||||||||||||||||||
Sbjct: 15879 gctagcaatagtagtggtgg 15898



to top

>gb|AC157095.9| Mus musculus 6 BAC RP24-350P11 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 177800

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 22     tatatgatacatatatnaaaagt 44
              |||||||||||||||| ||||||
Sbjct: 167855 tatatgatacatatataaaaagt 167833



to top

>gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041-2567370 strain AX4,
              complete sequence
          Length = 333321

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 676    tagcaatagtagtggtggtg 695
              ||||||||||||||||||||
Sbjct: 267625 tagcaatagtagtggtggtg 267644



to top

>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence
          Length = 206852

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   agcaaggatgacagcaagtg 308
             ||||||||||||||||||||
Sbjct: 90670 agcaaggatgacagcaagtg 90651



to top

>gb|AC148962.4| Atelerix albiventris clone LB4-372K23, complete sequence
          Length = 54256

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 41    aagtgcacatggtacaaagtacaa 64
             ||||||||||||||||||| ||||
Sbjct: 24977 aagtgcacatggtacaaagcacaa 25000



to top

>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 450    ttgtcagcggtgctctgggc 469
              ||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggc 123616



to top

>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 450   ttgtcagcggtgctctgggc 469
             ||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggc 29753



to top

>gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complete sequence
          Length = 193738

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    attcctctcaaaggaagtaa 94
             ||||||||||||||||||||
Sbjct: 83149 attcctctcaaaggaagtaa 83130



to top

>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete
             sequence
          Length = 211750

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 289   agcaaggatgacagcaagtg 308
             ||||||||||||||||||||
Sbjct: 90149 agcaaggatgacagcaagtg 90168



to top

>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete
              sequence
          Length = 156583

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 289    agcaaggatgacagcaagtg 308
              ||||||||||||||||||||
Sbjct: 142238 agcaaggatgacagcaagtg 142257



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 577    aggagatggccgcgtcggtg 596
              ||||||||||||||||||||
Sbjct: 201635 aggagatggccgcgtcggtg 201616



to top

>gb|AC158526.3| Mus musculus BAC clone RP23-288A9 from chromosome 12, complete sequence
          Length = 236362

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 676    tagcaatagtagtggtggtg 695
              ||||||||||||||||||||
Sbjct: 163843 tagcaatagtagtggtggtg 163824



to top

>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 6/19
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   agcaaggatgacagcaagtg 308
             ||||||||||||||||||||
Sbjct: 19820 agcaaggatgacagcaagtg 19801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,725,361
Number of Sequences: 3902068
Number of extensions: 4725361
Number of successful extensions: 89736
Number of sequences better than 10.0: 159
Number of HSP's better than 10.0 without gapping: 161
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88921
Number of HSP's gapped (non-prelim): 799
length of query: 699
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 676
effective length of database: 17,143,297,704
effective search space: 11588869247904
effective search space used: 11588869247904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top