>emb|AJ224324.1|HVH224324 Hordeum vulgare cv. Haisa mRNA for cp31BHv protein
          Length = 1139

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                            
Query: 88   aaaaggtgaactcatggtatngacaagaaattaacatgattacaccag 135
            ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 1133 aaaagttgaactcatggtattgacaagaaattaacatgattacaccag 1086

>gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome 1, complete sequence
          Length = 185692

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    ttgaaaaggtgaactcatgg 104
             ||||||||||||||||||||
Sbjct: 99824 ttgaaaaggtgaactcatgg 99805

>gb|AC108391.14| Mus musculus chromosome 1, clone RP23-16N14, complete sequence
          Length = 257730

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    ttgaaaaggtgaactcatgg 104
             ||||||||||||||||||||
Sbjct: 53877 ttgaaaaggtgaactcatgg 53858

>gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence,
             complete sequence
          Length = 100835

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    attatgcatgagcaacact 61
             |||||||||||||||||||
Sbjct: 34895 attatgcatgagcaacact 34913

>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 110    acaagaaattaacatgatt 128
              |||||||||||||||||||
Sbjct: 775344 acaagaaattaacatgatt 775326

>gb|AC021849.5| Homo sapiens BAC clone RP11-366G5 from 2, complete sequence
          Length = 168710

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    tgcatgagcaacactaggg 65
             |||||||||||||||||||
Sbjct: 54743 tgcatgagcaacactaggg 54725

>gb|AC013410.5| Homo sapiens BAC clone RP11-495I2 from 2, complete sequence
          Length = 200900

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 56     aacactagggcatcattacagtagcct 82
              |||||||||||  ||||||||||||||
Sbjct: 170128 aacactagggctgcattacagtagcct 170154

>emb|BX005215.13| Mouse DNA sequence from clone RP23-280F9 on chromosome X, complete
              sequence
          Length = 189900

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 32     aaccttcttcgattatgcatgag 54
              ||||||||| |||||||||||||
Sbjct: 178659 aaccttctttgattatgcatgag 178681


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 695,691
Number of Sequences: 3902068
Number of extensions: 695691
Number of successful extensions: 42997
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42979
Number of HSP's gapped (non-prelim): 18
length of query: 137
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 116
effective length of database: 17,151,101,840
effective search space: 1989527813440
effective search space used: 1989527813440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)