ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags38e22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY109331.1| Zea mays CL253_2 mRNA sequence 375 e-100
2ref|XM_467485.1| Oryza sativa (japonica cultivar-group), mRNA 351 1e-93
3dbj|AK120884.1| Oryza sativa (japonica cultivar-group) cDNA clon... 313 3e-82
4gb|BT017600.1| Zea mays clone EL01N0431G10.c mRNA sequence 280 4e-72
5gb|AY103830.2| Zea mays PCO109717 mRNA sequence 280 4e-72
6gb|AY754699.1| Zea mays putative 60S ribosomal protein L31 mRNA,... 268 2e-68
7gb|AY109515.1| Zea mays CL253_10 mRNA sequence 260 4e-66
8ref|XM_483237.1| Oryza sativa (japonica cultivar-group), mRNA 256 6e-65
9dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 232 9e-58
10dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic D... 232 9e-58
11dbj|AK105284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 9e-58
12dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 226 6e-56
13dbj|AP003543.3| Oryza sativa (japonica cultivar-group) genomic D... 226 6e-56
14dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 196 5e-47
15dbj|AP005245.3| Oryza sativa (japonica cultivar-group) genomic D... 196 5e-47
16dbj|AP003883.3| Oryza sativa (japonica cultivar-group) genomic D... 196 5e-47
17gb|AF457941.1| Zea mays clone cho1c.pk002.n14, mRNA sequence 184 2e-43
18gb|AF237624.1|AF237624 Perilla frutescens 80S ribosomal protein ... 149 1e-32
19gb|BT014565.1| Lycopersicon esculentum clone 134019R, mRNA sequence 129 1e-26
20dbj|D29722.1|RICYK35 Oryza sativa mRNA, partial homologous to ri... 125 2e-25
21dbj|AB043976.1| Panax ginseng mRNA for ribosomal protein L31, co... 121 2e-24
22ref|NM_127532.2| Arabidopsis thaliana structural constituent of ... 101 2e-18
23gb|AY072459.1| Arabidopsis thaliana 60S ribosomal protein L31 (A... 101 2e-18
24gb|AY061893.1| Arabidopsis thaliana At2g19740/F6F22.23 mRNA, com... 101 2e-18
25gb|AY054616.1| Arabidopsis thaliana 60S ribosomal protein L31 (A... 101 2e-18
26gb|AY052313.1| Arabidopsis thaliana At2g19740/F6F22.23 mRNA, com... 101 2e-18
27emb|BX821878.1|CNS0A8AF Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
28ref|NM_118756.3| Arabidopsis thaliana structural constituent of ... 94 5e-16
29emb|BX829225.1|CNS0A2K3 Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
30gb|BT005841.1| Arabidopsis thaliana At4g26230 gene, complete cds 94 5e-16
31gb|AY085228.1| Arabidopsis thaliana clone 14013 mRNA, complete s... 94 5e-16
32emb|BX827089.1|CNS0A3AD Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
33gb|DQ306814.1| Hevea brasiliensis isolate SSH85 mRNA sequence 92 2e-15
34gb|DQ384531.1| Panax ginseng clone PG6L-8 ribosomal protein L31 ... 90 8e-15
35gb|U23784.1|NGU23784 Nicotiana glutinosa ribosomal protein L31 m... 88 3e-14
36emb|AJ417520.1|OSA417520 Oryza sativa partial mRNA for ribosomal... 80 8e-12
37gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map... 78 3e-11
38ref|NM_125054.1| Arabidopsis thaliana structural constituent of ... 76 1e-10
39gb|AY124821.1| Arabidopsis thaliana AT5g56710/MIK19_16 mRNA, com... 76 1e-10
40gb|AY050393.1| Arabidopsis thaliana AT5g56710/MIK19_16 mRNA, com... 76 1e-10
41gb|AY085397.1| Arabidopsis thaliana clone 14992 mRNA, complete s... 76 1e-10
42emb|AL161564.2|ATCHRIV64 Arabidopsis thaliana DNA chromosome 4, ... 70 8e-09
43emb|AL049171.1|ATT25K17 Arabidopsis thaliana DNA chromosome 4, B... 70 8e-09
44dbj|AK107805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
45gb|AF051232.1|AF051232 Picea mariana probable 60S ribosomal prot... 64 5e-07
46ref|XM_751252.1| Ustilago maydis 521 hypothetical protein (UM001... 62 2e-06
47gb|BC114301.1| Danio rerio zgc:136896, mRNA (cDNA clone MGC:1368... 62 2e-06
48ref|NM_001040052.1| Danio rerio zgc:136896 (zgc:136896), mRNA 62 2e-06
49dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 62 2e-06
50ref|XM_381680.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 58 3e-05
51ref|XM_416909.1| PREDICTED: Gallus gallus similar to ribosomal p... 54 5e-04
52emb|CR387290.1| Gallus gallus finished cDNA, clone ChEST178p13 54 5e-04
53gb|AY832444.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
54gb|AY832443.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
55gb|AY832442.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
56gb|AY832441.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
57gb|AY832440.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
58gb|AY832439.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
59gb|AY832438.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
60gb|AY832437.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
61gb|AY832436.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
62gb|AY832435.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
63gb|AY832434.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
64gb|AY832433.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
65gb|AY832432.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
66gb|AY832431.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
67gb|AY832430.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
68gb|AY832429.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
69gb|AY832428.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
70gb|AY832427.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
71gb|AY832426.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
72gb|AY832425.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
73gb|AY832424.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
74gb|AY832423.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
75gb|AY832422.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
76gb|AY832421.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
77gb|AY832420.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
78gb|AY832419.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
79gb|AY832418.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
80gb|AY832417.1| Pseudotsuga menziesii var. menziesii haplotype Pm... 52 0.002
81emb|AJ628167.1| Oikopleura dioica partial mRNA for ribosomal pro... 52 0.002
82emb|AJ296278.1|CGL296278 Colletotrichum gloeosporioided f. sp. a... 52 0.002
83gb|AC125520.3| Mus musculus BAC clone RP24-281J17 from 8, comple... 52 0.002
84dbj|AP006658.1| Lotus japonicus genomic DNA, chromosome 4, clone... 52 0.002
85gb|BC086916.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 50 0.007
86gb|AC170991.1| Mus musculus chromosome 1, clone wi1-738M5, compl... 50 0.007
87ref|XM_523741.1| PREDICTED: Pan troglodytes similar to ribosomal... 50 0.007
88gb|AC099572.12| Mus musculus chromosome 15, clone RP23-16A17, co... 50 0.007
89gb|BC055720.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 50 0.007
90gb|BC008223.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 50 0.007
91ref|NM_053257.1| Mus musculus ribosomal protein L31 (Rpl31), mRNA 50 0.007
92ref|XM_001005894.1| PREDICTED: Mus musculus similar to ribosomal... 50 0.007
93ref|XR_002708.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
94ref|XR_003329.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
95ref|XR_002259.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
96ref|XM_001002948.1| PREDICTED: Mus musculus similar to ribosomal... 50 0.007
97ref|XM_991367.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
98ref|XM_991853.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
99ref|XM_982842.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
100ref|XM_618994.3| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
101ref|XM_993518.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
102gb|AC073335.5| Homo sapiens BAC clone RP11-458F8 from 7, complet... 50 0.007
103ref|XM_925336.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
104ref|XM_917895.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
105ref|XR_002570.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
106ref|XM_986580.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
107ref|XR_002179.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
108ref|XM_890955.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.007
109emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chr... 50 0.007
110gb|AC127252.3| Mus musculus BAC clone RP24-276A6 from chromosome... 50 0.007
111gb|AC129177.3| Mus musculus BAC clone RP23-175A22 from 3, comple... 50 0.007
112gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, comp... 50 0.007
113gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, R... 50 0.007
114gb|BC099436.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 50 0.007
115gb|AC142249.6| Mus musculus chromosome 19, clone RP23-388O22, co... 50 0.007
116dbj|AK148620.1| Mus musculus 2 days neonate sympathetic ganglion... 50 0.007
117dbj|AK160620.1| Mus musculus 11 days embryo whole body cDNA, RIK... 50 0.007
118dbj|AB169692.1| Macaca fascicularis brain cDNA, clone: QccE-1864... 50 0.007
119dbj|AK033029.1| Mus musculus 11 days embryo gonad cDNA, RIKEN fu... 50 0.007
120gb|AC161252.2| Mus musculus BAC clone RP24-167E3 from chromosome... 50 0.007
121gb|AC154217.2| Mus musculus BAC clone RP24-357L19 from chromosom... 50 0.007
122gb|AF362574.1|AF362574 Mus musculus M75 (M75) mRNA, complete cds 50 0.007
123dbj|AK019226.1| Mus musculus 11 days embryo whole body cDNA, RIK... 50 0.007
124dbj|AK075964.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 50 0.007
125dbj|AK011236.1| Mus musculus 10 days embryo whole body cDNA, RIK... 50 0.007
126dbj|AK014295.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN... 50 0.007
127dbj|AK020627.1| Mus musculus adult male urinary bladder cDNA, RI... 50 0.007
128gb|AC158989.1| Mus musculus BAC clone RP23-399H20 from chromosom... 50 0.007
129gb|AF401586.1| Ictalurus punctatus ribosomal protein L31 mRNA, c... 50 0.007
130ref|XM_212735.3| PREDICTED: Rattus norvegicus similar to ribosom... 50 0.007
131ref|XM_578077.1| PREDICTED: Rattus norvegicus similar to ribosom... 50 0.007
132emb|BX511169.2|RN224C24 Rattus norvegicus chromosome 1 BAC RP32-... 50 0.007
133gb|AF144695.1|AF144695 Mus musculus ERO1L (Ero1l) mRNA, complete... 50 0.007
134gb|BC050113.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 50 0.007
135gb|AC154631.2| Mus musculus BAC clone RP23-264F8 from 16, comple... 50 0.007
136emb|CT030142.10| Mouse DNA sequence from clone RP23-422H22 on ch... 50 0.007
137gb|AC132571.2| Mus musculus BAC clone RP24-539E18 from 1, comple... 50 0.007
138gb|AC150033.2| Mus musculus BAC clone RP23-449N19 from 3, comple... 50 0.007
139gb|AC165349.2| Mus musculus BAC clone RP23-212M22 from chromosom... 50 0.007
140gb|AC170749.6| Mus musculus chromosome 1, clone RP23-322G4, comp... 50 0.007
141ref|XM_329389.1| Neurospora crassa OR74A 60s ribosomal protein (... 48 0.029
142ref|XM_960154.1| Neurospora crassa OR74A 60s ribosomal protein (... 48 0.029
143ref|XM_657998.1| Aspergillus nidulans FGSC A4 hypothetical prote... 48 0.029
144ref|XM_001006473.1| PREDICTED: Mus musculus similar to ribosomal... 48 0.029
145ref|XM_973657.1| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.029
146ref|XM_979466.1| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.029
147ref|XM_484165.4| PREDICTED: Mus musculus similar to ribosomal pr... 48 0.029
148ref|XM_983272.1| PREDICTED: Mus musculus ribosomal protein L31 (... 48 0.029
149gb|AC157658.2| Mus musculus BAC clone RP23-331E4 from chromosome... 48 0.029
150gb|AC133187.3| Mus musculus BAC clone RP23-324O10 from 1, comple... 48 0.029
151ref|XM_213087.3| PREDICTED: Rattus norvegicus similar to ribosom... 46 0.11
152emb|AL603867.7| Mouse DNA sequence from clone RP23-237G11 on chr... 46 0.11
153gb|AY826148.1| Aedes albopictus clone AL_280 60S ribosomal prote... 44 0.44
154gb|BC052594.1| Homo sapiens ribosomal protein L31 pseudogene, mR... 44 0.44
155gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 44 0.44
156ref|XM_513947.1| PREDICTED: Pan troglodytes LOC457459 (LOC457459... 44 0.44
157ref|XR_003527.1| PREDICTED: Mus musculus similar to ribosomal pr... 44 0.44
158ref|XM_910656.2| PREDICTED: Mus musculus similar to ribosomal pr... 44 0.44
159ref|XM_983910.1| PREDICTED: Mus musculus similar to ribosomal pr... 44 0.44
160ref|XM_746108.1| Aspergillus fumigatus Af293 ribosomal protein L... 44 0.44
161ref|XM_566913.1| Cryptococcus neoformans var. neoformans JEC21 P... 44 0.44
162emb|AL359541.11| Human DNA sequence from clone RP11-474I16 on ch... 44 0.44
163emb|AL451067.12| Human DNA sequence from clone RP11-25K21 on chr... 44 0.44
164dbj|AB226042.1| Aspergillus oryzae cDNA, contig sequence: AoEST2898 44 0.44
165dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 44 0.44
166ref|NR_002595.1| Homo sapiens ribosomal protein L31 pseudogene (... 44 0.44
167gb|DQ066314.1| Ixodes scapularis isolate IS-6-12L-311 ribosomal ... 44 0.44
168gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cance... 44 0.44
169ref|XM_578388.1| PREDICTED: Rattus norvegicus similar to ribosom... 44 0.44
170ref|XM_508951.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.8
171gb|AY190731.1| Pagrus major ribosomal protein L31 mRNA, complete... 42 1.8
172ref|XM_361184.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 1.8
173ref|XM_001002593.1| PREDICTED: Mus musculus similar to ribosomal... 42 1.8
174ref|XM_917009.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.8
175ref|XM_893121.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.8
176ref|XR_003519.1| PREDICTED: Mus musculus hypothetical LOC435835 ... 42 1.8
177ref|XR_004788.1| PREDICTED: Mus musculus hypothetical LOC435835 ... 42 1.8
178ref|XM_913657.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.8
179emb|CR734325.2|CNS0GTDW Tetraodon nigroviridis full-length cDNA 42 1.8
180emb|CR734302.2|CNS0GTD9 Tetraodon nigroviridis full-length cDNA 42 1.8
181emb|CR734146.2|CNS0GT8X Tetraodon nigroviridis full-length cDNA 42 1.8
182emb|CR734410.2|CNS0GTG9 Tetraodon nigroviridis full-length cDNA 42 1.8
183emb|CR734012.2|CNS0GT57 Tetraodon nigroviridis full-length cDNA 42 1.8
184emb|CR733850.2|CNS0GT0P Tetraodon nigroviridis full-length cDNA 42 1.8
185emb|CR733743.2|CNS0GSXQ Tetraodon nigroviridis full-length cDNA 42 1.8
186emb|CR712268.2|CNS0GCJC Tetraodon nigroviridis full-length cDNA 42 1.8
187emb|CR719182.2|CNS0GHV8 Tetraodon nigroviridis full-length cDNA 42 1.8
188emb|CR718548.2|CNS0GHDM Tetraodon nigroviridis full-length cDNA 42 1.8
189emb|CR718429.2|CNS0GHAB Tetraodon nigroviridis full-length cDNA 42 1.8
190emb|CR718111.2|CNS0GH1H Tetraodon nigroviridis full-length cDNA 42 1.8
191emb|CR717959.2|CNS0GGX9 Tetraodon nigroviridis full-length cDNA 42 1.8
192emb|CR717558.2|CNS0GGM4 Tetraodon nigroviridis full-length cDNA 42 1.8
193emb|CR717407.2|CNS0GGHX Tetraodon nigroviridis full-length cDNA 42 1.8
194emb|CR716798.2|CNS0GG13 Tetraodon nigroviridis full-length cDNA 42 1.8
195emb|CR716116.2|CNS0GFI8 Tetraodon nigroviridis full-length cDNA 42 1.8
196emb|CR715543.2|CNS0GF2B Tetraodon nigroviridis full-length cDNA 42 1.8
197emb|CR715529.2|CNS0GF1X Tetraodon nigroviridis full-length cDNA 42 1.8
198emb|CR715510.2|CNS0GF1E Tetraodon nigroviridis full-length cDNA 42 1.8
199emb|CR715146.2|CNS0GERA Tetraodon nigroviridis full-length cDNA 42 1.8
200emb|CR714875.2|CNS0GEJR Tetraodon nigroviridis full-length cDNA 42 1.8
201emb|CR714639.2|CNS0GED7 Tetraodon nigroviridis full-length cDNA 42 1.8
202emb|CR714536.2|CNS0GEAC Tetraodon nigroviridis full-length cDNA 42 1.8
203emb|CR714381.2|CNS0GE61 Tetraodon nigroviridis full-length cDNA 42 1.8
204emb|CR712482.2|CNS0GCPA Tetraodon nigroviridis full-length cDNA 42 1.8
205emb|CR713989.2|CNS0GDV5 Tetraodon nigroviridis full-length cDNA 42 1.8
206emb|CR713727.2|CNS0GDNV Tetraodon nigroviridis full-length cDNA 42 1.8
207emb|CR713606.2|CNS0GDKI Tetraodon nigroviridis full-length cDNA 42 1.8
208emb|CR712987.2|CNS0GD3B Tetraodon nigroviridis full-length cDNA 42 1.8
209emb|CR712963.2|CNS0GD2N Tetraodon nigroviridis full-length cDNA 42 1.8
210emb|CR713329.2|CNS0GDCT Tetraodon nigroviridis full-length cDNA 42 1.8
211emb|CR713198.2|CNS0GD96 Tetraodon nigroviridis full-length cDNA 42 1.8
212emb|CR712658.2|CNS0GCU6 Tetraodon nigroviridis full-length cDNA 42 1.8
213emb|CR711061.2|CNS0GBLT Tetraodon nigroviridis full-length cDNA 42 1.8
214emb|CR710508.2|CNS0GB6G Tetraodon nigroviridis full-length cDNA 42 1.8
215emb|CR710285.2|CNS0GB09 Tetraodon nigroviridis full-length cDNA 42 1.8
216emb|CR709742.2|CNS0GAL6 Tetraodon nigroviridis full-length cDNA 42 1.8
217emb|CR709716.2|CNS0GAKG Tetraodon nigroviridis full-length cDNA 42 1.8
218emb|CR709291.2|CNS0GA8N Tetraodon nigroviridis full-length cDNA 42 1.8
219emb|CR708928.2|CNS0G9YK Tetraodon nigroviridis full-length cDNA 42 1.8
220emb|CR708809.2|CNS0G9V9 Tetraodon nigroviridis full-length cDNA 42 1.8
221emb|CR709071.2|CNS0GA2J Tetraodon nigroviridis full-length cDNA 42 1.8
222emb|CR708700.2|CNS0G9S8 Tetraodon nigroviridis full-length cDNA 42 1.8
223emb|CR707070.2|CNS0G8IY Tetraodon nigroviridis full-length cDNA 42 1.8
224emb|CR707068.2|CNS0G8IW Tetraodon nigroviridis full-length cDNA 42 1.8
225emb|CR706968.2|CNS0G8G4 Tetraodon nigroviridis full-length cDNA 42 1.8
226emb|CR706675.2|CNS0G87Z Tetraodon nigroviridis full-length cDNA 42 1.8
227emb|CR705563.2|CNS0G7D3 Tetraodon nigroviridis full-length cDNA 42 1.8
228emb|CR705386.2|CNS0G786 Tetraodon nigroviridis full-length cDNA 42 1.8
229emb|CR705049.2|CNS0G6YT Tetraodon nigroviridis full-length cDNA 42 1.8
230emb|CR704256.2|CNS0G6CS Tetraodon nigroviridis full-length cDNA 42 1.8
231emb|CR703648.2|CNS0G5VW Tetraodon nigroviridis full-length cDNA 42 1.8
232emb|CR703508.2|CNS0G5S0 Tetraodon nigroviridis full-length cDNA 42 1.8
233emb|CR703462.2|CNS0G5QQ Tetraodon nigroviridis full-length cDNA 42 1.8
234emb|CR702868.2|CNS0G5A8 Tetraodon nigroviridis full-length cDNA 42 1.8
235emb|CR702754.2|CNS0G572 Tetraodon nigroviridis full-length cDNA 42 1.8
236emb|CR702090.2|CNS0G4OM Tetraodon nigroviridis full-length cDNA 42 1.8
237emb|CR700699.2|CNS0G3LZ Tetraodon nigroviridis full-length cDNA 42 1.8
238emb|CR697644.2|CNS0G194 Tetraodon nigroviridis full-length cDNA 42 1.8
239emb|CR697054.2|CNS0G0SQ Tetraodon nigroviridis full-length cDNA 42 1.8
240emb|CR696604.2|CNS0G0G8 Tetraodon nigroviridis full-length cDNA 42 1.8
241emb|CR694260.2|CNS0FYN4 Tetraodon nigroviridis full-length cDNA 42 1.8
242emb|CR692605.2|CNS0FXD5 Tetraodon nigroviridis full-length cDNA 42 1.8
243emb|CR688682.2|CNS0FUC6 Tetraodon nigroviridis full-length cDNA 42 1.8
244emb|CR686948.2|CNS0FT00 Tetraodon nigroviridis full-length cDNA 42 1.8
245emb|CR686415.2|CNS0FSL7 Tetraodon nigroviridis full-length cDNA 42 1.8
246emb|CR684623.2|CNS0FR7F Tetraodon nigroviridis full-length cDNA 42 1.8
247emb|CR681766.2|CNS0FP02 Tetraodon nigroviridis full-length cDNA 42 1.8
248emb|CR671971.2|CNS0FHGP Tetraodon nigroviridis full-length cDNA 42 1.8
249emb|CR661138.2|CNS0F93S Tetraodon nigroviridis full-length cDNA 42 1.8
250emb|CR656051.2|CNS0F56H Tetraodon nigroviridis full-length cDNA 42 1.8
251emb|CR655886.2|CNS0F51W Tetraodon nigroviridis full-length cDNA 42 1.8
252emb|CR655770.2|CNS0F4YO Tetraodon nigroviridis full-length cDNA 42 1.8
253emb|CR654391.2|CNS0F3WD Tetraodon nigroviridis full-length cDNA 42 1.8
254emb|CR654159.2|CNS0F3PX Tetraodon nigroviridis full-length cDNA 42 1.8
255emb|CR653736.2|CNS0F3E6 Tetraodon nigroviridis full-length cDNA 42 1.8
256emb|CR653113.2|CNS0F2WV Tetraodon nigroviridis full-length cDNA 42 1.8
257emb|CR652461.2|CNS0F2ER Tetraodon nigroviridis full-length cDNA 42 1.8
258emb|CR652318.2|CNS0F2AS Tetraodon nigroviridis full-length cDNA 42 1.8
259emb|CR652143.2|CNS0F25X Tetraodon nigroviridis full-length cDNA 42 1.8
260emb|CR652520.2|CNS0F2GE Tetraodon nigroviridis full-length cDNA 42 1.8
261emb|CR651677.2|CNS0F1SZ Tetraodon nigroviridis full-length cDNA 42 1.8
262emb|CR651599.2|CNS0F1QT Tetraodon nigroviridis full-length cDNA 42 1.8
263emb|CR648519.2|CNS0EZD9 Tetraodon nigroviridis full-length cDNA 42 1.8
264emb|CR648435.2|CNS0EZAX Tetraodon nigroviridis full-length cDNA 42 1.8
265emb|CR650005.2|CNS0F0IJ Tetraodon nigroviridis full-length cDNA 42 1.8
266emb|CR650222.2|CNS0F0OK Tetraodon nigroviridis full-length cDNA 42 1.8
267emb|CR649436.2|CNS0F02Q Tetraodon nigroviridis full-length cDNA 42 1.8
268emb|CR649277.2|CNS0EZYB Tetraodon nigroviridis full-length cDNA 42 1.8
269emb|CR648761.2|CNS0EZJZ Tetraodon nigroviridis full-length cDNA 42 1.8
270emb|CR648392.2|CNS0EZ9Q Tetraodon nigroviridis full-length cDNA 42 1.8
271emb|CR646907.2|CNS0EY4H Tetraodon nigroviridis full-length cDNA 42 1.8
272emb|CR645348.2|CNS0EWX6 Tetraodon nigroviridis full-length cDNA 42 1.8
273emb|CR645090.2|CNS0EWQ0 Tetraodon nigroviridis full-length cDNA 42 1.8
274emb|CR641648.2|CNS0EU2E Tetraodon nigroviridis full-length cDNA 42 1.8
275emb|CR640166.2|CNS0ESX8 Tetraodon nigroviridis full-length cDNA 42 1.8
276emb|CR639451.2|CNS0ESDD Tetraodon nigroviridis full-length cDNA 42 1.8
277emb|CR638912.2|CNS0ERYE Tetraodon nigroviridis full-length cDNA 42 1.8
278emb|CR637864.2|CNS0ER5A Tetraodon nigroviridis full-length cDNA 42 1.8
279emb|CR637548.2|CNS0EQWI Tetraodon nigroviridis full-length cDNA 42 1.8
280emb|CR636391.2|CNS0EQ0D Tetraodon nigroviridis full-length cDNA 42 1.8
281emb|CR634990.2|CNS0EOXG Tetraodon nigroviridis full-length cDNA 42 1.8
282emb|CR634329.2|CNS0EOF3 Tetraodon nigroviridis full-length cDNA 42 1.8
283emb|CR634579.2|CNS0EOM1 Tetraodon nigroviridis full-length cDNA 42 1.8
284emb|CR632825.2|CNS0EN9B Tetraodon nigroviridis full-length cDNA 42 1.8
285emb|CR632787.2|CNS0EN89 Tetraodon nigroviridis full-length cDNA 42 1.8
286emb|CR632754.2|CNS0EN7C Tetraodon nigroviridis full-length cDNA 42 1.8
287emb|CR632688.2|CNS0EN5I Tetraodon nigroviridis full-length cDNA 42 1.8
288emb|CR633444.2|CNS0ENQI Tetraodon nigroviridis full-length cDNA 42 1.8
289emb|CR633320.2|CNS0ENN2 Tetraodon nigroviridis full-length cDNA 42 1.8
290emb|CR633292.2|CNS0ENMA Tetraodon nigroviridis full-length cDNA 42 1.8
291emb|CR633233.2|CNS0ENKN Tetraodon nigroviridis full-length cDNA 42 1.8
292emb|CR633165.2|CNS0ENIR Tetraodon nigroviridis full-length cDNA 42 1.8
293emb|CR632973.2|CNS0ENDF Tetraodon nigroviridis full-length cDNA 42 1.8
294emb|CR632927.2|CNS0ENC5 Tetraodon nigroviridis full-length cDNA 42 1.8
295emb|CR632572.2|CNS0EN2A Tetraodon nigroviridis full-length cDNA 42 1.8
296emb|CR632480.2|CNS0EMZQ Tetraodon nigroviridis full-length cDNA 42 1.8
297emb|CR632471.2|CNS0EMZH Tetraodon nigroviridis full-length cDNA 42 1.8
298emb|CR631284.2|CNS0EM2H Tetraodon nigroviridis full-length cDNA 42 1.8
299emb|CR631237.2|CNS0EM16 Tetraodon nigroviridis full-length cDNA 42 1.8
300emb|CR631170.2|CNS0ELZB Tetraodon nigroviridis full-length cDNA 42 1.8
301emb|CR632334.2|CNS0EMVO Tetraodon nigroviridis full-length cDNA 42 1.8
302emb|CR632221.2|CNS0EMSJ Tetraodon nigroviridis full-length cDNA 42 1.8
303emb|CR632216.2|CNS0EMSE Tetraodon nigroviridis full-length cDNA 42 1.8
304emb|CR632207.2|CNS0EMS5 Tetraodon nigroviridis full-length cDNA 42 1.8
305emb|CR632105.2|CNS0EMPB Tetraodon nigroviridis full-length cDNA 42 1.8
306emb|CR632095.2|CNS0EMP1 Tetraodon nigroviridis full-length cDNA 42 1.8
307emb|CR632074.2|CNS0EMOG Tetraodon nigroviridis full-length cDNA 42 1.8
308emb|CR631911.2|CNS0EMJX Tetraodon nigroviridis full-length cDNA 42 1.8
309emb|CR631860.2|CNS0EMII Tetraodon nigroviridis full-length cDNA 42 1.8
310emb|CR631848.2|CNS0EMI6 Tetraodon nigroviridis full-length cDNA 42 1.8
311emb|CR631845.2|CNS0EMI3 Tetraodon nigroviridis full-length cDNA 42 1.8
312emb|CR631802.2|CNS0EMGW Tetraodon nigroviridis full-length cDNA 42 1.8
313emb|CR631787.2|CNS0EMGH Tetraodon nigroviridis full-length cDNA 42 1.8
314emb|CR631462.2|CNS0EM7F Tetraodon nigroviridis full-length cDNA 42 1.8
315emb|CR631369.2|CNS0EM4U Tetraodon nigroviridis full-length cDNA 42 1.8
316emb|CR631317.2|CNS0EM3E Tetraodon nigroviridis full-length cDNA 42 1.8
317emb|CR631642.2|CNS0EMCG Tetraodon nigroviridis full-length cDNA 42 1.8
318emb|CR631578.2|CNS0EMAO Tetraodon nigroviridis full-length cDNA 42 1.8
319emb|CR631545.2|CNS0EM9R Tetraodon nigroviridis full-length cDNA 42 1.8
320gb|AC159977.4| Mus musculus chromosome 5, clone RP24-121I11, com... 42 1.8
321gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, co... 42 1.8
322dbj|AK161996.1| Mus musculus 12 days embryo male wolffian duct i... 42 1.8
323gb|AC159005.3| Mus musculus BAC clone RP23-67F4 from chromosome ... 42 1.8
324ref|NM_022506.2| Rattus norvegicus ribosomal protein L31 (Rpl31)... 42 1.8
325ref|XM_343771.2| PREDICTED: Rattus norvegicus similar to Ftsj ho... 42 1.8
326ref|XM_573524.1| PREDICTED: Rattus norvegicus similar to MGC7885... 42 1.8
327dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 42 1.8
328gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, co... 42 1.8
329gb|BC062228.1| Rattus norvegicus ribosomal protein L31, mRNA (cD... 42 1.8
330emb|X04809.1|RNRPL31R Rat mRNA for ribosomal protein L31 42 1.8
331gb|BC092139.1| Mus musculus ribosomal protein L31, mRNA (cDNA cl... 42 1.8
332gb|AC111034.11| Mus musculus chromosome 8, clone RP23-202K1, com... 40 6.9
333ref|XM_527743.1| PREDICTED: Pan troglodytes LOC472368 (LOC472368... 40 6.9
334gb|AC158958.4| Mus musculus chromosome 1, clone RP23-31E12, comp... 40 6.9
335ref|XM_363007.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.9
336gb|AC160517.3| Mus musculus chromosome 8, clone RP23-279A11, com... 40 6.9
337gb|AC126029.3| Mus musculus BAC clone RP23-389K5 from chromosome... 40 6.9
338gb|AC099062.2| Homo sapiens chromosome 1 clone RP5-1043L3, compl... 40 6.9
339emb|CR691237.2|CNS0FWB5 Tetraodon nigroviridis full-length cDNA 40 6.9
340gb|AC019210.7| Homo sapiens BAC clone RP11-449G3 from 7, complet... 40 6.9
341gb|AC011228.9| Homo sapiens BAC clone GS1-18A18 from 7, complete... 40 6.9
342gb|AC140953.1| Pan troglodytes BAC clone RP43-37K18 from 7, comp... 40 6.9
343gb|AC087530.8| Homo sapiens chromosome 17, clone RP11-313F15, co... 40 6.9
344dbj|AB208646.1| Pichia jadinii RPL31 gene for ribosomal protein ... 40 6.9
345gb|AC114486.2| Homo sapiens chromosome 1 clone RP11-371A23, comp... 40 6.9
346gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold 40 6.9
347gb|AC105026.4| Homo sapiens chromosome 8, clone CTD-2152D24, com... 40 6.9
348gb|AC104306.2| Homo sapiens chromosome 3 clone RP11-524O15, comp... 40 6.9
349gb|AC092392.2| Homo sapiens chromosome 1 clone RP4-544H6, comple... 40 6.9
350ref|XM_692105.1| PREDICTED: Danio rerio similar to nuclear local... 40 6.9
351gb|AC133012.5| Homo sapiens chromosome 17, clone RP11-582A10, co... 40 6.9
352gb|AC018676.5|AC018676 Homo sapiens BAC clone RP11-255L13 from 8... 40 6.9
353gb|AC154537.3| Mus musculus BAC clone RP23-451F20 from chromosom... 40 6.9
354gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, co... 40 6.9
355gb|AC005840.2|AC005840 Homo sapiens complete sequence of a PAC c... 40 6.9
356gb|AC092929.5| Homo sapiens 3 BAC RP11-569L16 (Roswell Park Canc... 40 6.9
357gb|AC133638.7| Homo sapiens chromosome 17, clone CTD-2125J20, co... 40 6.9
358ref|XM_575849.1| PREDICTED: Rattus norvegicus similar to high-mo... 40 6.9
359gb|AC073942.2|F16L1 Sequence of BAC F16L1 from Arabidopsis thali... 40 6.9
360emb|AL928896.6| Mouse DNA sequence from clone RP23-42H18 on chro... 40 6.9

>gb|AY109331.1| Zea mays CL253_2 mRNA sequence
          Length = 2256

 Score =  375 bits (189), Expect = e-100
 Identities = 332/380 (87%)
 Strand = Plus / Plus

                                                                       
Query: 135 agggtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctggggg 194
           |||| ||| ||||||||||| |||||||| || ||||||||||| ||||| ||| | |||
Sbjct: 212 agggcttaatcctcatcctcaacaaccttagttcccaaacctttgagaccctccggtggg 271

                                                                       
Query: 195 acttcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctc 254
           |  ||||||||||| ||||||||||| || |||||||| ||||| ||||| |||||||  
Sbjct: 272 atctcagcaactgtgaccagagagtagagttcctccttggcgtcttcctcatcgttccgg 331

                                                                       
Query: 255 ttgcgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatg 314
           ||||||||||| ||||||||||| | |||||| ||||| | ||| || ||||||||||||
Sbjct: 332 ttgcgggcaattctgacacggacacgcctcggcacactgcggataccactgctccagatg 391

                                                                       
Query: 315 tgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaac 374
           |||||||||||||| ||||| || ||||||||| | || |||||||||||||| || |||
Sbjct: 392 tgcttgttgagcttcacgtcaatccggacatcagtagtacccatggccttctgagcgaac 451

                                                                       
Query: 375 ttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggaggcgc 434
           |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 452 ttcctgatctccttgatggcatttggtgccttcttcttaaaggtgcatccgtggaggcgt 511

                                                                       
Query: 435 ttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttgcgagggccgggggcg 494
           |||||||||||||  ||||||||||| ||||||||||| |||||||||| ||||| | | 
Sbjct: 512 ttgtggaggttgatagtgtactcgcgtgtcaccacctcatccttgcgagtgccggcgcct 571

                               
Query: 495 cgcttnttctccgacatctc 514
           ||||| ||||||| ||||||
Sbjct: 572 cgcttcttctccgccatctc 591



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 47  cagtagataacaataagctaaagcaa 72
           ||||||||||||||||||| ||||||
Sbjct: 159 cagtagataacaataagctcaagcaa 184



to top

>ref|XM_467485.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 372

 Score =  351 bits (177), Expect = 1e-93
 Identities = 320/368 (86%)
 Strand = Plus / Minus

                                                                       
Query: 144 tcctcatcctccacaaccttggtacccaaacctttaagaccttcctgggggacttcagca 203
           ||||||||||| ||||||||||| |||||||| || ||||| ||    ||||  ||||||
Sbjct: 368 tcctcatcctcaacaaccttggttcccaaacccttgagaccctctgcagggatctcagca 309

                                                                       
Query: 204 actgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggca 263
           ||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| |  
Sbjct: 308 actgtgaccagagagtagagctcctccttggcgtcctcctcatcgtttctcttgcgagag 249

                                                                       
Query: 264 atcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttg 323
           || || |||||||||| ||| |||||||||| ||| ||  || ||||||||  |||||| 
Sbjct: 248 attctaacacggactcgccttgggacactccggataccattggtccagatggccttgtta 189

                                                                       
Query: 324 agcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatc 383
           ||||| ||||||||||| | |||  |||| |||||||||||||| |||||||||||||||
Sbjct: 188 agcttcacgtcgatgcgtatatccgttgtgcccatggccttctgtgcaaacttcctgatc 129

                                                                       
Query: 384 tccttgatggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggagg 443
           |||||||||||||| || ||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 128 tccttgatggcattcggcgccttcttcttgaaggtgcatccgtggagacgcttgtggagg 69

                                                                       
Query: 444 ttgacggtgtactcgcgggtcaccacctcgtccttgcgagggccgggggcgcgcttnttc 503
           |||| ||||||||||||||||||||||||||||||||| | ||||| | ||||||| |||
Sbjct: 68  ttgatggtgtactcgcgggtcaccacctcgtccttgcgggtgccggcgccgcgcttcttc 9

                   
Query: 504 tccgacat 511
           ||||||||
Sbjct: 8   tccgacat 1



to top

>dbj|AK120884.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023028N24, full
           insert sequence
          Length = 811

 Score =  313 bits (158), Expect = 3e-82
 Identities = 257/290 (88%)
 Strand = Plus / Minus

                                                                       
Query: 189 tgggggacttcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcg 248
           ||||| || |||||||| || ||||||||||| ||||||||||| || ||||||||||||
Sbjct: 417 tggggaacctcagcaacagtgaccagagagtagagctcctccttcgcatcctcctcgtcg 358

                                                                       
Query: 249 ttcctcttgcgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctc 308
           |||||| |||||||||| ||||||||||| | ||| || || |||| ||| |||||||||
Sbjct: 357 ttcctcctgcgggcaattctgacacggacacgccttggaacgctccggataccgctgctc 298

                                                                       
Query: 309 cagatgtgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgg 368
           ||||||||||||| |||||| || || |  | ||| ||| | || |||||||||||||| 
Sbjct: 297 cagatgtgcttgtcgagcttcacatcaacactgacgtcaatggtgcccatggccttctgt 238

                                                                       
Query: 369 gcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtgg 428
           ||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||
Sbjct: 237 gcaaacttcctgatctccttgatggcattaggagccttcttcttgaaggtgcatccgtgg 178

                                                             
Query: 429 aggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
           ||||||||||||||||||| ||||||||||||||| ||||||||||||||
Sbjct: 177 aggcgcttgtggaggttgatggtgtactcgcgggtgaccacctcgtcctt 128



to top

>gb|BT017600.1| Zea mays clone EL01N0431G10.c mRNA sequence
          Length = 533

 Score =  280 bits (141), Expect = 4e-72
 Identities = 282/329 (85%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcctccacaaccttggtacccaaacctttaagaccttcctgggggacttcagcaactgtc 209
           |||||||||||||||||||||||||| || || |||||  ||||||  |||||||| || 
Sbjct: 360 tcctccacaaccttggtacccaaacccttcaggccttctggggggatctcagcaacggta 301

                                                                       
Query: 210 accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
           || |||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||||||
Sbjct: 300 acaagagagtaaagctcttccttggcgtcttcctcatcgttcctcttgcgtgcgatcctg 241

                                                                       
Query: 270 acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
           |||||||| | |||||| ||||||| ||| || ||||||||||||||||||||||| || 
Sbjct: 240 acacggacacgcctcggcacactccggataccactgctccagatgtgcttgttgagtttc 181

                                                                       
Query: 330 acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
           || || || | ||  |||   || ||||| |||||||| |||||||||||||| ||||||
Sbjct: 180 acatcaatcctgatgtcaggggtgcccattgccttctgtgcaaacttcctgatttccttg 121

                                                                       
Query: 390 atggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacg 449
           || ||||| || || |||||||||||||  |||||||||||||||||||||||| ||| |
Sbjct: 120 atagcattgggggctttcttcttgaaggggcatccgtggaggcgcttgtggagggtgatg 61

                                        
Query: 450 gtgtactcgcgggtcaccacctcgtcctt 478
           |||||||||||||| ||||||||||||||
Sbjct: 60  gtgtactcgcgggtaaccacctcgtcctt 32



to top

>gb|AY103830.2| Zea mays PCO109717 mRNA sequence
          Length = 705

 Score =  280 bits (141), Expect = 4e-72
 Identities = 282/329 (85%)
 Strand = Plus / Minus

                                                                       
Query: 150 tcctccacaaccttggtacccaaacctttaagaccttcctgggggacttcagcaactgtc 209
           |||||||||||||||||||||| ||| || || |||||  ||||||  |||||||| || 
Sbjct: 411 tcctccacaaccttggtacccagacccttcaggccttctggggggatctcagcaacggta 352

                                                                       
Query: 210 accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
           || |||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||||||
Sbjct: 351 acaagagagtaaagctcttccttggcgtcttcctcatcgttcctcttgcgtgcgatcctg 292

                                                                       
Query: 270 acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
           |||||||| | |||||| ||||||| ||| || ||||||||||||||||||||||| || 
Sbjct: 291 acacggacacgcctcggcacactccggataccactgctccagatgtgcttgttgagtttc 232

                                                                       
Query: 330 acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
           || || || | ||  ||| | || ||||| |||||||| |||||||||||||| ||||| 
Sbjct: 231 acatcaatcctgatgtcagtggtgcccattgccttctgtgcaaacttcctgatttccttt 172

                                                                       
Query: 390 atggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacg 449
           || ||||| || || |||||||||||||| |||||||||||||||||||| ||||||| |
Sbjct: 171 atagcattgggggctttcttcttgaaggtgcatccgtggaggcgcttgtgtaggttgatg 112

                                        
Query: 450 gtgtactcgcgggtcaccacctcgtcctt 478
           |||||||||||||| ||||||||||||||
Sbjct: 111 gtgtactcgcgggtaaccacctcgtcctt 83



to top

>gb|AY754699.1| Zea mays putative 60S ribosomal protein L31 mRNA, complete cds
          Length = 595

 Score =  268 bits (135), Expect = 2e-68
 Identities = 231/263 (87%)
 Strand = Plus / Minus

                                                                       
Query: 216 gagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctgacacgg 275
           ||||| ||||||||||| || |||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 308 gagtagagctcctccttggcatcctcctcgtcgttcctcttgcgggcgatcctcacacga 249

                                                                       
Query: 276 actctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagcttaacgtcg 335
           || |||| ||| || |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 248 accctccgcggcacgctcctgatcccgctgctccagatgtgcttgttgagcttcacatcg 189

                                                                       
Query: 336 atgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           || |  |  ||  | || |||||||||||||| |||||||||||||||||||| || |||
Sbjct: 188 atcctaatgtctgtggtgcccatggccttctgcgcaaacttcctgatctcctttatagca 129

                                                                       
Query: 396 tttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtac 455
           || || || |||||||||||||| |||||||||||||||||||| ||||||| |||||||
Sbjct: 128 ttgggggctttcttcttgaaggtgcatccgtggaggcgcttgtgtaggttgatggtgtac 69

                                  
Query: 456 tcgcgggtcaccacctcgtcctt 478
           |||||||| ||||||||||||||
Sbjct: 68  tcgcgggtaaccacctcgtcctt 46



to top

>gb|AY109515.1| Zea mays CL253_10 mRNA sequence
          Length = 654

 Score =  260 bits (131), Expect = 4e-66
 Identities = 230/263 (87%)
 Strand = Plus / Plus

                                                                       
Query: 216 gagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctgacacgg 275
           ||||| || |||||||| || |||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 293 gagtagagttcctccttggcatcctcctcatcgttcctcttgcgggcgatcctcacacga 352

                                                                       
Query: 276 actctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagcttaacgtcg 335
           || |||| ||| || |||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 353 accctccgcggcacgctcctgatcccgctgctccagatgtgcttgttgagcttcacatcg 412

                                                                       
Query: 336 atgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           || | ||| ||  | || |||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 413 atcctgacgtccgtggtgcccatggccttctgtgcaaacttcctgatctccttgatggcg 472

                                                                       
Query: 396 tttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtac 455
           || ||||||||||||||||| || || ||||||||||||||||||||||||| |||||||
Sbjct: 473 ttgggtgccttcttcttgaatgtgcagccgtggaggcgcttgtggaggttgatggtgtac 532

                                  
Query: 456 tcgcgggtcaccacctcgtcctt 478
           || | ||| |||||||| |||||
Sbjct: 533 tccctggtgaccacctcctcctt 555



to top

>ref|XM_483237.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 369

 Score =  256 bits (129), Expect = 6e-65
 Identities = 234/269 (86%)
 Strand = Plus / Minus

                                                                       
Query: 210 accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
           ||||||||||| ||||| ||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 299 accagagagtagagctcttccttggcatcctcctcgtcattcctcttgcgggcgatcctc 240

                                                                       
Query: 270 acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
           ||||| || |||| ||| ||||||||||| || |||||||||||||||||||||||||| 
Sbjct: 239 acacgaaccctccgcggcacactcctgatcccactgctccagatgtgcttgttgagcttc 180

                                                                       
Query: 330 acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
           || ||||  | ||||||  | || ||||| |||||||| ||||||||||||||||| |||
Sbjct: 179 acatcgaccctgacatctgtagtgcccatagccttctgcgcaaacttcctgatctctttg 120

                                                                       
Query: 390 atggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacg 449
           |||||||| || |||||||||||||| ||||| | ||||||||||||||||||||||| |
Sbjct: 119 atggcattgggcgccttcttcttgaatgtacagctgtggaggcgcttgtggaggttgatg 60

                                        
Query: 450 gtgtactcgcgggtcaccacctcgtcctt 478
           |||||||| |  ||||||||||| |||||
Sbjct: 59  gtgtactccctcgtcaccacctcctcctt 31



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  232 bits (117), Expect = 9e-58
 Identities = 240/281 (85%)
 Strand = Plus / Plus

                                                                            
Query: 138      gtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctgggggact 197
                ||||| ||||||||||| ||||||||||| |||||||| || ||||| ||    ||||  
Sbjct: 29814197 gtttactcctcatcctcaacaaccttggttcccaaacccttgagaccctctgcagggatc 29814256

                                                                            
Query: 198      tcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttg 257
                ||||||||||| ||||||||||| ||||||||||| ||||||||||| ||||| ||||||
Sbjct: 29814257 tcagcaactgtgaccagagagtagagctcctccttggcgtcctcctcatcgtttctcttg 29814316

                                                                            
Query: 258      cgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgc 317
                || |  || || |||||||||| ||| |||||||||| ||| ||  || ||||||||  |
Sbjct: 29814317 cgagagattctaacacggactcgccttgggacactccggataccattggtccagatggcc 29814376

                                                                            
Query: 318      ttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttc 377
                ||||| ||||| ||||||||||| | |||  |||| |||||||||||||| |||||||||
Sbjct: 29814377 ttgttaagcttcacgtcgatgcgtatatccgttgtgcccatggccttctgtgcaaacttc 29814436

                                                         
Query: 378      ctgatctccttgatggcatttggtgccttcttcttgaaggt 418
                |||||||||||||||||||| || |||||||||||||||||
Sbjct: 29814437 ctgatctccttgatggcattcggcgccttcttcttgaaggt 29814477



 Score =  133 bits (67), Expect = 6e-28
 Identities = 87/94 (92%)
 Strand = Plus / Plus

                                                                            
Query: 420      catccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttg 479
                ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 29815558 catccgtggagacgcttgtggaggttgatggtgtactcgcgggtcaccacctcgtccttg 29815617

                                                  
Query: 480      cgagggccgggggcgcgcttnttctccgacatct 513
                || | ||||| | ||||||| |||||||||||||
Sbjct: 29815618 cgggtgccggcgccgcgcttcttctccgacatct 29815651



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                         
Query: 39       atcatgaacagtagataacaataagctaaagcaagacttcccaacatgctctcagca 95
                ||||| ||||||||||||||| | ||||||||||||||||| ||  |||||||||||
Sbjct: 29814082 atcatcaacagtagataacaaaacgctaaagcaagacttccaaatttgctctcagca 29814138



to top

>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ2056_H01
          Length = 123428

 Score =  232 bits (117), Expect = 9e-58
 Identities = 240/281 (85%)
 Strand = Plus / Plus

                                                                         
Query: 138   gtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctgggggact 197
             ||||| ||||||||||| ||||||||||| |||||||| || ||||| ||    ||||  
Sbjct: 70542 gtttactcctcatcctcaacaaccttggttcccaaacccttgagaccctctgcagggatc 70601

                                                                         
Query: 198   tcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttg 257
             ||||||||||| ||||||||||| ||||||||||| ||||||||||| ||||| ||||||
Sbjct: 70602 tcagcaactgtgaccagagagtagagctcctccttggcgtcctcctcatcgtttctcttg 70661

                                                                         
Query: 258   cgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgc 317
             || |  || || |||||||||| ||| |||||||||| ||| ||  || ||||||||  |
Sbjct: 70662 cgagagattctaacacggactcgccttgggacactccggataccattggtccagatggcc 70721

                                                                         
Query: 318   ttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttc 377
             ||||| ||||| ||||||||||| | |||  |||| |||||||||||||| |||||||||
Sbjct: 70722 ttgttaagcttcacgtcgatgcgtatatccgttgtgcccatggccttctgtgcaaacttc 70781

                                                      
Query: 378   ctgatctccttgatggcatttggtgccttcttcttgaaggt 418
             |||||||||||||||||||| || |||||||||||||||||
Sbjct: 70782 ctgatctccttgatggcattcggcgccttcttcttgaaggt 70822



 Score =  133 bits (67), Expect = 6e-28
 Identities = 87/94 (92%)
 Strand = Plus / Plus

                                                                         
Query: 420   catccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttg 479
             ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 71903 catccgtggagacgcttgtggaggttgatggtgtactcgcgggtcaccacctcgtccttg 71962

                                               
Query: 480   cgagggccgggggcgcgcttnttctccgacatct 513
             || | ||||| | ||||||| |||||||||||||
Sbjct: 71963 cgggtgccggcgccgcgcttcttctccgacatct 71996



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                      
Query: 39    atcatgaacagtagataacaataagctaaagcaagacttcccaacatgctctcagca 95
             ||||| ||||||||||||||| | ||||||||||||||||| ||  |||||||||||
Sbjct: 70427 atcatcaacagtagataacaaaacgctaaagcaagacttccaaatttgctctcagca 70483



to top

>dbj|AK105284.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-E05, full
            insert sequence
          Length = 2274

 Score =  232 bits (117), Expect = 9e-58
 Identities = 240/281 (85%)
 Strand = Plus / Minus

                                                                        
Query: 138  gtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctgggggact 197
            ||||| ||||||||||| ||||||||||| |||||||| || ||||| ||    ||||  
Sbjct: 1535 gtttactcctcatcctcaacaaccttggttcccaaacccttgagaccctctgcagggatc 1476

                                                                        
Query: 198  tcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttg 257
            ||||||||||| ||||||||||| ||||||||||| ||||||||||| ||||| ||||||
Sbjct: 1475 tcagcaactgtgaccagagagtagagctcctccttggcgtcctcctcatcgtttctcttg 1416

                                                                        
Query: 258  cgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgc 317
            || |  || || |||||||||| ||| |||||||||| ||| ||  || ||||||||  |
Sbjct: 1415 cgagagattctaacacggactcgccttgggacactccggataccattggtccagatggcc 1356

                                                                        
Query: 318  ttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttc 377
            ||||| ||||| ||||||||||| | |||  |||| |||||||||||||| |||||||||
Sbjct: 1355 ttgttaagcttcacgtcgatgcgtatatccgttgtgcccatggccttctgtgcaaacttc 1296

                                                     
Query: 378  ctgatctccttgatggcatttggtgccttcttcttgaaggt 418
            |||||||||||||||||||| || |||||||||||||||||
Sbjct: 1295 ctgatctccttgatggcattcggcgccttcttcttgaaggt 1255



 Score =  133 bits (67), Expect = 6e-28
 Identities = 87/94 (92%)
 Strand = Plus / Minus

                                                                       
Query: 420 catccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttg 479
           ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 174 catccgtggagacgcttgtggaggttgatggtgtactcgcgggtcaccacctcgtccttg 115

                                             
Query: 480 cgagggccgggggcgcgcttnttctccgacatct 513
           || | ||||| | ||||||| |||||||||||||
Sbjct: 114 cgggtgccggcgccgcgcttcttctccgacatct 81



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                     
Query: 39   atcatgaacagtagataacaataagctaaagcaagacttcccaacatgctctcagca 95
            ||||| ||||||||||||||| | ||||||||||||||||| ||  |||||||||||
Sbjct: 1650 atcatcaacagtagataacaaaacgctaaagcaagacttccaaatttgctctcagca 1594



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  226 bits (114), Expect = 6e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                            
Query: 189      tgggggacttcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcg 248
                ||||| || |||||||| || ||||||||||| ||||||||||| || ||||||||||||
Sbjct: 12257744 tggggaacctcagcaacagtgaccagagagtagagctcctccttcgcatcctcctcgtcg 12257685

                                                                            
Query: 249      ttcctcttgcgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctc 308
                |||||| |||||||||| ||||||||||| | ||| || || |||| ||| |||||||||
Sbjct: 12257684 ttcctcctgcgggcaattctgacacggacacgccttggaacgctccggataccgctgctc 12257625

                                                                            
Query: 309      cagatgtgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgg 368
                |||||||||||||||||||| || || |  | ||| ||| | || |||||||||||||| 
Sbjct: 12257624 cagatgtgcttgttgagcttcacatcaaccctgacgtcaatggtgcccatggccttctgt 12257565

                                                                  
Query: 369      gcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggt 418
                ||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 12257564 gcaaacttcctgatctccttgatggcattaggagccttcttcttgaaggt 12257515



 Score =  101 bits (51), Expect = 2e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                           
Query: 420      catccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
                |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||
Sbjct: 12255512 catccgtggaggcgcttgtggaggttgatggtgtactcgcgggtgaccacctcgtcctt 12255454



to top

>dbj|AP003543.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0592B08
          Length = 131096

 Score =  226 bits (114), Expect = 6e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                         
Query: 189   tgggggacttcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcg 248
             ||||| || |||||||| || ||||||||||| ||||||||||| || ||||||||||||
Sbjct: 94766 tggggaacctcagcaacagtgaccagagagtagagctcctccttcgcatcctcctcgtcg 94707

                                                                         
Query: 249   ttcctcttgcgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctc 308
             |||||| |||||||||| ||||||||||| | ||| || || |||| ||| |||||||||
Sbjct: 94706 ttcctcctgcgggcaattctgacacggacacgccttggaacgctccggataccgctgctc 94647

                                                                         
Query: 309   cagatgtgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgg 368
             |||||||||||||||||||| || || |  | ||| ||| | || |||||||||||||| 
Sbjct: 94646 cagatgtgcttgttgagcttcacatcaaccctgacgtcaatggtgcccatggccttctgt 94587

                                                               
Query: 369   gcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggt 418
             ||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 94586 gcaaacttcctgatctccttgatggcattaggagccttcttcttgaaggt 94537



 Score =  101 bits (51), Expect = 2e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                        
Query: 420   catccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
             |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||
Sbjct: 92534 catccgtggaggcgcttgtggaggttgatggtgtactcgcgggtgaccacctcgtcctt 92476



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  196 bits (99), Expect = 5e-47
 Identities = 183/211 (86%)
 Strand = Plus / Plus

                                                                            
Query: 210      accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
                ||||||||||| ||||| ||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 24986033 accagagagtagagctcttccttggcatcctcctcgtcattcctcttgcgggcgatcctc 24986092

                                                                            
Query: 270      acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
                ||||| || |||| ||| ||||||||||| || |||||||||||||||||||||||||| 
Sbjct: 24986093 acacgaaccctccgcggcacactcctgatcccactgctccagatgtgcttgttgagcttc 24986152

                                                                            
Query: 330      acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
                || ||||  | ||||||  | || ||||| |||||||| ||||||||||||||||| |||
Sbjct: 24986153 acatcgaccctgacatctgtagtgcccatagccttctgcgcaaacttcctgatctctttg 24986212

                                               
Query: 390      atggcatttggtgccttcttcttgaaggtac 420
                |||||||| || |||||||||||||| ||||
Sbjct: 24986213 atggcattgggcgccttcttcttgaatgtac 24986243



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 425      gtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
                ||||||||||||||||||||||| ||||||||| |  ||||||||||| |||||
Sbjct: 24987114 gtggaggcgcttgtggaggttgatggtgtactccctcgtcaccacctcctcctt 24987167



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                   
Query: 423      ccgtggaggcgcttgtggaggttgacggtgtactc 457
                ||||||||||||||||||||||||| |||||||||
Sbjct: 24991859 ccgtggaggcgcttgtggaggttgatggtgtactc 24991893



to top

>dbj|AP005245.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0025J22
          Length = 175355

 Score =  196 bits (99), Expect = 5e-47
 Identities = 183/211 (86%)
 Strand = Plus / Plus

                                                                         
Query: 210   accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
             ||||||||||| ||||| ||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 42149 accagagagtagagctcttccttggcatcctcctcgtcattcctcttgcgggcgatcctc 42208

                                                                         
Query: 270   acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
             ||||| || |||| ||| ||||||||||| || |||||||||||||||||||||||||| 
Sbjct: 42209 acacgaaccctccgcggcacactcctgatcccactgctccagatgtgcttgttgagcttc 42268

                                                                         
Query: 330   acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
             || ||||  | ||||||  | || ||||| |||||||| ||||||||||||||||| |||
Sbjct: 42269 acatcgaccctgacatctgtagtgcccatagccttctgcgcaaacttcctgatctctttg 42328

                                            
Query: 390   atggcatttggtgccttcttcttgaaggtac 420
             |||||||| || |||||||||||||| ||||
Sbjct: 42329 atggcattgggcgccttcttcttgaatgtac 42359



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                   
Query: 425   gtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
             ||||||||||||||||||||||| ||||||||| |  ||||||||||| |||||
Sbjct: 43230 gtggaggcgcttgtggaggttgatggtgtactccctcgtcaccacctcctcctt 43283



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 423   ccgtggaggcgcttgtggaggttgacggtgtactc 457
             ||||||||||||||||||||||||| |||||||||
Sbjct: 47975 ccgtggaggcgcttgtggaggttgatggtgtactc 48009



to top

>dbj|AP003883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1134_H03
          Length = 135914

 Score =  196 bits (99), Expect = 5e-47
 Identities = 183/211 (86%)
 Strand = Plus / Plus

                                                                         
Query: 210   accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
             ||||||||||| ||||| ||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 87748 accagagagtagagctcttccttggcatcctcctcgtcattcctcttgcgggcgatcctc 87807

                                                                         
Query: 270   acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctta 329
             ||||| || |||| ||| ||||||||||| || |||||||||||||||||||||||||| 
Sbjct: 87808 acacgaaccctccgcggcacactcctgatcccactgctccagatgtgcttgttgagcttc 87867

                                                                         
Query: 330   acgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttg 389
             || ||||  | ||||||  | || ||||| |||||||| ||||||||||||||||| |||
Sbjct: 87868 acatcgaccctgacatctgtagtgcccatagccttctgcgcaaacttcctgatctctttg 87927

                                            
Query: 390   atggcatttggtgccttcttcttgaaggtac 420
             |||||||| || |||||||||||||| ||||
Sbjct: 87928 atggcattgggcgccttcttcttgaatgtac 87958



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                   
Query: 425   gtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
             ||||||||||||||||||||||| ||||||||| |  ||||||||||| |||||
Sbjct: 88829 gtggaggcgcttgtggaggttgatggtgtactccctcgtcaccacctcctcctt 88882



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 423   ccgtggaggcgcttgtggaggttgacggtgtactc 457
             ||||||||||||||||||||||||| |||||||||
Sbjct: 93574 ccgtggaggcgcttgtggaggttgatggtgtactc 93608



to top

>gb|AF457941.1| Zea mays clone cho1c.pk002.n14, mRNA sequence
          Length = 387

 Score =  184 bits (93), Expect = 2e-43
 Identities = 198/233 (84%)
 Strand = Plus / Minus

                                                                       
Query: 135 agggtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctggggg 194
           |||| ||| ||||||||||| |||||||| || ||||||||||| ||||| ||| | |||
Sbjct: 238 agggcttaatcctcatcctcaacaaccttagttcccaaacctttgagaccctccggtggg 179

                                                                       
Query: 195 acttcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctc 254
           |  ||||| ||||| ||||| ||||| || |||||||| ||||| ||||| |||||||  
Sbjct: 178 atctcagctactgtgaccagggagtagagttcctccttggcgtcttcctcatcgttccgg 119

                                                                       
Query: 255 ttgcgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatg 314
           ||||||||||| ||||||||||| | |||||| ||||| | ||| || ||||||||||||
Sbjct: 118 ttgcgggcaattctgacacggacacgcctcggcacactgcggataccactgctccagatg 59

                                                                
Query: 315 tgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctg 367
           |||||||||||||| ||||| || ||||||||| | || ||||||||||||||
Sbjct: 58  tgcttgttgagcttcacgtcaatccggacatcagtagtacccatggccttctg 6



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 47  cagtagataacaataagctaaagcaa 72
           ||||||||||||||||||| ||||||
Sbjct: 291 cagtagataacaataagctgaagcaa 266



to top

>gb|AF237624.1|AF237624 Perilla frutescens 80S ribosomal protein L31 mRNA, complete cds
          Length = 535

 Score =  149 bits (75), Expect = 1e-32
 Identities = 180/215 (83%)
 Strand = Plus / Minus

                                                                       
Query: 243 tcgtcgttcctcttgcgggcaatcctgacacggactctcctcgggacactcctgatgccg 302
           ||||| || |||||||| ||||| |  ||||||| ||| || |||||||||||||| || 
Sbjct: 315 tcgtcatttctcttgcgtgcaatgcgaacacggattcttcttgggacactcctgatccca 256

                                                                       
Query: 303 ctgctccagatgtgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggcc 362
           | |||||| ||||| ||||| | |||||| || |  |  |||||| | || |||||||||
Sbjct: 255 cggctccatatgtgtttgttcaacttaacatcaactcttacatcagtggtgcccatggcc 196

                                                                       
Query: 363 ttctgggcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacat 422
           ||||||||||||||||  || ||||||||||| || ||||||||||||||||| ||||||
Sbjct: 195 ttctgggcaaacttccgaatttccttgatggctttcggtgccttcttcttgaaagtacat 136

                                              
Query: 423 ccgtggaggcgcttgtggaggttgacggtgtactc 457
           ||||||||||| ||||| || |||| |||||||||
Sbjct: 135 ccgtggaggcgtttgtgcagattgatggtgtactc 101



to top

>gb|BT014565.1| Lycopersicon esculentum clone 134019R, mRNA sequence
          Length = 643

 Score =  129 bits (65), Expect = 1e-26
 Identities = 200/245 (81%)
 Strand = Plus / Minus

                                                                       
Query: 213 agagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctgaca 272
           |||||||| ||||| ||||| |||||||| ||||| ||||||||||| ||||| |  || 
Sbjct: 393 agagagtagagctcttcctttgcgtcctcatcgtcattcctcttgcgagcaatacgaact 334

                                                                       
Query: 273 cggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagcttaacg 332
           | ||  |  || || ||||| | |||||| ||||||||||| |||||||||||||| |||
Sbjct: 333 ctgatacgtcttggaacacttcggatgcctctgctccagatctgcttgttgagcttcacg 274

                                                                       
Query: 333 tcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttgatg 392
           || |  | |||||| || ||||||||||| ||||| |||||||| | |||||||||||||
Sbjct: 273 tccactctgacatccttcgttcccatggctttctgtgcaaactttcggatctccttgatg 214

                                                                       
Query: 393 gcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtg 452
           ||  | || |||||||||||||| || ||||| || |  ||||||||||| || | ||||
Sbjct: 213 gctgtcggggccttcttcttgaatgtgcatccatgcaaacgcttgtggagattaatggtg 154

                
Query: 453 tactc 457
           |||||
Sbjct: 153 tactc 149



to top

>dbj|D29722.1|RICYK35 Oryza sativa mRNA, partial homologous to ribosomal protein L31 gene
          Length = 325

 Score =  125 bits (63), Expect = 2e-25
 Identities = 105/119 (88%)
 Strand = Plus / Minus

                                                                       
Query: 210 accagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctg 269
           ||||||||||| ||||| ||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 132 accagagagtagagctcttccttggcatcctcctcgtcattcctcttgcgggcgatcctc 73

                                                                      
Query: 270 acacggactctcctcgggacactcctgatgccgctgctccagatgtgcttgttgagctt 328
           ||||| || || | ||| ||||||||||| || ||||||||||||||||||||||||||
Sbjct: 72  acacgaacccttcgcggcacactcctgatcccactgctccagatgtgcttgttgagctt 14



to top

>dbj|AB043976.1| Panax ginseng mRNA for ribosomal protein L31, complete cds
          Length = 554

 Score =  121 bits (61), Expect = 2e-24
 Identities = 145/173 (83%)
 Strand = Plus / Minus

                                                                       
Query: 306 ctccagatgtgcttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttc 365
           |||||||| |||||||| ||||| || || |  | |||||| ||||||||||| ||||||
Sbjct: 270 ctccagatttgcttgtttagcttgacatccactctgacatcttttgttcccattgccttc 211

                                                                       
Query: 366 tgggcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccg 425
           || ||||| |||||||||||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 210 tgtgcaaatttcctgatctcctttatagcattaggagccttcttcttgaaggtgcagcca 151

                                                                
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
           || ||||||||||| ||||||| ||| ||||| |  |||||||| || |||||
Sbjct: 150 tgaaggcgcttgtgcaggttgatggtatactccctcgtcaccacttcttcctt 98



to top

>ref|NM_127532.2| Arabidopsis thaliana structural constituent of ribosome AT2G19740
           mRNA, complete cds
          Length = 593

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 212 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 153

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 152 ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 93

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 92  acctcttcctt 82



to top

>gb|AY072459.1| Arabidopsis thaliana 60S ribosomal protein L31 (At2g19740;
           F6F22.23) mRNA, complete cds
          Length = 425

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 152 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 93

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 92  ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 33

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 32  acctcttcctt 22



to top

>gb|AY061893.1| Arabidopsis thaliana At2g19740/F6F22.23 mRNA, complete cds
          Length = 360

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 152 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 93

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 92  ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 33

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 32  acctcttcctt 22



to top

>gb|AY054616.1| Arabidopsis thaliana 60S ribosomal protein L31 (At2g19740;
           F6F22.23) mRNA, complete cds
          Length = 562

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 210 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 151

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 150 ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 91

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 90  acctcttcctt 80



to top

>gb|AY052313.1| Arabidopsis thaliana At2g19740/F6F22.23 mRNA, complete cds
          Length = 593

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 212 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 153

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 152 ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 93

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 92  acctcttcctt 82



to top

>emb|BX821878.1|CNS0A8AF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL81ZB02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 525

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 348 tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
           ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 185 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 126

                                                                       
Query: 408 ttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcacc 467
           ||||||||||| || |  ||||||||| ||||||| ||||  |||||||| | |||||| 
Sbjct: 125 ttcttgaaggtgcagctatggaggcgcctgtggagattgatagtgtactccctggtcacg 66

                      
Query: 468 acctcgtcctt 478
           ||||| |||||
Sbjct: 65  acctcttcctt 55



to top

>ref|NM_118756.3| Arabidopsis thaliana structural constituent of ribosome AT4G26230
           mRNA, complete cds
          Length = 671

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
           ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 231 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 172

                                                                       
Query: 402 gccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgg 461
           ||||||||||| |||||||| |  || |||||  |||| ||||||| ||||||||| | |
Sbjct: 171 gccttcttcttaaaggtacagctatgaaggcgtctgtgaaggttgatggtgtactctctg 112

                      
Query: 462 gtcaccacctc 472
           |||||||||||
Sbjct: 111 gtcaccacctc 101



to top

>emb|BX829225.1|CNS0A2K3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL82ZG07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 663

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
           ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 223 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 164

                                                                       
Query: 402 gccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgg 461
           ||||||||||| |||||||| |  || |||||  |||| ||||||| ||||||||| | |
Sbjct: 163 gccttcttcttaaaggtacagctatgaaggcgtctgtgaaggttgatggtgtactctctg 104

                      
Query: 462 gtcaccacctc 472
           |||||||||||
Sbjct: 103 gtcaccacctc 93



to top

>gb|BT005841.1| Arabidopsis thaliana At4g26230 gene, complete cds
          Length = 360

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
           ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 158 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 99

                                                                       
Query: 402 gccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgg 461
           ||||||||||| |||||||| |  || |||||  |||| ||||||| ||||||||| | |
Sbjct: 98  gccttcttcttaaaggtacagctatgaaggcgtctgtgaaggttgatggtgtactctctg 39

                      
Query: 462 gtcaccacctc 472
           |||||||||||
Sbjct: 38  gtcaccacctc 28



to top

>gb|AY085228.1| Arabidopsis thaliana clone 14013 mRNA, complete sequence
          Length = 537

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 342 acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
           ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 230 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 171

                                                                       
Query: 402 gccttcttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgg 461
           ||||||||||| |||||||| |  || |||||  |||| ||||||| ||||||||| | |
Sbjct: 170 gccttcttcttaaaggtacagctatgaaggcgtctgtgaaggttgatggtgtactctctg 111

                      
Query: 462 gtcaccacctc 472
           |||||||||||
Sbjct: 110 gtcaccacctc 100



to top

>emb|BX827089.1|CNS0A3AD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB93ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 515

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 363 ttctgggcaaacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacat 422
           ||||| ||||||||||| ||||||||||| || ||||| ||||||||||| |||||||| 
Sbjct: 164 ttctgagcaaacttccttatctccttgatcgcctttggagccttcttcttaaaggtacag 105

                                                             
Query: 423 ccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctc 472
           |  || |||||  |||| ||||||| ||||||||| | ||||||||||||
Sbjct: 104 ctatgaaggcgtctgtgaaggttgatggtgtactctctggtcaccacctc 55



to top

>gb|DQ306814.1| Hevea brasiliensis isolate SSH85 mRNA sequence
          Length = 449

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 178/222 (80%)
 Strand = Plus / Minus

                                                                       
Query: 224 ctcctccttagcgtcctcctcgtcgttcctcttgcgggcaatcctgacacggactctcct 283
           ||||||||| || ||||| || || || ||||| || ||||| |  ||||| ||||||||
Sbjct: 230 ctcctcctttgcatcctcttcatcatttctcttccgtgcaatgcgaacacgaactctcct 171

                                                                       
Query: 284 cgggacactcctgatgccgctgctccagatgtgcttgttgagcttaacgtcgatgcggac 343
            || || |||||||| || | |||||| || |||||||| ||||| || || |  |  ||
Sbjct: 170 tggcacgctcctgattccacggctccatatatgcttgtttagcttgacatccactctaac 111

                                                                       
Query: 344 atcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgc 403
           |||| |||| |||||||||||||| |||||||| ||||| ||||| ||||| || || ||
Sbjct: 110 atcagttgtccccatggccttctgagcaaactttctgatttcctttatggccttgggagc 51

                                                     
Query: 404 cttcttcttgaaggtacatccgtggaggcgcttgtggaggtt 445
           |||||||||||| || ||||| || | ||| || ||||||||
Sbjct: 50  cttcttcttgaaagtgcatccatgcaagcgtttatggaggtt 9



to top

>gb|DQ384531.1| Panax ginseng clone PG6L-8 ribosomal protein L31 mRNA, complete cds
          Length = 548

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 222/281 (79%)
 Strand = Plus / Minus

                                                                       
Query: 198 tcagcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttg 257
           ||||||||||| ||||| || || ||||||||||| || || ||||| || || || || 
Sbjct: 366 tcagcaactgttaccagtgaatagagctcctcctttgcatcttcctcatcatttcttttt 307

                                                                       
Query: 258 cgggcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgc 317
           |||||||| |  ||||| || ||||| || ||||| | ||| || | ||||||||| |||
Sbjct: 306 cgggcaatgcgaacacgcaccctccttggaacacttcggatcccacggctccagatctgc 247

                                                                       
Query: 318 ttgttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttc 377
           ||||| |||||  | ||||  |  |||||  | || ||||| ||||| || |||||||| 
Sbjct: 246 ttgtttagcttcgcatcgaccctaacatctgtagtccccatagccttttgagcaaacttt 187

                                                                       
Query: 378 ctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttg 437
           |||||||| || ||||||||||| || ||||| || || || ||||| || |||||| ||
Sbjct: 186 ctgatctcttttatggcatttggagctttctttttaaatgtgcatccatgaaggcgcctg 127

                                                    
Query: 438 tggaggttgacggtgtactcgcgggtcaccacctcgtcctt 478
           || ||||||| ||||||||| |  || |||||||| |||||
Sbjct: 126 tgaaggttgatggtgtactctctagtgaccacctcttcctt 86



to top

>gb|U23784.1|NGU23784 Nicotiana glutinosa ribosomal protein L31 mRNA, complete cds
          Length = 672

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 215/272 (79%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcaactgtcaccagagagtacagctcctccttagcgtcctcctcgtcgttcctcttgcgg 260
           ||||| || |||| |||||| ||||| ||||| || ||||| || || ||||||||||| 
Sbjct: 378 gcaacagtaaccaaagagtatagctcttcctttgcatcctcatcatcattcctcttgcga 319

                                                                       
Query: 261 gcaatcctgacacggactctcctcgggacactcctgatgccgctgctccagatgtgcttg 320
           ||||| |  || | ||| | ||| || ||||| | ||| || |||||||| || ||||||
Sbjct: 318 gcaatacgaactctgacacgccttggaacacttcggatacccctgctccatatttgcttg 259

                                                                       
Query: 321 ttgagcttaacgtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctg 380
           || ||||| || || |  |  ||||| || || ||||| || ||||| |||||||||| |
Sbjct: 258 ttcagcttcacatccactcttacatccttggtgcccatagctttctgtgcaaacttccgg 199

                                                                       
Query: 381 atctccttgatggcatttggtgccttcttcttgaaggtacatccgtggaggcgcttgtgg 440
           ||||||||||||||  |||| ||||||||||| || ||||| |  || | ||||||||||
Sbjct: 198 atctccttgatggctgttggggccttcttcttaaatgtacagctatgtaagcgcttgtgg 139

                                           
Query: 441 aggttgacggtgtactcgcgggtcaccacctc 472
           || ||||  |||||||| |  |||||||||||
Sbjct: 138 agattgatagtgtactccctcgtcaccacctc 107



to top

>emb|AJ417520.1|OSA417520 Oryza sativa partial mRNA for ribosomal protein L31 (xd5 gene)
          Length = 325

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                       
Query: 138 gtttagtcctcatcctccacaaccttggtacccaaacctttaagaccttcctgggggact 197
           ||||| ||||||||||| ||||||||||| |||||||| || ||||| ||    ||||| 
Sbjct: 92  gtttactcctcatcctcaacaaccttggttcccaaacccttgagaccctctgcagggacc 33

                                           
Query: 198 tcagcaactgtcaccagagagtacagctcctc 229
           ||||||||||| ||||||||||| ||||||||
Sbjct: 32  tcagcaactgtgaccagagagtagagctcctc 1



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 39  atcatgaacagtagataacaataagctaaagcaagacttcccaacatgctctcagca 95
           ||||| ||||||||||||||| | ||||||||||||||||| ||  |||||||||||
Sbjct: 207 atcatcaacagtagataacaaaacgctaaagcaagacttccaaatttgctctcagca 151



to top

>gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map mi148, complete
              sequence
          Length = 126386

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                          
Query: 348    tttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttc 407
              ||||||||||| || |||   ||||||||||||||||| || |||||||| |||||||||
Sbjct: 109257 tttgttcccattgctttcaatgcaaacttcctgatctctttaatggcattgggtgccttc 109316

                         
Query: 408    ttcttgaaggt 418
              |||||||||||
Sbjct: 109317 ttcttgaaggt 109327



to top

>ref|NM_125054.1| Arabidopsis thaliana structural constituent of ribosome AT5G56710
           mRNA, complete cds
          Length = 600

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 aacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggagg 431
           ||||||||||| ||||||||||| || |||||||||||||| ||||| |||  ||| |||
Sbjct: 201 aacttcctgatttccttgatggctttcggtgccttcttcttaaaggtgcatttgtgaagg 142

                                     
Query: 432 cgcttgtggaggttgacggtgtactc 457
           ||  |||||||||| | |||||||||
Sbjct: 141 cgtctgtggaggttaatggtgtactc 116



to top

>gb|AY124821.1| Arabidopsis thaliana AT5g56710/MIK19_16 mRNA, complete cds
          Length = 360

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 aacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggagg 431
           ||||||||||| ||||||||||| || |||||||||||||| ||||| |||  ||| |||
Sbjct: 128 aacttcctgatttccttgatggctttcggtgccttcttcttaaaggtgcatttgtgaagg 69

                                     
Query: 432 cgcttgtggaggttgacggtgtactc 457
           ||  |||||||||| | |||||||||
Sbjct: 68  cgtctgtggaggttaatggtgtactc 43



to top

>gb|AY050393.1| Arabidopsis thaliana AT5g56710/MIK19_16 mRNA, complete cds
          Length = 569

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 aacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggagg 431
           ||||||||||| ||||||||||| || |||||||||||||| ||||| |||  ||| |||
Sbjct: 195 aacttcctgatttccttgatggctttcggtgccttcttcttaaaggtgcatttgtgaagg 136

                                     
Query: 432 cgcttgtggaggttgacggtgtactc 457
           ||  |||||||||| | |||||||||
Sbjct: 135 cgtctgtggaggttaatggtgtactc 110



to top

>gb|AY085397.1| Arabidopsis thaliana clone 14992 mRNA, complete sequence
          Length = 600

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 372 aacttcctgatctccttgatggcatttggtgccttcttcttgaaggtacatccgtggagg 431
           ||||||||||| ||||||||||| || |||||||||||||| ||||| |||  ||| |||
Sbjct: 201 aacttcctgatttccttgatggctttcggtgccttcttcttaaaggtgcatttgtgaagg 142

                                     
Query: 432 cgcttgtggaggttgacggtgtactc 457
           ||  |||||||||| | |||||||||
Sbjct: 141 cgtctgtggaggttaatggtgtactc 116



to top

>emb|AL161564.2|ATCHRIV64 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 64
          Length = 196286

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                          
Query: 342    acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
              ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 174815 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 174756

                                 
Query: 402    gccttcttcttgaaggtac 420
              ||||||||||| |||||||
Sbjct: 174755 gccttcttcttaaaggtac 174737



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 436    tgtggaggttgacggtgtactcgcgggtcaccacctc 472
              |||| ||||||| ||||||||| | ||||||||||||
Sbjct: 174553 tgtgaaggttgatggtgtactctctggtcaccacctc 174517



to top

>emb|AL049171.1|ATT25K17 Arabidopsis thaliana DNA chromosome 4, BAC clone  (ESSA project)
          Length = 89904

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Minus

                                                                         
Query: 342   acatcatttgttcccatggccttctgggcaaacttcctgatctccttgatggcatttggt 401
             ||||| ||||| |||||  ||||||  ||||||||||| ||||||||||| || ||||| 
Sbjct: 30461 acatcctttgtccccatttccttctcagcaaacttccttatctccttgatcgcctttgga 30402

                                
Query: 402   gccttcttcttgaaggtac 420
             ||||||||||| |||||||
Sbjct: 30401 gccttcttcttaaaggtac 30383



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 436   tgtggaggttgacggtgtactcgcgggtcaccacctc 472
             |||| ||||||| ||||||||| | ||||||||||||
Sbjct: 30199 tgtgaaggttgatggtgtactctctggtcaccacctc 30163



to top

>dbj|AK107805.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-133-E07, full
           insert sequence
          Length = 699

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 424 cgtggaggcgcttgtggaggttgacggtgtactcgcgggtcac 466
           |||||| ||||||||| ||||||||||||||||||||||||||
Sbjct: 120 cgtggacgcgcttgtgcaggttgacggtgtactcgcgggtcac 78



to top

>gb|AF051232.1|AF051232 Picea mariana probable 60S ribosomal protein L31 (Sb42) mRNA,
           complete cds
          Length = 864

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                       
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggcatttggtgccttcttc 410
           |||||||| |||||||||||||| ||||||||||| || | ||| ||||| ||| | || 
Sbjct: 217 gttcccatagccttctgggcaaatttcctgatctctttaacggcctttggagccattttt 158

                                                                       
Query: 411 ttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacc 470
           || || || || || ||||||||| |||| || |||| ||||||||| |  ||| |||||
Sbjct: 157 ttaaaagtgcagccatggaggcgcctgtgaagattgatggtgtactccctcgtcgccacc 98

               
Query: 471 tcgt 474
           ||||
Sbjct: 97  tcgt 94



to top

>ref|XM_751252.1| Ustilago maydis 521 hypothetical protein (UM00198.1) partial mRNA
          Length = 528

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 424 cgtggaggcgcttgtggaggttgacggtgtactcgcgggtcac 466
           |||||| ||||||||| |||||||| |||||||||||||||||
Sbjct: 250 cgtggacgcgcttgtgcaggttgaccgtgtactcgcgggtcac 208



to top

>gb|BC114301.1| Danio rerio zgc:136896, mRNA (cDNA clone MGC:136896 IMAGE:7991945),
           complete cds
          Length = 1356

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 423 ccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccac 469
           ||||||| ||||||||||| ||||| |||||| ||||||||||||||
Sbjct: 103 ccgtggatgcgcttgtggatgttgatggtgtattcgcgggtcaccac 57



to top

>ref|NM_001040052.1| Danio rerio zgc:136896 (zgc:136896), mRNA
          Length = 1356

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 423 ccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccac 469
           ||||||| ||||||||||| ||||| |||||| ||||||||||||||
Sbjct: 103 ccgtggatgcgcttgtggatgttgatggtgtattcgcgggtcaccac 57



to top

>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
          Length = 84129

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 372   aacttcctgatctccttgatggcatttggtgccttcttcttgaaggt 418
             ||||||||||| ||||||||||| || |||||||||||||| |||||
Sbjct: 42440 aacttcctgatttccttgatggctttcggtgccttcttcttaaaggt 42486



to top

>ref|XM_381680.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01504.1) partial mRNA
          Length = 372

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 73/85 (85%), Gaps = 2/85 (2%)
 Strand = Plus / Minus

                                                                       
Query: 379 tgatctccttgatggcatttggtgccttcttcttgaaggt-acatccgtggaggcgcttg 437
           |||||||||||||||| || || ||| ||||||||||||| ||| || ||||| ||||||
Sbjct: 145 tgatctccttgatggccttgggagccctcttcttgaaggtgaca-ccatggagtcgcttg 87

                                    
Query: 438 tggaggttgacggtgtactcgcggg 462
           || | || || ||||||||||||||
Sbjct: 86  tgcatgtggatggtgtactcgcggg 62



to top

>ref|XM_416909.1| PREDICTED: Gallus gallus similar to ribosomal protein L31
           (LOC418710), mRNA
          Length = 1022

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 432 cgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||||||||| ||||| ||||||||| | ||||||||||||||
Sbjct: 236 cgcttgtggatgttgatggtgtactccctggtcaccacctcgt 194



to top

>emb|CR387290.1| Gallus gallus finished cDNA, clone ChEST178p13
          Length = 801

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 432 cgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||||||||| ||||| ||||||||| | ||||||||||||||
Sbjct: 117 cgcttgtggatgttgatggtgtactccctggtcaccacctcgt 75



to top

>gb|AY832444.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_412m2
           60S ribosomal protein L31a (60SRPL31a) gene, exons 1, 2
           and partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832443.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_412m1
           60S ribosomal protein L31a (60SRPL31a) gene, exons 1, 2
           and partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



to top

>gb|AY832442.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_013d2
           60S ribosomal protein L31a (60SRPL31a) gene, exons 1, 2
           and partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccatcaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832441.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_013d1
           60S ribosomal protein L31a (60SRPL31a) gene, exons 1, 2
           and partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832440.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_24 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccatcaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832439.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_23 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 429 aggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttgcg 481
           ||||||||||| || |||| ||||||||| | ||| || ||||||||| ||||
Sbjct: 54  aggcgcttgtgaagattgatggtgtactccctggtaacaacctcgtccctgcg 2



to top

>gb|AY832438.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_22 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccatcaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832437.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_21 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832436.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_20 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832435.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_19 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 429 aggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttgcg 481
           ||||||||||| || |||| ||||||||| | ||| || ||||||||| ||||
Sbjct: 54  aggcgcttgtgaagattgatggtgtactccctggtaacaacctcgtccctgcg 2



to top

>gb|AY832434.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_18 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



to top

>gb|AY832433.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_17 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccataaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832432.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_16 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832431.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_15 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832430.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_14 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832429.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_13 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccatcaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832428.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_12 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832427.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_11 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832426.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_10 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



to top

>gb|AY832425.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_9 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccatcaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832424.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_8 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832423.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_7 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832422.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_6 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832421.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_5 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 606

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 394 gttcccataaccttctgggcaaatttcctgatctcctt 357



to top

>gb|AY832420.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_4 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832419.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_3 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>gb|AY832418.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_2 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 395 gttcccatcaccttctgggcaaatttcctgatctcctt 358



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 429 aggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgtccttgcg 481
           ||||||||||| || |||| ||||||||| | ||| || ||||||||| ||||
Sbjct: 54  aggcgcttgtgaagattgatggtgtactccctggtaacaacctcgtccctgcg 2



to top

>gb|AY832417.1| Pseudotsuga menziesii var. menziesii haplotype Pm-60SRPL31a_1 60S
           ribosomal protein L31a (60SRPL31a) gene, exons 1, 2 and
           partial cds
          Length = 608

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 351 gttcccatggccttctgggcaaacttcctgatctcctt 388
           ||||||||  ||||||||||||| ||||||||||||||
Sbjct: 396 gttcccatcaccttctgggcaaatttcctgatctcctt 359



to top

>emb|AJ628167.1| Oikopleura dioica partial mRNA for ribosomal protein L31 (RPL31
           gene)
          Length = 347

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 432 cgcttgtggaggttgacggtgtactc 457
           ||||||||||||||||||||||||||
Sbjct: 142 cgcttgtggaggttgacggtgtactc 117



to top

>emb|AJ296278.1|CGL296278 Colletotrichum gloeosporioided f. sp. aeschynomene mRNA for
           putative 60s ribosomal protein (l31A gene)
          Length = 491

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 407 cttcttgaaggtacatccgtggaggcgcttgtggaggttgacggtgtactcgcg 460
           |||||||||||||   ||||||||||||||||| | || || ||||||||||||
Sbjct: 154 cttcttgaaggtaacaccgtggaggcgcttgtgcatgtggatggtgtactcgcg 101



to top

>gb|AC125520.3| Mus musculus BAC clone RP24-281J17 from 8, complete sequence
          Length = 178227

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 433   gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             ||||||||| ||||| |||||| || ||||||||||||||||
Sbjct: 62277 gcttgtggatgttgatggtgtattcccgggtcaccacctcgt 62236



to top

>dbj|AP006658.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT27P02, TM0343,
             complete sequence
          Length = 92507

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                         
Query: 184   cttcctgggggacttcagcaactgtcaccagagagtacagctcctccttagcgtcctcct 243
             |||||| ||||| |||  |||| || ||||| ||||||||||| ||||| || ||||| |
Sbjct: 92392 cttccttggggatttcgacaacagtaaccagggagtacagctcttcctttgcatcctcat 92451

                                   
Query: 244   cgtcgttcctcttgcgggcaat 265
             | ||||||||||| || |||||
Sbjct: 92452 catcgttcctcttacgagcaat 92473



to top

>gb|BC086916.1| Mus musculus ribosomal protein L31, mRNA (cDNA clone MGC:107628
           IMAGE:6764985), complete cds
          Length = 457

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 129 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 81



to top

>gb|AC170991.1| Mus musculus chromosome 1, clone wi1-738M5, complete sequence
          Length = 42035

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 426  tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
            |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 9821 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 9773



to top

>ref|XM_523741.1| PREDICTED: Pan troglodytes similar to ribosomal protein L31
           (LOC468352), mRNA
          Length = 426

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 422 tccgtggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||||||| ||||||||| | ||||| |||||  || ||||||||||||||||
Sbjct: 105 tccgtggatgcgcttgtgaatgttgatggtgtcttctcgggtcaccacctcgt 53



to top

>gb|AC099572.12| Mus musculus chromosome 15, clone RP23-16A17, complete sequence
          Length = 200229

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 146627 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 146675



to top

>gb|BC055720.1| Mus musculus ribosomal protein L31, mRNA (cDNA clone MGC:66837
           IMAGE:6410850), complete cds
          Length = 492

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 134 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 86



to top

>gb|BC008223.1| Mus musculus ribosomal protein L31, mRNA (cDNA clone
           IMAGE:2599150), partial cds
          Length = 974

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 107 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 59



to top

>ref|NM_053257.1| Mus musculus ribosomal protein L31 (Rpl31), mRNA
          Length = 970

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 118 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 70



to top

>ref|XM_001005894.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC673582), mRNA
          Length = 474

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 137 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 89



to top

>ref|XR_002708.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC435486), mRNA
          Length = 377

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 101 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 53



to top

>ref|XR_003329.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC671205), mRNA
          Length = 472

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 128 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 80



to top

>ref|XR_002259.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC668850), mRNA
          Length = 472

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 128 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 80



to top

>ref|XM_001002948.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC672957), mRNA
          Length = 533

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 194 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 146



to top

>ref|XM_991367.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC676592), mRNA
          Length = 533

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 194 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 146



to top

>ref|XM_991853.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC667682), mRNA
          Length = 533

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 194 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 146



to top

>ref|XM_982842.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC544868), mRNA
          Length = 473

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 137 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 89



to top

>ref|XM_618994.3| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC544868), mRNA
          Length = 473

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 137 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 89



to top

>ref|XM_993518.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC544868), mRNA
          Length = 473

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 137 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 89



to top

>gb|AC073335.5| Homo sapiens BAC clone RP11-458F8 from 7, complete sequence
          Length = 68275

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 44514 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 44466



to top

>ref|XM_925336.2| PREDICTED: Mus musculus similar to ribosomal protein L31,
           transcript variant 2 (LOC638399), mRNA
          Length = 505

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 164 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 116



to top

>ref|XM_917895.2| PREDICTED: Mus musculus similar to ribosomal protein L31,
           transcript variant 1 (LOC638399), mRNA
          Length = 454

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 113 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 65



to top

>ref|XR_002570.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC631731), mRNA
          Length = 512

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 170 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 122



to top

>ref|XM_986580.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC626367), mRNA
          Length = 488

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 155 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 107



to top

>ref|XR_002179.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC668409), mRNA
          Length = 507

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 170 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 122



to top

>ref|XM_890955.2| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC626367), mRNA
          Length = 488

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 155 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 107



to top

>emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chromosome 16, complete
             sequence
          Length = 202976

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 69015 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 69063



to top

>gb|AC127252.3| Mus musculus BAC clone RP24-276A6 from chromosome 3, complete sequence
          Length = 173199

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 116100 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 116148



to top

>gb|AC129177.3| Mus musculus BAC clone RP23-175A22 from 3, complete sequence
          Length = 229072

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 216114 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 216162



to top

>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence
          Length = 224790

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 173657 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 173609



to top

>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete
             Sequence, complete sequence
          Length = 217768

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 42932 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 42884



to top

>gb|BC099436.1| Mus musculus ribosomal protein L31, mRNA (cDNA clone MGC:117624
           IMAGE:30933663), complete cds
          Length = 441

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 107 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 59



to top

>gb|AC142249.6| Mus musculus chromosome 19, clone RP23-388O22, complete sequence
          Length = 201321

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 58162 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 58210



to top

>dbj|AK148620.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120425F17
            product:hypothetical protein, full insert sequence
          Length = 2704

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                             
Query: 426  tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
            |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 2153 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 2201



to top

>dbj|AK160620.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055G03 product:ribosomal
           protein L31, full insert sequence
          Length = 452

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 120 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 72



to top

>dbj|AB169692.1| Macaca fascicularis brain cDNA, clone: QccE-18647, similar to human
           ribosomal protein L31 (RPL31), mRNA, RefSeq: NM_000993.2
          Length = 754

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 128 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 80



to top

>dbj|AK033029.1| Mus musculus 11 days embryo gonad cDNA, RIKEN full-length enriched
           library, clone:7030408O17 product:ribosomal protein L31,
           full insert sequence
          Length = 1978

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 508 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 556



to top

>gb|AC161252.2| Mus musculus BAC clone RP24-167E3 from chromosome 13, complete sequence
          Length = 158432

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 15395 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 15443



to top

>gb|AC154217.2| Mus musculus BAC clone RP24-357L19 from chromosome 17, complete sequence
          Length = 183535

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 111038 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 110990



to top

>gb|AF362574.1|AF362574 Mus musculus M75 (M75) mRNA, complete cds
          Length = 453

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 116 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 68



to top

>dbj|AK019226.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700087K23 product:ribosomal
           protein L31, full insert sequence
          Length = 435

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 125 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 77



to top

>dbj|AK075964.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2500004N06 product:ribosomal protein L31,
           full insert sequence
          Length = 705

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 159 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 111



to top

>dbj|AK011236.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2600017C16 product:ribosomal
           protein L31, full insert sequence
          Length = 559

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 129 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 81



to top

>dbj|AK014295.1| Mus musculus 14, 17 days embryo head cDNA, RIKEN full-length
           enriched library, clone:3200001N24 product:ribosomal
           protein L31, full insert sequence
          Length = 970

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 118 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 70



to top

>dbj|AK020627.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
           enriched library, clone:9530065G07 product:ribosomal
           protein L31, full insert sequence
          Length = 435

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 125 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 77



to top

>gb|AC158989.1| Mus musculus BAC clone RP23-399H20 from chromosome 3, complete sequence
          Length = 190372

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 187397 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 187349



to top

>gb|AF401586.1| Ictalurus punctatus ribosomal protein L31 mRNA, complete cds
          Length = 417

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||||| ||||| ||| ||||| ||||| ||||||||||
Sbjct: 101 tggatgcgcttgtggacgttgatggtatactcccgggttaccacctcgt 53



to top

>ref|XM_212735.3| PREDICTED: Rattus norvegicus similar to ribosomal protein L31
           (LOC289401), mRNA
          Length = 420

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 110 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 62



to top

>ref|XM_578077.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L31
           (LOC502591), mRNA
          Length = 468

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 128 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 80



to top

>emb|BX511169.2|RN224C24 Rattus norvegicus chromosome 1 BAC RP32-224C24, complete sequence
          Length = 163386

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 161277 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 161325



to top

>gb|AF144695.1|AF144695 Mus musculus ERO1L (Ero1l) mRNA, complete cds
          Length = 3512

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 426  tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
            |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 3174 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 3126



to top

>gb|BC050113.1| Mus musculus ribosomal protein L31, mRNA (cDNA clone MGC:60892
           IMAGE:6431661), complete cds
          Length = 441

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 106 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 58



to top

>gb|AC154631.2| Mus musculus BAC clone RP23-264F8 from 16, complete sequence
          Length = 201820

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 27360 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 27312



to top

>emb|CT030142.10| Mouse DNA sequence from clone RP23-422H22 on chromosome 12, complete
             sequence
          Length = 203796

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 10019 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 10067



to top

>gb|AC132571.2| Mus musculus BAC clone RP24-539E18 from 1, complete sequence
          Length = 200750

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 65677 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 65725



to top

>gb|AC150033.2| Mus musculus BAC clone RP23-449N19 from 3, complete sequence
          Length = 179293

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 11722 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 11770



to top

>gb|AC165349.2| Mus musculus BAC clone RP23-212M22 from chromosome 12, complete sequence
          Length = 199483

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                               
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 145482 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 145530



to top

>gb|AC170749.6| Mus musculus chromosome 1, clone RP23-322G4, complete sequence
          Length = 208713

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             |||| ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 36119 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 36167



to top

>ref|XM_329389.1| Neurospora crassa OR74A 60s ribosomal protein (NCU08344.1) partial
           mRNA
          Length = 369

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 107/132 (81%), Gaps = 2/132 (1%)
 Strand = Plus / Minus

                                                                       
Query: 332 gtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttgat 391
           |||||||||||||||  | || ||||| ||||| |  || |||| | |||||||||||||
Sbjct: 189 gtcgatgcggacatcggtggtacccatcgccttgtaagcgaactccttgatctccttgat 130

                                                                       
Query: 392 ggcatttggtgccttcttcttgaaggt-acatccgtggaggcgcttgtggaggttgacgg 450
           |||    || ||| ||||||||||||| ||| ||||| | ||||||||| | || || ||
Sbjct: 129 ggcgcgaggagccctcttcttgaaggtgaca-ccgtgcatgcgcttgtgcatgtggatgg 71

                       
Query: 451 tgtactcgcggg 462
           ||||||||||||
Sbjct: 70  tgtactcgcggg 59



to top

>ref|XM_960154.1| Neurospora crassa OR74A 60s ribosomal protein (NCU08344.1) partial
           mRNA
          Length = 369

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 107/132 (81%), Gaps = 2/132 (1%)
 Strand = Plus / Minus

                                                                       
Query: 332 gtcgatgcggacatcatttgttcccatggccttctgggcaaacttcctgatctccttgat 391
           |||||||||||||||  | || ||||| ||||| |  || |||| | |||||||||||||
Sbjct: 189 gtcgatgcggacatcggtggtacccatcgccttgtaagcgaactccttgatctccttgat 130

                                                                       
Query: 392 ggcatttggtgccttcttcttgaaggt-acatccgtggaggcgcttgtggaggttgacgg 450
           |||    || ||| ||||||||||||| ||| ||||| | ||||||||| | || || ||
Sbjct: 129 ggcgcgaggagccctcttcttgaaggtgaca-ccgtgcatgcgcttgtgcatgtggatgg 71

                       
Query: 451 tgtactcgcggg 462
           ||||||||||||
Sbjct: 70  tgtactcgcggg 59



to top

>ref|XM_657998.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5486.2), mRNA
          Length = 1269

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 434 cttgtggaggttgacggtgtactcgcgggtcaccac 469
           |||||| ||||| | |||||||||||||||||||||
Sbjct: 984 cttgtgcaggttaatggtgtactcgcgggtcaccac 949



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 216  gagtacagctcctccttagcgtcctcctcgtcgttcctcttgcg 259
            ||||| |||| |||||||||  ||||||||||||| | ||||||
Sbjct: 1202 gagtagagcttctccttagcaccctcctcgtcgttacgcttgcg 1159



to top

>ref|XM_001006473.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC432681), mRNA
          Length = 482

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcg 473
           |||| ||||||||| | ||||| |||||| || |||||||||||||||
Sbjct: 155 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcg 108



to top

>ref|XM_973657.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC669190), mRNA
          Length = 483

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcg 473
           |||| ||||||||| | ||||| |||||| || |||||||||||||||
Sbjct: 156 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcg 109



to top

>ref|XM_979466.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC675096), mRNA
          Length = 475

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcg 473
           |||| ||||||||| | ||||| |||||| || |||||||||||||||
Sbjct: 155 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcg 108



to top

>ref|XM_484165.4| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC432681), mRNA
          Length = 482

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcg 473
           |||| ||||||||| | ||||| |||||| || |||||||||||||||
Sbjct: 155 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcg 108



to top

>ref|XM_983272.1| PREDICTED: Mus musculus ribosomal protein L31 (Rpl31), mRNA
          Length = 512

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 431 gcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 160 gcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 117



to top

>gb|AC157658.2| Mus musculus BAC clone RP23-331E4 from chromosome 12, complete sequence
          Length = 203717

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 426    tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcg 473
              |||| ||||||||| | ||||| |||||| || |||||||||||||||
Sbjct: 106623 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctcg 106576



to top

>gb|AC133187.3| Mus musculus BAC clone RP23-324O10 from 1, complete sequence
          Length = 219866

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 431    gcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              ||||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 204671 gcgcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 204628



to top

>ref|XM_213087.3| PREDICTED: Rattus norvegicus similar to ribosomal protein L31
           (LOC299740), mRNA
          Length = 454

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctc 472
           |||| ||||||||| | ||||| |||||| || ||||||||||||||
Sbjct: 124 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctc 78



to top

>emb|AL603867.7| Mouse DNA sequence from clone RP23-237G11 on chromosome 15, complete
             sequence
          Length = 112729

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctc 472
             |||| ||||||||| | ||||| |||||| || ||||||||||||||
Sbjct: 16690 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacctc 16644



to top

>gb|AY826148.1| Aedes albopictus clone AL_280 60S ribosomal protein L31 mRNA,
           complete cds
          Length = 375

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 441 aggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||| |||| |||||||||||||||| ||||
Sbjct: 77  aggttgatggtgcactcgcgggtcaccacttcgt 44



to top

>gb|BC052594.1| Homo sapiens ribosomal protein L31 pseudogene, mRNA (cDNA clone
           IMAGE:6574909), containing frame-shift errors
          Length = 1572

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 433 gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 136 gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 95



to top

>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete
             sequence
          Length = 186202

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 426   tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacct 471
             |||| ||||||||| | ||||| |||||| || |||||||||||||
Sbjct: 39692 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacct 39647



to top

>ref|XM_513947.1| PREDICTED: Pan troglodytes LOC457459 (LOC457459), mRNA
          Length = 739

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 433 gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 94  gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 53



to top

>ref|XR_003527.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC670381), mRNA
          Length = 990

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacct 471
           |||| ||||||||| | ||||| |||||| || |||||||||||||
Sbjct: 654 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacct 609



to top

>ref|XM_910656.2| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC632618), mRNA
          Length = 989

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacct 471
           |||| ||||||||| | ||||| |||||| || |||||||||||||
Sbjct: 654 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacct 609



to top

>ref|XM_983910.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC665562), mRNA
          Length = 989

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacct 471
           |||| ||||||||| | ||||| |||||| || |||||||||||||
Sbjct: 654 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacct 609



to top

>ref|XM_746108.1| Aspergillus fumigatus Af293 ribosomal protein L31e (Afu6g13250)
           partial mRNA
          Length = 372

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 434 cttgtggaggttgacggtgtactcgcgggt 463
           |||||| ||||||| |||||||||||||||
Sbjct: 90  cttgtgcaggttgatggtgtactcgcgggt 61



to top

>ref|XM_566913.1| Cryptococcus neoformans var. neoformans JEC21 PRCDNA87 (CNA06820)
           partial mRNA
          Length = 459

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 380 gatctccttgatggcatttggtgccttcttcttgaagg 417
           ||||||||| ||||| || || ||||||||||||||||
Sbjct: 144 gatctccttaatggccttgggggccttcttcttgaagg 107



to top

>emb|AL359541.11| Human DNA sequence from clone RP11-474I16 on chromosome 1 Contains three
              novel genes, the FCGR2B gene for Fc fragment of IgG low
              affinity IIb receptor for (CD32), a ribosomal protein L31
              (RPL31) pseudogene, the gene for Fc receptor homolog
              expressed in B cells (FREB), the gene for a novel protein
              (FLJ31052), the DUSP12 gene for dual specificity
              phosphatase 12, the 5' end of the ATF6 gene for activating
              transcription factor 6 and a CpG island, complete sequence
          Length = 158641

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 433    gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 107047 gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 107006



to top

>emb|AL451067.12| Human DNA sequence from clone RP11-25K21 on chromosome 1, complete
              sequence
          Length = 150019

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 433    gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
              ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 149817 gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 149858



to top

>dbj|AB226042.1| Aspergillus oryzae cDNA, contig sequence: AoEST2898
          Length = 630

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 216 gagtacagctcctccttagcgtcctcctcgtcgttcctcttgcggg 261
           ||||| |||| |||||| |||| |||||||||||| | ||||||||
Sbjct: 372 gagtagagcttctccttggcgttctcctcgtcgttacgcttgcggg 327



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                             
Query: 216     gagtacagctcctccttagcgtcctcctcgtcgttcctcttgcggg 261
               ||||| |||| |||||| |||| |||||||||||| | ||||||||
Sbjct: 1198139 gagtagagcttctccttggcgttctcctcgtcgttacgcttgcggg 1198094



to top

>ref|NR_002595.1| Homo sapiens ribosomal protein L31 pseudogene (LOC641311) on
           chromosome 1
          Length = 1572

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 433 gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 136 gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 95



to top

>gb|DQ066314.1| Ixodes scapularis isolate IS-6-12L-311 ribosomal protein L31 mRNA,
           partial cds
          Length = 384

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 362 cttctgggcaaacttcctgatctccttgatggca 395
           ||||| ||| |||||| |||||||||||||||||
Sbjct: 168 cttctcggcgaacttcttgatctccttgatggca 135



to top

>gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 172188

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 433   gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
             ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 49181 gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 49222



to top

>ref|XM_578388.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L31
           (LOC502887), mRNA
          Length = 375

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 433 gcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           ||||||| | ||||| |||||| || ||||||||||||||||
Sbjct: 91  gcttgtgaatgttgatggtgtattctcgggtcaccacctcgt 50



to top

>ref|XM_508951.1| PREDICTED: Pan troglodytes similar to ribosomal protein L31
           (LOC451779), mRNA
          Length = 521

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| || ||||||||||| ||||
Sbjct: 113 tggatgcgcttgtgaatgttgatggtgtattctcgggtcaccacttcgt 65



to top

>gb|AY190731.1| Pagrus major ribosomal protein L31 mRNA, complete cds
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcac 466
           |||| ||||||||||| ||||| ||||||||| | ||||||
Sbjct: 116 tggatgcgcttgtggatgttgatggtgtactctctggtcac 76



to top

>ref|XM_361184.1| Magnaporthe grisea 70-15 hypothetical protein (MG03727.4) partial
           mRNA
          Length = 375

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 434 cttgtggaggttgacggtgtactcgcggg 462
           ||||||||||| || ||||||||||||||
Sbjct: 93  cttgtggaggtggatggtgtactcgcggg 65



to top

>ref|XM_001002593.1| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC625917), mRNA
          Length = 438

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| ||  |||||||||||||||
Sbjct: 116 tggatgcgcttgtgaatgttgatggtgtattcttgggtcaccacctcgt 68



to top

>ref|XM_917009.2| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC625917), mRNA
          Length = 438

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| ||  |||||||||||||||
Sbjct: 116 tggatgcgcttgtgaatgttgatggtgtattcttgggtcaccacctcgt 68



to top

>ref|XM_893121.2| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC625917), mRNA
          Length = 438

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| ||  |||||||||||||||
Sbjct: 116 tggatgcgcttgtgaatgttgatggtgtattcttgggtcaccacctcgt 68



to top

>ref|XR_003519.1| PREDICTED: Mus musculus hypothetical LOC435835 (LOC435835), mRNA
          Length = 366

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| ||  |||||||||||||||
Sbjct: 93  tggatgcgcttgtgaatgttgatggtgtattcttgggtcaccacctcgt 45



to top

>ref|XR_004788.1| PREDICTED: Mus musculus hypothetical LOC435835 (LOC435835), mRNA
          Length = 366

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||||||| | ||||| |||||| ||  |||||||||||||||
Sbjct: 93  tggatgcgcttgtgaatgttgatggtgtattcttgggtcaccacctcgt 45



to top

>ref|XM_913657.2| PREDICTED: Mus musculus similar to ribosomal protein L31
           (LOC637860), mRNA
          Length = 482

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 426 tggaggcgcttgtggaggttgacggtgtactcgcgggtcaccacctcgt 474
           |||| ||||| ||| | ||||| |||||| || ||||||||||||||||
Sbjct: 154 tggatgcgctcgtgaatgttgatggtgtattctcgggtcaccacctcgt 106



to top

>emb|CR734325.2|CNS0GTDW Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR734302.2|CNS0GTD9 Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 203 gttcccatctccttcacggcaaacttgcggatctccttgatggca 159



to top

>emb|CR734146.2|CNS0GT8X Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR734410.2|CNS0GTG9 Tetraodon nigroviridis full-length cDNA
          Length = 289

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 46  gttcccatctccttcacggcaaacttgcggatctccttgatggca 2



to top

>emb|CR734012.2|CNS0GT57 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 203 gttcccatctccttcacggcaaacttgcggatctccttgatggca 159



to top

>emb|CR733850.2|CNS0GT0P Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR733743.2|CNS0GSXQ Tetraodon nigroviridis full-length cDNA
          Length = 442

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 198 gttcccatctccttcacggcaaacttgcggatctccttgatggca 154



to top

>emb|CR712268.2|CNS0GCJC Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 246 gttcccatctccttcacggcaaacttgcggatctccttgatggca 202



to top

>emb|CR719182.2|CNS0GHV8 Tetraodon nigroviridis full-length cDNA
          Length = 439

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 196 gttcccatctccttcacggcaaacttgcggatctccttgatggca 152



to top

>emb|CR718548.2|CNS0GHDM Tetraodon nigroviridis full-length cDNA
          Length = 439

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 196 gttcccatctccttcacggcaaacttgcggatctccttgatggca 152



to top

>emb|CR718429.2|CNS0GHAB Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR718111.2|CNS0GH1H Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR717959.2|CNS0GGX9 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR717558.2|CNS0GGM4 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR717407.2|CNS0GGHX Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR716798.2|CNS0GG13 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR716116.2|CNS0GFI8 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR715543.2|CNS0GF2B Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 203 gttcccatctccttcacggcaaacttgcggatctccttgatggca 159



to top

>emb|CR715529.2|CNS0GF1X Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR715510.2|CNS0GF1E Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR715146.2|CNS0GERA Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR714875.2|CNS0GEJR Tetraodon nigroviridis full-length cDNA
          Length = 588

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 345 gttcccatctccttcacggcaaacttgcggatctccttgatggca 301



to top

>emb|CR714639.2|CNS0GED7 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR714536.2|CNS0GEAC Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR714381.2|CNS0GE61 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR712482.2|CNS0GCPA Tetraodon nigroviridis full-length cDNA
          Length = 442

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 199 gttcccatctccttcacggcaaacttgcggatctccttgatggca 155



to top

>emb|CR713989.2|CNS0GDV5 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR713727.2|CNS0GDNV Tetraodon nigroviridis full-length cDNA
          Length = 825

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 228 gttcccatctccttcacggcaaacttgcggatctccttgatggca 184



to top

>emb|CR713606.2|CNS0GDKI Tetraodon nigroviridis full-length cDNA
          Length = 416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 173 gttcccatctccttcacggcaaacttgcggatctccttgatggca 129



to top

>emb|CR712987.2|CNS0GD3B Tetraodon nigroviridis full-length cDNA
          Length = 436

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR712963.2|CNS0GD2N Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR713329.2|CNS0GDCT Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR713198.2|CNS0GD96 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR712658.2|CNS0GCU6 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR711061.2|CNS0GBLT Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR710508.2|CNS0GB6G Tetraodon nigroviridis full-length cDNA
          Length = 442

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 199 gttcccatctccttcacggcaaacttgcggatctccttgatggca 155



to top

>emb|CR710285.2|CNS0GB09 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR709742.2|CNS0GAL6 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR709716.2|CNS0GAKG Tetraodon nigroviridis full-length cDNA
          Length = 416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 173 gttcccatctccttcacggcaaacttgcggatctccttgatggca 129



to top

>emb|CR709291.2|CNS0GA8N Tetraodon nigroviridis full-length cDNA
          Length = 416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 173 gttcccatctccttcacggcaaacttgcggatctccttgatggca 129



to top

>emb|CR708928.2|CNS0G9YK Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR708809.2|CNS0G9V9 Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR709071.2|CNS0GA2J Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR708700.2|CNS0G9S8 Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 226 gttcccatctccttcacggcaaacttgcggatctccttgatggca 182



to top

>emb|CR707070.2|CNS0G8IY Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR707068.2|CNS0G8IW Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR706968.2|CNS0G8G4 Tetraodon nigroviridis full-length cDNA
          Length = 442

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 199 gttcccatctccttcacggcaaacttgcggatctccttgatggca 155



to top

>emb|CR706675.2|CNS0G87Z Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR705563.2|CNS0G7D3 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR705386.2|CNS0G786 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR705049.2|CNS0G6YT Tetraodon nigroviridis full-length cDNA
          Length = 449

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR704256.2|CNS0G6CS Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR703648.2|CNS0G5VW Tetraodon nigroviridis full-length cDNA
          Length = 446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 203 gttcccatctccttcacggcaaacttgcggatctccttgatggca 159



to top

>emb|CR703508.2|CNS0G5S0 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR703462.2|CNS0G5QQ Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR702868.2|CNS0G5A8 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR702754.2|CNS0G572 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR702090.2|CNS0G4OM Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR700699.2|CNS0G3LZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 202 gttcccatctccttcacggcaaacttgcggatctccttgatggca 158



to top

>emb|CR697644.2|CNS0G194 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR697054.2|CNS0G0SQ Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR696604.2|CNS0G0G8 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR694260.2|CNS0FYN4 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR692605.2|CNS0FXD5 Tetraodon nigroviridis full-length cDNA
          Length = 450

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR688682.2|CNS0FUC6 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR686948.2|CNS0FT00 Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR686415.2|CNS0FSL7 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR684623.2|CNS0FR7F Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR681766.2|CNS0FP02 Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160



to top

>emb|CR671971.2|CNS0FHGP Tetraodon nigroviridis full-length cDNA
          Length = 448

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR661138.2|CNS0F93S Tetraodon nigroviridis full-length cDNA
          Length = 759

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 205 gttcccatctccttcacggcaaacttgcggatctccttgatggca 161



to top

>emb|CR656051.2|CNS0F56H Tetraodon nigroviridis full-length cDNA
          Length = 447

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 351 gttcccatggccttctgggcaaacttcctgatctccttgatggca 395
           ||||||||  |||||  ||||||||| | ||||||||||||||||
Sbjct: 204 gttcccatctccttcacggcaaacttgcggatctccttgatggca 160


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,043,951
Number of Sequences: 3902068
Number of extensions: 4043951
Number of successful extensions: 83803
Number of sequences better than 10.0: 360
Number of HSP's better than 10.0 without gapping: 358
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 83021
Number of HSP's gapped (non-prelim): 771
length of query: 514
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 491
effective length of database: 17,143,297,704
effective search space: 8417359172664
effective search space used: 8417359172664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top