>gb|AC167012.3| Mus musculus BAC clone RP23-416A5 from chromosome 13, complete sequence
          Length = 193916

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   tgccaaaaaagaacacccac 154
             ||||||||||||||||||||
Sbjct: 38203 tgccaaaaaagaacacccac 38222

>gb|AC126799.3| Mus musculus BAC clone RP24-388B22 from chromosome 13, complete
             sequence
          Length = 168873

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   tgtacatgtctacagccatg 193
             ||||||||||||||||||||
Sbjct: 65357 tgtacatgtctacagccatg 65338

>emb|AL603910.6| Human DNA sequence from clone RP11-505P4 on chromosome 6 Contains the
             5' end of the C6orf150 gene for chromosome 6 open reading
             frame 150 , the MTO1 gene for mitochondrial translation
             optimization 1 homolog (S. cerevisiae), the EEF1A1 gene
             for eukaryotic translation elongation factor 1 alpha 1, a
             thymosin beta (TMSNB) pseudogene and 3 CpG islands,
             complete sequence
          Length = 134105

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   ctaggcatatgtacatgtct 184
             ||||||||||||||||||||
Sbjct: 64574 ctaggcatatgtacatgtct 64593

>emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23 on chromosome 6q24 Contains
             the gene for KIAA1244 protein, a macrophage myristoylated
             alanine-rich C kinase substrate (MACMARCKS) pseudogene, a
             pseudogene similar to Mus musculus upregulated during
             skeletal muscle growth 5 (Usmg5), the gene for chromosome
             6 open reading frame 34 (C6orf34) (SOUL) and a CpG island,
             complete sequence
          Length = 159344

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 132   ccctgccaaaaaagaacacc 151
             ||||||||||||||||||||
Sbjct: 92630 ccctgccaaaaaagaacacc 92611

>emb|BX545915.7| Zebrafish DNA sequence from clone DKEY-41B16 in linkage group 3,
             complete sequence
          Length = 192468

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   gcatatgtacatgtctacag 188
             ||||||||||||||||||||
Sbjct: 39242 gcatatgtacatgtctacag 39223

>gb|AF442963.1| Homo sapiens MTO1-like protein gene, complete cds; nuclear gene for
             mitochondrial product
          Length = 40439

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   ctaggcatatgtacatgtct 184
             ||||||||||||||||||||
Sbjct: 10131 ctaggcatatgtacatgtct 10150

>gb|AC025755.5| Homo sapiens chromosome 5 clone CTD-2045M21, complete sequence
          Length = 111634

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   aaaagaacacccacacccac 160
             ||||||||||||||||||||
Sbjct: 75227 aaaagaacacccacacccac 75208

>gb|AC159261.4| Mus musculus BAC clone RP24-80C13 from chromosome 13, complete
            sequence
          Length = 230437

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 135  tgccaaaaaagaacacccac 154
            ||||||||||||||||||||
Sbjct: 9909 tgccaaaaaagaacacccac 9928


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,245,873
Number of Sequences: 3902068
Number of extensions: 1245873
Number of successful extensions: 79498
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79482
Number of HSP's gapped (non-prelim): 16
length of query: 222
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 200
effective length of database: 17,147,199,772
effective search space: 3429439954400
effective search space used: 3429439954400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)