ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags37n19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_189879.2| Oryza sativa (japonica cultivar-group), mRNA 476 e-131
2dbj|AK069465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 476 e-131
3gb|U92045.1|ZMU92045 Zea mays ribosomal protein S6 RPS6-1 (rps6-... 387 e-104
4gb|AF295599.1| Zea mays ribosomal protein s6 RPS6-2 (rps6-2) mRN... 373 e-100
5gb|AY103674.1| Zea mays PCO104001 mRNA sequence 373 e-100
6ref|XM_470801.1| Oryza sativa (japonica cultivar-group), mRNA 369 7e-99
7dbj|AK121621.1| Oryza sativa (japonica cultivar-group) cDNA clon... 369 7e-99
8dbj|AK061827.1| Oryza sativa (japonica cultivar-group) cDNA clon... 369 7e-99
9dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 281 1e-72
10dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 281 1e-72
11gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 200 4e-48
12gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom... 200 4e-48
13dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 200 4e-48
14emb|AJ277533.1|AOF277533 Asparagus officinalis mRNA for S6 ribos... 172 8e-40
15ref|NM_121074.2| Arabidopsis thaliana EMB3010; structural consti... 165 2e-37
16gb|AY093783.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, c... 165 2e-37
17gb|AY057634.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, c... 165 2e-37
18gb|AY045594.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, c... 165 2e-37
19emb|BX832002.1|CNS0A26R Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
20emb|BX830696.1|CNS0A0OB Arabidopsis thaliana Full-length cDNA Co... 165 2e-37
21gb|DQ191669.1| Solanum tuberosum ribosomal protein S6-like prote... 151 3e-33
22emb|Y14052.1|ATY14052 Arabidopsis thaliana mRNA for ribosomal pr... 151 3e-33
23emb|BX832475.1|CNS0A24D Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
24emb|BX832457.1|CNS0A241 Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
25emb|BX829995.1|CNS0A1FC Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
26gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clon... 123 7e-25
27emb|AL353995.1|ATF12B17 Arabidopsis thaliana DNA chromosome 5, B... 121 3e-24
28gb|AY293401.1| Brassica napus ribosomal protein S6 (RPS6) mRNA, ... 115 2e-22
29ref|NM_119319.3| Arabidopsis thaliana RPS6 (RIBOSOMAL PROTEIN S6... 105 2e-19
30gb|BT000693.1| Arabidopsis thaliana clone RAFL07-09-P18 (R10989)... 105 2e-19
31gb|AY113983.1| Arabidopsis thaliana putative ribosomal protein S... 105 2e-19
32gb|AY050803.1| Arabidopsis thaliana putative ribosomal protein S... 105 2e-19
33emb|BX826399.1|CNS0A4KZ Arabidopsis thaliana Full-length cDNA Co... 105 2e-19
34gb|BT014411.1| Lycopersicon esculentum clone 133718F, mRNA sequence 103 6e-19
35gb|BT014365.1| Lycopersicon esculentum clone 133651F, mRNA sequence 103 6e-19
36emb|BX831797.1|CNS0A23Y Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
37emb|AJ010227.1|CAR010227 Cicer arietinum mRNA for 40S ribosomal ... 86 1e-13
38gb|AY105798.1| Zea mays PCO089449 mRNA sequence 86 1e-13
39emb|BX827692.1|CNS0A3WM Arabidopsis thaliana Full-length cDNA Co... 84 6e-13
40gb|AF034217.1|AF034217 Arabidopsis thaliana ribosomal protein S6... 84 6e-13
41gb|DQ241846.1| Solanum tuberosum clone 186G09 unknown mRNA 82 2e-12
42gb|AY453394.1| Glycine max ribosomal protein S6 (RPS6) mRNA, com... 78 4e-11
43dbj|D78497.1| Brassica rapa mRNA for putative ribosomal protein,... 76 1e-10
44dbj|AP006076.1| Lotus japonicus genomic DNA, chromosome 6, clone... 74 6e-10
45ref|XM_570222.1| Cryptococcus neoformans var. neoformans JEC21 4... 68 3e-08
46emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, ... 68 3e-08
47emb|AL031004.1|ATF28M20 Arabidopsis thaliana DNA chromosome 4, B... 68 3e-08
48ref|XM_654476.1| Aspergillus nidulans FGSC A4 hypothetical prote... 60 8e-06
49dbj|AK109085.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 8e-06
50gb|AC146855.5| Medicago truncatula clone mth2-16c23, complete se... 58 3e-05
51gb|AC149801.3| Medicago truncatula chromosome 2 BAC clone mth2-3... 58 3e-05
52gb|AF294917.1|AF294917 Aplysia californica ribosomal protein S6 ... 58 3e-05
53gb|AF525803.1| Chlamys farreri ribosomal protein S6-like mRNA, p... 56 1e-04
54ref|XM_751713.1| Ustilago maydis 521 hypothetical protein (UM006... 52 0.002
55ref|XM_746654.1| Aspergillus fumigatus Af293 40S ribosomal prote... 52 0.002
56dbj|AB226198.1| Aspergillus oryzae cDNA, contig sequence: AoEST3057 48 0.032
57dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 48 0.032
58emb|AJ438987.1|PLI438987 Paracentrotus lividus mRNA for S6 ribos... 48 0.032
59gb|AY752838.1| Culicoides sonorensis clone CsRPS6A ribosomal pro... 46 0.13
60gb|AY237125.1| Telmatoscopus sp. AMF-2003 ribosomal protein S6 m... 46 0.13
61gb|AY095266.1| Culicoides sonorensis RPS6 mRNA, partial cds 46 0.13
62emb|X68050.1|NTRPS6 N.tabacum mRNA for ribosomal protein S6 46 0.13
63ref|XM_360693.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.50
64ref|XM_867656.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 44 0.50
65ref|XM_505593.1| Yarrowia lipolytica CLIB122, YALI0F18766g predi... 42 2.0
66gb|AC092437.4| Homo sapiens BAC clone RP11-326I19 from 4, comple... 42 2.0
67gb|AC067728.25| Homo sapiens 3 BAC RP11-117F22 (Roswell Park Can... 42 2.0
68dbj|AP000757.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 42 2.0
69dbj|AP001554.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.0
70emb|CT033435.1| Platynereis dumerilii EST IB0AAA20BE05EM1 42 2.0
71emb|CT033434.1| Platynereis dumerilii EST IB0AAA20BE05FM1 42 2.0
72emb|CT033340.1| Platynereis dumerilii EST IB0AAA22BC10EM1 42 2.0
73emb|CT033339.1| Platynereis dumerilii EST IB0AAA22BC10FM1 42 2.0
74emb|CT033115.1| Platynereis dumerilii EST IB0AAA26BH05EM1 42 2.0
75emb|CT033114.1| Platynereis dumerilii EST IB0AAA26BH05FM1 42 2.0
76emb|CT032815.1| Platynereis dumerilii EST IB0AAA31AB08EM1 42 2.0
77emb|CT032814.1| Platynereis dumerilii EST IB0AAA31AB08FM1 42 2.0
78emb|CT032774.1| Platynereis dumerilii EST IB0AAA31DB11EM1 42 2.0
79emb|CT032738.1| Platynereis dumerilii EST IB0AAA32CB08EM1 42 2.0
80emb|CT032539.1| Platynereis dumerilii EST IB0AAA36DA11EM1 42 2.0
81emb|CT032538.1| Platynereis dumerilii EST IB0AAA36DA11FM1 42 2.0
82emb|CT032484.1| Platynereis dumerilii EST IB0AAA37CB10EM1 42 2.0
83emb|CT032483.1| Platynereis dumerilii EST IB0AAA37CB10FM1 42 2.0
84emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 42 2.0
85gb|AC092189.3| Drosophila melanogaster clone BACR34M11, complete... 40 7.9
86gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 40 7.9
87gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, comp... 40 7.9
88gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome... 40 7.9
89ref|XM_842713.1| Leishmania major strain Friedlin hypothetical p... 40 7.9
90ref|XM_842723.1| Leishmania major strain Friedlin hypothetical p... 40 7.9
91gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome... 40 7.9
92gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosom... 40 7.9
93ref|XM_775406.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.9
94ref|XM_796910.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.9
95emb|AJ439463.2|OOS439463 Ostertagia ostertagi mRNA for metallopr... 40 7.9
96emb|AJ419180.1|OOS419180 Ostertagia ostertagi partial mRNA for m... 40 7.9
97emb|CR938364.1| Single read from an extremity of a full-length c... 40 7.9
98emb|CR938363.1| Single read from an extremity of a full-length c... 40 7.9
99gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R... 40 7.9
100gb|DQ399013.1| Ictalurus punctatus clone SAE03 hypothetical prot... 40 7.9
101gb|AF154067.1|AF154067 Aedes aegypti ribosomal protein S6 mRNA, ... 40 7.9
102gb|AF154066.1|AF154066 Aedes albopictus ribosomal protein S6 (rp... 40 7.9
103gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g... 40 7.9
104gb|AC115949.13| Mus musculus chromosome 3, clone RP24-568B16, co... 40 7.9
105gb|AY924261.1| Aedes aegypti ribosomal protein S6 gene, partial cds 40 7.9
106gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 ... 40 7.9
107gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 7.9
108gb|AC138025.4| Mus musculus BAC clone RP24-430F5 from 8, complet... 40 7.9
109gb|AC004369.1|AC004369 Drosophila melanogaster DNA sequence (P1 ... 40 7.9

>ref|NM_189879.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1077

 Score =  476 bits (240), Expect = e-131
 Identities = 354/392 (90%)
 Strand = Plus / Minus

                                                                       
Query: 168 agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
           ||||||||  |||| ||| ||||| ||||||||||| |||| |||||| |||||||| ||
Sbjct: 826 agccttggcagcagaagaaagcttggacctcctctttgccaagctctcgctccggcgttc 767

                                                                       
Query: 228 cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
           |||||||||||| |||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 766 cctctgctccttgagcctctgggcaagaagcttctggtactcagcagcctccgacttctt 707

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           |||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||
Sbjct: 706 cttggcgatcctcttcttcttgtcagcgattctggcacgcttcctctggagggtgagggg 647

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
           ||||||||||||||||||||| || ||||||||||||||||| || |||||| ||  |||
Sbjct: 646 agtcacaagacgctggatcttaggagccttgctcaccttcttgccattcttggtagtgaa 587

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            ||||||||||| |||||||||||  ||||||||||||||||||||  ||||||||| ||
Sbjct: 586 tgtcctgcggtaggtgttgacatatttgcggacatcatcatccttggaaaggttgaagag 527

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 526 cttcctgatcttggaggccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 467

                                           
Query: 528 gcctggtagatcattctcacccttcttgacaa 559
           ||| || || ||||||||||||||||||||||
Sbjct: 466 gccaggcaggtcattctcacccttcttgacaa 435



to top

>dbj|AK069465.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022D14, full
           insert sequence
          Length = 1078

 Score =  476 bits (240), Expect = e-131
 Identities = 354/392 (90%)
 Strand = Plus / Minus

                                                                       
Query: 168 agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
           ||||||||  |||| ||| ||||| ||||||||||| |||| |||||| |||||||| ||
Sbjct: 827 agccttggcagcagaagaaagcttggacctcctctttgccaagctctcgctccggcgttc 768

                                                                       
Query: 228 cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
           |||||||||||| |||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 767 cctctgctccttgagcctctgggcaagaagcttctggtactcagcagcctccgacttctt 708

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           |||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||
Sbjct: 707 cttggcgatcctcttcttcttgtcagcgattctggcacgcttcctctggagggtgagggg 648

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
           ||||||||||||||||||||| || ||||||||||||||||| || |||||| ||  |||
Sbjct: 647 agtcacaagacgctggatcttaggagccttgctcaccttcttgccattcttggtagtgaa 588

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            ||||||||||| |||||||||||  ||||||||||||||||||||  ||||||||| ||
Sbjct: 587 tgtcctgcggtaggtgttgacatatttgcggacatcatcatccttggaaaggttgaagag 528

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 cttcctgatcttggaggccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 468

                                           
Query: 528 gcctggtagatcattctcacccttcttgacaa 559
           ||| || || ||||||||||||||||||||||
Sbjct: 467 gccaggcaggtcattctcacccttcttgacaa 436



to top

>gb|U92045.1|ZMU92045 Zea mays ribosomal protein S6 RPS6-1 (rps6-1) mRNA, complete cds
          Length = 1039

 Score =  387 bits (195), Expect = e-104
 Identities = 359/411 (87%), Gaps = 2/411 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
           |||||||| ||| ||||| ||||| |||||||||||||||| |||||| |||||||| ||
Sbjct: 804 agccttggcggcggcagaaagcttggacctcctcttggccaagctctcgctccggcggtc 745

                                                                       
Query: 228 cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
            ||||| |||||||||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 744 tctctgttccttcagcctctgggcaagaagcttctggtactcagcagcctcagacttctt 685

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           ||| |  ||||||||||||||||| || ||||| ||||||||||||||||||||||||||
Sbjct: 684 cttagttatcctcttcttcttgtcagcgattctagcacgcttcctctggagggtcaaggg 625

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
            |||||||| || |||||||| || |||||||| |||||||| || |||||| ||  |||
Sbjct: 624 tgtcacaagccgttggatcttaggtgccttgctgaccttcttgccgttcttggtagtgaa 565

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            ||||||||||||||||| || ||  |||| |||||||||||||||  ||||||||| ||
Sbjct: 564 tgtcctgcggtatgtgttcacgtacttgcgtacatcatcatccttgttaaggttgaacag 505

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||  ||||||| || ||||||||||| ||||||||||| ||||||||||||||||| ||
Sbjct: 504 ctttctgatcttggaggccctcttgggacccctcatccttggcttctcagtgtcagtcag 445

                                                              
Query: 528 gcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
            || || |||||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 444 accaggcagatcattctcacccttcttcac-aatca-ccaagttgataaca 396



to top

>gb|AF295599.1| Zea mays ribosomal protein s6 RPS6-2 (rps6-2) mRNA, complete cds
          Length = 1023

 Score =  373 bits (188), Expect = e-100
 Identities = 356/411 (86%), Gaps = 2/411 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
           |||||||| ||| ||||| ||||| |||||||||||||||| ||||||||| ||||| ||
Sbjct: 803 agccttggcggcggcagaaagcttagacctcctcttggccaagctctcactgcggcggtc 744

                                                                       
Query: 228 cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
           |||||| || ||||||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 743 cctctgttctttcagcctctgggcaagaagcttctggtactcagcagcctcagacttctt 684

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           ||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 683 cttagcgatcctcttcttcttgtcagcaattctagcacgcttcctctggagggtcaaggg 624

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
            |||||||| ||||||||||| || ||||||||||||||||| || |||||| ||  |||
Sbjct: 623 ggtcacaagccgctggatcttaggtgccttgctcaccttcttgccattcttggtagtgaa 564

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            ||||||||||| ||||| || ||  |||| || || ||||||||  |||| ||||| ||
Sbjct: 563 tgtcctgcggtacgtgttcacgtacttgcgcacgtcgtcatcctttgcaagattgaacag 504

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||| ||||||| || ||||| ||||| ||||||||||| ||||||||||||||||| | 
Sbjct: 503 cttcctgatcttggaggcccttttgggacccctcatccttggcttctcagtgtcagttaa 444

                                                              
Query: 528 gcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
            || || ||||| |||||||||||||| |||| |   ||||||||||||||
Sbjct: 443 accaggcagatcgttctcacccttcttaacaatta--ccaagttgataaca 395



to top

>gb|AY103674.1| Zea mays PCO104001 mRNA sequence
          Length = 1198

 Score =  373 bits (188), Expect = e-100
 Identities = 356/411 (86%), Gaps = 2/411 (0%)
 Strand = Plus / Minus

                                                                       
Query: 168 agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
           |||||||| ||| ||||| ||||| |||||||||||||||| ||||||||| ||||| ||
Sbjct: 931 agccttggcggcggcagaaagcttagacctcctcttggccaagctctcactgcggcggtc 872

                                                                       
Query: 228 cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
           |||||| || ||||||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 871 cctctgttctttcagcctctgggcaagaagcttctggtactcagcagcctcagacttctt 812

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           ||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 811 cttagcgatcctcttcttcttgtcagcaattctagcacgcttcctctggagggtcaaggg 752

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
            |||||||| ||||||||||| || ||||||||||||||||| || |||||| ||  |||
Sbjct: 751 ggtcacaagccgctggatcttaggtgccttgctcaccttcttgccattcttggtagtgaa 692

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            ||||||||||| ||||| || ||  |||| || || ||||||||  |||| ||||| ||
Sbjct: 691 tgtcctgcggtacgtgttcacgtacttgcgcacgtcgtcatcctttgcaagattgaacag 632

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||| ||||||| || ||||| ||||| ||||||||||| ||||||||||||||||| | 
Sbjct: 631 cttcctgatcttggaggcccttttgggacccctcatccttggcttctcagtgtcagttaa 572

                                                              
Query: 528 gcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
            || || ||||| |||||||||||||| |||| |   ||||||||||||||
Sbjct: 571 accaggcagatcgttctcacccttcttaacaatta--ccaagttgataaca 523



to top

>ref|XM_470801.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 983

 Score =  369 bits (186), Expect = 7e-99
 Identities = 353/406 (86%), Gaps = 2/406 (0%)
 Strand = Plus / Minus

                                                                       
Query: 173 tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
           ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 771 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 712

                                                                       
Query: 233 gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
           ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 711 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 652

                                                                       
Query: 293 cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
           | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 651 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 592

                                                                       
Query: 353 caagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcc 412
           |||| | ||||||||| || |||||||| |||||||| || |||||| ||  |||||| |
Sbjct: 591 caagcctctggatcttaggagccttgctaaccttcttgccgttcttggtagtgaaggttc 532

                                                                       
Query: 413 tgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttct 472
           ||||||| |||||||||||  |||||||||||||||||||| ||||||| || |||||| 
Sbjct: 531 tgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaacagcttcc 472

                                                                       
Query: 473 tgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctg 532
           ||||||| || ||||||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 471 tgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagtcaagccag 412

                                                         
Query: 533 gtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
           | || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 411 gaaggtcattatcacccttctttac-aatca-ccaagttgataaca 368



to top

>dbj|AK121621.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033045B01, full
           insert sequence
          Length = 1018

 Score =  369 bits (186), Expect = 7e-99
 Identities = 353/406 (86%), Gaps = 2/406 (0%)
 Strand = Plus / Minus

                                                                       
Query: 173 tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
           ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 769 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 710

                                                                       
Query: 233 gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
           ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 709 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 650

                                                                       
Query: 293 cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
           | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 649 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 590

                                                                       
Query: 353 caagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcc 412
           |||| | ||||||||| || |||||||| |||||||| || |||||| ||  |||||| |
Sbjct: 589 caagcctctggatcttaggagccttgctaaccttcttgccgttcttggtagtgaaggttc 530

                                                                       
Query: 413 tgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttct 472
           ||||||| |||||||||||  |||||||||||||||||||| ||||||| || |||||| 
Sbjct: 529 tgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaacagcttcc 470

                                                                       
Query: 473 tgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctg 532
           ||||||| || ||||||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 469 tgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagtcaagccag 410

                                                         
Query: 533 gtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
           | || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 409 gaaggtcattatcacccttctttac-aatca-ccaagttgataaca 366



to top

>dbj|AK061827.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C07, full
           insert sequence
          Length = 990

 Score =  369 bits (186), Expect = 7e-99
 Identities = 353/406 (86%), Gaps = 2/406 (0%)
 Strand = Plus / Minus

                                                                       
Query: 173 tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
           ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 768 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 709

                                                                       
Query: 233 gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
           ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 708 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 649

                                                                       
Query: 293 cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
           | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 648 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 589

                                                                       
Query: 353 caagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcc 412
           |||| | ||||||||| || |||||||| |||||||| || |||||| ||  |||||| |
Sbjct: 588 caagcctctggatcttaggagccttgctaaccttcttgccgttcttggtagtgaaggttc 529

                                                                       
Query: 413 tgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttct 472
           ||||||| |||||||||||  |||||||||||||||||||| ||||||| || |||||| 
Sbjct: 528 tgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaacagcttcc 469

                                                                       
Query: 473 tgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctg 532
           ||||||| || ||||||||||||||||||||||||||||||||||||||||| | ||| |
Sbjct: 468 tgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagtcaagccag 409

                                                         
Query: 533 gtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
           | || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 408 gaaggtcattatcacccttctttac-aatca-ccaagttgataaca 365



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  281 bits (142), Expect = 1e-72
 Identities = 202/222 (90%)
 Strand = Plus / Minus

                                                                            
Query: 168      agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
                ||||||||  |||| ||| ||||| ||||||||||| |||| |||||| |||||||| ||
Sbjct: 25671571 agccttggcagcagaagaaagcttggacctcctctttgccaagctctcgctccggcgttc 25671512

                                                                            
Query: 228      cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
                |||||||||||| |||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 25671511 cctctgctccttgagcctctgggcaagaagcttctggtactcagcagcctccgacttctt 25671452

                                                                            
Query: 288      cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
                |||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||
Sbjct: 25671451 cttggcgatcctcttcttcttgtcagcgattctggcacgcttcctctggagggtgagggg 25671392

                                                          
Query: 348      agtcacaagacgctggatcttgggggccttgctcaccttctt 389
                ||||||||||||||||||||| || |||||||||||||||||
Sbjct: 25671391 agtcacaagacgctggatcttaggagccttgctcaccttctt 25671350



 Score =  204 bits (103), Expect = 2e-49
 Identities = 139/151 (92%)
 Strand = Plus / Minus

                                                                            
Query: 409      gtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagc 468
                ||||||||||| |||||||||||  ||||||||||||||||||||  ||||||||| |||
Sbjct: 25671127 gtcctgcggtaggtgttgacatatttgcggacatcatcatccttggaaaggttgaagagc 25671068

                                                                            
Query: 469      ttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaagg 528
                ||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 25671067 ttcctgatcttggaggccctcttgggtcccctcatcctgggcttctcagtgtcagtaagg 25671008

                                               
Query: 529      cctggtagatcattctcacccttcttgacaa 559
                || || || ||||||||||||||||||||||
Sbjct: 25671007 ccaggcaggtcattctcacccttcttgacaa 25670977



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0594D10
          Length = 143200

 Score =  281 bits (142), Expect = 1e-72
 Identities = 202/222 (90%)
 Strand = Plus / Minus

                                                                          
Query: 168    agccttggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatc 227
              ||||||||  |||| ||| ||||| ||||||||||| |||| |||||| |||||||| ||
Sbjct: 125544 agccttggcagcagaagaaagcttggacctcctctttgccaagctctcgctccggcgttc 125485

                                                                          
Query: 228    cctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttctt 287
              |||||||||||| |||||||| ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 125484 cctctgctccttgagcctctgggcaagaagcttctggtactcagcagcctccgacttctt 125425

                                                                          
Query: 288    cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
              |||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||
Sbjct: 125424 cttggcgatcctcttcttcttgtcagcgattctggcacgcttcctctggagggtgagggg 125365

                                                        
Query: 348    agtcacaagacgctggatcttgggggccttgctcaccttctt 389
              ||||||||||||||||||||| || |||||||||||||||||
Sbjct: 125364 agtcacaagacgctggatcttaggagccttgctcaccttctt 125323



 Score =  204 bits (103), Expect = 2e-49
 Identities = 139/151 (92%)
 Strand = Plus / Minus

                                                                          
Query: 409    gtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagc 468
              ||||||||||| |||||||||||  ||||||||||||||||||||  ||||||||| |||
Sbjct: 125100 gtcctgcggtaggtgttgacatatttgcggacatcatcatccttggaaaggttgaagagc 125041

                                                                          
Query: 469    ttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaagg 528
              ||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125040 ttcctgatcttggaggccctcttgggtcccctcatcctgggcttctcagtgtcagtaagg 124981

                                             
Query: 529    cctggtagatcattctcacccttcttgacaa 559
              || || || ||||||||||||||||||||||
Sbjct: 124980 ccaggcaggtcattctcacccttcttgacaa 124950



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  200 bits (101), Expect = 4e-48
 Identities = 188/217 (86%)
 Strand = Plus / Plus

                                                                            
Query: 173      tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
                ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 15460637 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 15460696

                                                                            
Query: 233      gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
                ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 15460697 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 15460756

                                                                            
Query: 293      cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
                | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 15460757 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 15460816

                                                     
Query: 353      caagacgctggatcttgggggccttgctcaccttctt 389
                |||| | ||||||||| || |||||||| ||||||||
Sbjct: 15460817 caagcctctggatcttaggagccttgctaaccttctt 15460853



 Score =  178 bits (90), Expect = 1e-41
 Identities = 155/174 (89%), Gaps = 2/174 (1%)
 Strand = Plus / Plus

                                                                            
Query: 405      gaaggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaa 464
                |||||| |||||||| |||||||||||  |||||||||||||||||||| ||||||| ||
Sbjct: 15461102 gaaggttctgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaa 15461161

                                                                            
Query: 465      aagcttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagt 524
                 |||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 15461162 cagcttcctgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagt 15461221

                                                                      
Query: 525      aaggcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
                 | ||| || || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 15461222 caagccaggaaggtcattatcacccttctttac-aatca-ccaagttgataaca 15461273



to top

>gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genomic sequence, complete
             sequence
          Length = 164705

 Score =  200 bits (101), Expect = 4e-48
 Identities = 188/217 (86%)
 Strand = Plus / Minus

                                                                         
Query: 173   tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
             ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 40889 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 40830

                                                                         
Query: 233   gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
             ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 40829 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 40770

                                                                         
Query: 293   cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
             | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 40769 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 40710

                                                  
Query: 353   caagacgctggatcttgggggccttgctcaccttctt 389
             |||| | ||||||||| || |||||||| ||||||||
Sbjct: 40709 caagcctctggatcttaggagccttgctaaccttctt 40673



 Score =  178 bits (90), Expect = 1e-41
 Identities = 155/174 (89%), Gaps = 2/174 (1%)
 Strand = Plus / Minus

                                                                         
Query: 405   gaaggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaa 464
             |||||| |||||||| |||||||||||  |||||||||||||||||||| ||||||| ||
Sbjct: 40424 gaaggttctgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaa 40365

                                                                         
Query: 465   aagcttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagt 524
              |||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 40364 cagcttcctgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagt 40305

                                                                   
Query: 525   aaggcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
              | ||| || || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 40304 caagccaggaaggtcattatcacccttctttac-aatca-ccaagttgataaca 40253



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  200 bits (101), Expect = 4e-48
 Identities = 188/217 (86%)
 Strand = Plus / Plus

                                                                            
Query: 173      tggtggcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctct 232
                ||||||||||||| ||||| ||||||||||| |||| ||||||||||| ||| |||||||
Sbjct: 15455171 tggtggcagcagaaagcttggacctcctctttgccaagctctcactcctgcgttccctct 15455230

                                                                            
Query: 233      gctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttgg 292
                ||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 15455231 gctccttgagcctctgggcaagcagcttctggtactcggcagcctcggacttcttcttgg 15455290

                                                                            
Query: 293      cgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtca 352
                | || || | |||||| | ||| ||||| || | ||||||||| || |||| |||||| |
Sbjct: 15455291 caattctttgcttcttctgggcgattctcgccctcttcctctgaagagtcaggggagtga 15455350

                                                     
Query: 353      caagacgctggatcttgggggccttgctcaccttctt 389
                |||| | ||||||||| || |||||||| ||||||||
Sbjct: 15455351 caagcctctggatcttaggagccttgctaaccttctt 15455387



 Score =  178 bits (90), Expect = 1e-41
 Identities = 155/174 (89%), Gaps = 2/174 (1%)
 Strand = Plus / Plus

                                                                            
Query: 405      gaaggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaa 464
                |||||| |||||||| |||||||||||  |||||||||||||||||||| ||||||| ||
Sbjct: 15455636 gaaggttctgcggtaagtgttgacatacttgcggacatcatcatccttggcaaggttaaa 15455695

                                                                            
Query: 465      aagcttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagt 524
                 |||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 15455696 cagcttcctgatcttagatgccctcttgggtcccctcatcctgggcttctcagtgtcagt 15455755

                                                                      
Query: 525      aaggcctggtagatcattctcacccttcttgacaaatcacccaagttgataaca 578
                 | ||| || || ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 15455756 caagccaggaaggtcattatcacccttctttac-aatca-ccaagttgataaca 15455807



to top

>emb|AJ277533.1|AOF277533 Asparagus officinalis mRNA for S6 ribosomal protein (rps6 gene)
          Length = 959

 Score =  172 bits (87), Expect = 8e-40
 Identities = 276/339 (81%)
 Strand = Plus / Minus

                                                                       
Query: 178 gcagcagacagcttcgacctcctcttggccatgctctcactccggcgatccctctgctcc 237
           |||||||| ||| | |||||| |||| |||| ||||||||| || || ||||||||||||
Sbjct: 750 gcagcagagagcctggacctcttctttgccaagctctcactgcgtcggtccctctgctcc 691

                                                                       
Query: 238 ttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttcttggcgatc 297
           || ||||||   ||||| ||||||||||| |||||||| || || ||   |||||| |  
Sbjct: 690 ttgagcctcgaggcaaggagcttctggtattctgcagcttcagatttggccttggcaact 631

                                                                       
Query: 298 ctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaaga 357
           ||||||||||| || ||||||||||| |||||||| || | |||||||||||||||||| 
Sbjct: 630 ctcttcttcttctctgcaattctggctcgcttcctttgcaaggtcaagggagtcacaagc 571

                                                                       
Query: 358 cgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcgg 417
           | |||||| || || ||||| ||     ||||||| |||||||||  ||||||||| |||
Sbjct: 570 ctctggatttttggtgccttactgcaggtctttcctttcttgttagtgaaggtcctacgg 511

                                                                       
Query: 418 tatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatc 477
           || |||||||||||  |||| |||||||| |||||   ||||||||| |||||   ||| 
Sbjct: 510 taagtgttgacatacttgcgtacatcatcttccttagaaaggttgaacagcttacggatt 451

                                                  
Query: 478 ttcgaagccctcttgggtcccctcatcctgggcttctca 516
           || || |||||||| ||||| |||||||| |||||||||
Sbjct: 450 ttggaggccctcttaggtcctctcatccttggcttctca 412



to top

>ref|NM_121074.2| Arabidopsis thaliana EMB3010; structural constituent of ribosome
           AT5G10360 (EMB3010) mRNA, complete cds
          Length = 1095

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 795 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 736

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 735 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 676

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 675 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 616

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 615 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 556

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 555 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 496

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 495 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 436

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 435 ttcacaa 429



to top

>gb|AY093783.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, complete cds
          Length = 750

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 710 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 651

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 650 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 591

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 590 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 531

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 530 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 471

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 470 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 411

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 410 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 351

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 350 ttcacaa 344



to top

>gb|AY057634.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, complete cds
          Length = 993

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 795 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 736

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 735 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 676

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 675 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 616

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 615 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 556

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 555 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 496

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 495 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 436

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 435 ttcacaa 429



to top

>gb|AY045594.1| Arabidopsis thaliana AT5g10360/F12B17_290 mRNA, complete cds
          Length = 993

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 795 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 736

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 735 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 676

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 675 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 616

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 615 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 556

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 555 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 496

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 495 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 436

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 435 ttcacaa 429



to top

>emb|BX832002.1|CNS0A26R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZC11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 969

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 778 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 719

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 718 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 659

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 658 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 599

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 598 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 539

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 538 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 479

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 478 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 419

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 418 ttcacaa 412



to top

>emb|BX830696.1|CNS0A0OB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS15ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 947

 Score =  165 bits (83), Expect = 2e-37
 Identities = 296/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 776 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 717

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 716 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 657

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 656 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 597

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 596 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 537

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 536 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 477

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 476 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 417

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 416 ttcacaa 410



to top

>gb|DQ191669.1| Solanum tuberosum ribosomal protein S6-like protein mRNA, complete
           cds
          Length = 1032

 Score =  151 bits (76), Expect = 3e-33
 Identities = 247/304 (81%)
 Strand = Plus / Minus

                                                                       
Query: 256 agcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcggca 315
           |||||||| || || ||||| ||||||||   |||||| || ||||||||||||||||||
Sbjct: 698 agcttctgataatcagcagcttctgacttagccttggcaattctcttcttcttgtcggca 639

                                                                       
Query: 316 attctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggggcc 375
           ||||| || | |||||||||||| ||||| || || || || | ||||||||| || |||
Sbjct: 638 attcttgctctcttcctctggagagtcaatggtgttaccagcctctggatcttaggagcc 579

                                                                       
Query: 376 ttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatagctg 435
           ||||| ||||  || ||||| |||||   ||| || | ||| || |||||||||||  | 
Sbjct: 578 ttgctaacctctttcccctttttgtttgtgaatgttcggcgataggtgttgacatacttc 519

                                                                       
Query: 436 cggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttgggt 495
           |  ||||| |||||||| ||||||||||| |||||| | ||||| |||||||| ||||| 
Sbjct: 518 ctaacatcgtcatcctttccaaggttgaagagcttcctaatcttggaagcccttttggga 459

                                                                       
Query: 496 cccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttcttg 555
           || |||||||| || || |||||||| || || || || |||||||||||||||||||| 
Sbjct: 458 cctctcatcctaggtttttcagtgtctgtcagtccgggcagatcattctcacccttcttc 399

               
Query: 556 acaa 559
           ||||
Sbjct: 398 acaa 395



to top

>emb|Y14052.1|ATY14052 Arabidopsis thaliana mRNA for ribosomal protein S6
          Length = 957

 Score =  151 bits (76), Expect = 3e-33
 Identities = 223/272 (81%)
 Strand = Plus / Minus

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           |||||| || |||||||||||||| |||||||| || | |||||||||||||||||| ||
Sbjct: 615 cttggctattctcttcttcttgtcagcaattctagctctcttcctctggagggtcaatgg 556

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
           ||||||||| | ||||||||| || |||||||| |||||||| |||||||||||   |||
Sbjct: 555 agtcacaagcctctggatcttaggagccttgctaaccttcttgcccttcttgtttgtgaa 496

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
           ||| | |||||| ||||| || ||  | |  |||||||| || || |||||||| || | 
Sbjct: 495 ggtacggcggtaagtgttaacgtacttcctcacatcatcctcttttccaaggttaaacaa 436

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||   |||||| || ||||||||||| || ||||| || |||||||||||||| |||||
Sbjct: 435 cttgcggatctttgatgccctcttgggacctctcattcttggcttctcagtgtcggtaag 376

                                           
Query: 528 gcctggtagatcattctcacccttcttgacaa 559
            || || |||||| |  |||||||||| ||||
Sbjct: 375 cccgggaagatcacttacacccttcttcacaa 344



to top

>emb|BX832475.1|CNS0A24D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH75ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 645

 Score =  149 bits (75), Expect = 1e-32
 Identities = 270/335 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 446 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 387

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 386 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 327

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | ||||||||||||||| || ||||||||||| | ||||||||| || 
Sbjct: 326 gcaattctagctctcttcctctggagggtaaatggagtcacaagcctctggatcttagga 267

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 266 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 207

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 206 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 147

                                              
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaag 527
           || || ||||| || |||||||||||||| |||||
Sbjct: 146 ggacctctcattcttggcttctcagtgtcggtaag 112



to top

>emb|BX832457.1|CNS0A241 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 689

 Score =  149 bits (75), Expect = 1e-32
 Identities = 270/335 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 456 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 397

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 396 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 337

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||| ||||| | ||||||||| || 
Sbjct: 336 gcaattctagctctcttcctctggagggtcaatggagtaacaagcctctggatcttagga 277

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||   |||||| | |||||| ||||| || || 
Sbjct: 276 gccttgctaaccttcttgcccttcttgtttgtgaaggtacggcggtaagtgttaacgtac 217

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 216 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 157

                                              
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaag 527
           || || ||||| || |||||||||||||| |||||
Sbjct: 156 ggacctctcattcttggcttctcagtgtcggtaag 122



to top

>emb|BX829995.1|CNS0A1FC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB52ZB07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 981

 Score =  149 bits (75), Expect = 1e-32
 Identities = 294/367 (80%)
 Strand = Plus / Minus

                                                                       
Query: 193 gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
           |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 776 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 717

                                                                       
Query: 253 agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
           || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 716 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 657

                                                                       
Query: 313 gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
           |||||||| || | |||||||||||||||||| ||||| ||||| | ||||||||| || 
Sbjct: 656 gcaattctagctctcttcctctggagggtcaatggagttacaagcctctggatcttagga 597

                                                                       
Query: 373 gccttgctcaccttctttcccttcttgttaaggaaggtcctgcggtatgtgttgacatag 432
           |||||||| |||||||| |||||||||||    ||||| | |||||| ||||| || || 
Sbjct: 596 gccttgctaaccttcttgcccttcttgtttgttaaggtacggcggtaagtgttaacgtac 537

                                                                       
Query: 433 ctgcggacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttg 492
            | |  |||||||| || || |||||||| || | |||   |||||| || |||||||||
Sbjct: 536 ttcctcacatcatcctcttttccaaggttaaacaacttgcggatctttgatgccctcttg 477

                                                                       
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttc 552
           || || ||||| || |||||||||||||| ||||| || || |||||| |  ||||||||
Sbjct: 476 ggacctctcattcttggcttctcagtgtcggtaagcccgggaagatcacttacacccttc 417

                  
Query: 553 ttgacaa 559
           || ||||
Sbjct: 416 ttcacaa 410



to top

>gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clone KBrH004D11, complete
             sequence
          Length = 106476

 Score =  123 bits (62), Expect = 7e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                         
Query: 193   gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
             |||||| |||||||||  |||||||| |||||||| | ||||||||| |||||    || 
Sbjct: 89251 gacctcttcttggccaaactctcactacggcgatcacgctgctccttaagcctggaggcg 89310

                                                                         
Query: 253   agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
             || |||||||||||||| || || || |  ||   ||| || ||||||||||||||||||
Sbjct: 89311 agaagcttctggtactcagccgcatcagcgttagccttagcaatcctcttcttcttgtcg 89370

                                                                         
Query: 313   gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
             |||||||| || | ||||||||| || ||||| ||||||||||| | |||||||||||||
Sbjct: 89371 gcaattctagctctcttcctctgaagagtcaaaggagtcacaagcctctggatcttgggg 89430

                                           
Query: 373   gccttgctcaccttctttcccttcttgtta 402
             || |||||||| | ||| || |||||||||
Sbjct: 89431 gctttgctcacttccttacctttcttgtta 89460



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 104/122 (85%), Gaps = 1/122 (0%)
 Strand = Plus / Plus

                                                                         
Query: 438   gacatcatcatccttgccaaggttgaaaagcttcttgatcttcgaagccctcttgggtcc 497
             ||||||||||||||| ||||||||||| || ||   |||||| ||||| ||||| |||||
Sbjct: 89508 gacatcatcatcctttccaaggttgaacagtttacggatcttagaagctctcttaggtcc 89567

                                                                         
Query: 498   cctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttcttgac 557
             ||||||||| |||||||| || || ||||| || || ||||| |||| ||||||||||||
Sbjct: 89568 cctcatcctcggcttctcggtatcggtaagcccgggaagatccttct-acccttcttgac 89626

               
Query: 558   aa 559
             ||
Sbjct: 89627 aa 89628



to top

>emb|AL353995.1|ATF12B17 Arabidopsis thaliana DNA chromosome 5, BAC clone F12B17 (ESSA project)
          Length = 113053

 Score =  121 bits (61), Expect = 3e-24
 Identities = 163/197 (82%)
 Strand = Plus / Minus

                                                                          
Query: 193    gacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgca 252
              |||||| |||||||||  || ||||| |||||||| | ||||||||| || ||    |||
Sbjct: 106087 gacctcttcttggccaaactttcactacggcgatcacgctgctcctttagtctggaggca 106028

                                                                          
Query: 253    agcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcg 312
              || ||||||||||| || || || || || ||   ||||||||| |||||||||||||| 
Sbjct: 106027 agaagcttctggtaatcagctgcatcagagttagccttggcgattctcttcttcttgtca 105968

                                                                          
Query: 313    gcaattctggcacgcttcctctggagggtcaagggagtcacaagacgctggatcttgggg 372
              |||||||| || | |||||||||||||||||| ||||||||||| | ||||||||| || 
Sbjct: 105967 gcaattctagctctcttcctctggagggtcaatggagtcacaagcctctggatcttagga 105908

                               
Query: 373    gccttgctcaccttctt 389
              |||||||| ||||||||
Sbjct: 105907 gccttgctaaccttctt 105891



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                          
Query: 474    gatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctgg 533
              |||||| || ||||||||||| || ||||| || |||||||||||||| ||||| || ||
Sbjct: 105719 gatctttgatgccctcttgggacctctcattcttggcttctcagtgtcggtaagcccggg 105660

                                        
Query: 534    tagatcattctcacccttcttgacaa 559
               |||||| |  |||||||||| ||||
Sbjct: 105659 aagatcacttacacccttcttcacaa 105634



to top

>gb|AY293401.1| Brassica napus ribosomal protein S6 (RPS6) mRNA, complete cds
          Length = 980

 Score =  115 bits (58), Expect = 2e-22
 Identities = 215/265 (81%), Gaps = 3/265 (1%)
 Strand = Plus / Minus

                                                                       
Query: 295 atcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcaca 354
           ||||||||||||||||| || ||||| || | ||||||||| |||||||| |||||||||
Sbjct: 665 atcctcttcttcttgtcagcgattctagctctcttcctctgaagggtcaacggagtcaca 606

                                                                       
Query: 355 agacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctg 414
           || | |||||||||||| || |||||||| | ||| || ||||||||   |||  | | |
Sbjct: 605 agcctctggatcttgggagctttgctcacttccttgcctttcttgtttgtgaacttgcgg 546

                                                                       
Query: 415 cggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttg 474
           ||||| |||||||| ||  | | ||||||||| |||||    | |||||| || ||   |
Sbjct: 545 cggtaagtgttgacgtacttcctgacatcatcctccttaatgaagttgaacagtttacgg 486

                                                                       
Query: 475 atcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggt 534
           ||||| ||||| |||||||||||||||||||  ||||| || ||||| ||||| || || 
Sbjct: 485 atcttggaagctctcttgggtcccctcatcc--ggctt-tcggtgtcggtaagcccggga 429

                                    
Query: 535 agatcattctcacccttcttgacaa 559
           ||||| |||||||||||||||||||
Sbjct: 428 agatccttctcacccttcttgacaa 404



to top

>ref|NM_119319.3| Arabidopsis thaliana RPS6 (RIBOSOMAL PROTEIN S6); structural
           constituent of ribosome AT4G31700 (RPS6) mRNA, complete
           cds
          Length = 993

 Score =  105 bits (53), Expect = 2e-19
 Identities = 209/261 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 615 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 556

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 555 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 496

                                                                       
Query: 419 atgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatct 478
           | |||||||||||| | | ||||||||| |||||    ||||| || || ||   |||||
Sbjct: 495 aagtgttgacataggtcctgacatcatcttccttcttgaggttaaacagtttacggatct 436

                                                                       
Query: 479 tcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagat 538
           | || || ||||| ||||| ||||| || ||||||||||| || ||||| || || ||||
Sbjct: 435 tggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccaggaagat 376

                                
Query: 539 cattctcacccttcttgacaa 559
           | |||||||||||||| ||||
Sbjct: 375 cgttctcacccttcttcacaa 355



to top

>gb|BT000693.1| Arabidopsis thaliana clone RAFL07-09-P18 (R10989) putative
           ribosomal protein S6 (At4g31700) mRNA, complete cds
          Length = 962

 Score =  105 bits (53), Expect = 2e-19
 Identities = 209/261 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 617 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 558

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 557 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 498

                                                                       
Query: 419 atgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatct 478
           | |||||||||||| | | ||||||||| |||||    ||||| || || ||   |||||
Sbjct: 497 aagtgttgacataggtcctgacatcatcttccttcttgaggttaaacagtttacggatct 438

                                                                       
Query: 479 tcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagat 538
           | || || ||||| ||||| ||||| || ||||||||||| || ||||| || || ||||
Sbjct: 437 tggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccaggaagat 378

                                
Query: 539 cattctcacccttcttgacaa 559
           | |||||||||||||| ||||
Sbjct: 377 cgttctcacccttcttcacaa 357



to top

>gb|AY113983.1| Arabidopsis thaliana putative ribosomal protein S6 (At4g31700)
           mRNA, complete cds
          Length = 784

 Score =  105 bits (53), Expect = 2e-19
 Identities = 209/261 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 604 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 545

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 544 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 485

                                                                       
Query: 419 atgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatct 478
           | |||||||||||| | | ||||||||| |||||    ||||| || || ||   |||||
Sbjct: 484 aagtgttgacataggtcctgacatcatcttccttcttgaggttaaacagtttacggatct 425

                                                                       
Query: 479 tcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagat 538
           | || || ||||| ||||| ||||| || ||||||||||| || ||||| || || ||||
Sbjct: 424 tggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccaggaagat 365

                                
Query: 539 cattctcacccttcttgacaa 559
           | |||||||||||||| ||||
Sbjct: 364 cgttctcacccttcttcacaa 344



to top

>gb|AY050803.1| Arabidopsis thaliana putative ribosomal protein S6 (At4g31700)
           mRNA, complete cds
          Length = 989

 Score =  105 bits (53), Expect = 2e-19
 Identities = 209/261 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 611 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 552

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 551 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 492

                                                                       
Query: 419 atgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatct 478
           | |||||||||||| | | ||||||||| |||||    ||||| || || ||   |||||
Sbjct: 491 aagtgttgacataggtcctgacatcatcttccttcttgaggttaaacagtttacggatct 432

                                                                       
Query: 479 tcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagat 538
           | || || ||||| ||||| ||||| || ||||||||||| || ||||| || || ||||
Sbjct: 431 tggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccaggaagat 372

                                
Query: 539 cattctcacccttcttgacaa 559
           | |||||||||||||| ||||
Sbjct: 371 cgttctcacccttcttcacaa 351



to top

>emb|BX826399.1|CNS0A4KZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 938

 Score =  105 bits (53), Expect = 2e-19
 Identities = 209/261 (80%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 600 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 541

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 540 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 481

                                                                       
Query: 419 atgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttgatct 478
           | |||||||||||| | | ||||||||| |||||    ||||| || || ||   |||||
Sbjct: 480 aagtgttgacataggtcctgacatcatcttccttcttgaggttaaacagtttacggatct 421

                                                                       
Query: 479 tcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagat 538
           | || || ||||| ||||| ||||| || ||||||||||| || ||||| || || ||||
Sbjct: 420 tggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccaggaagat 361

                                
Query: 539 cattctcacccttcttgacaa 559
           | |||||||||||||| ||||
Sbjct: 360 cgttctcacccttcttcacaa 340



to top

>gb|BT014411.1| Lycopersicon esculentum clone 133718F, mRNA sequence
          Length = 1067

 Score =  103 bits (52), Expect = 6e-19
 Identities = 124/148 (83%)
 Strand = Plus / Minus

                                                                       
Query: 412 ctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttc 471
           |||||||| |||||||||||  | | ||||||||| ||||||  ||| ||||| ||||| 
Sbjct: 554 ctgcggtaagtgttgacatacttcctgacatcatcttccttggaaagattgaagagcttt 495

                                                                       
Query: 472 ttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcct 531
            ||||||| |||||||| |||||||| |||||||| ||||| |||||||| || || || 
Sbjct: 494 ctgatcttggaagcccttttgggtcctctcatccttggcttttcagtgtcggtcagtcca 435

                                       
Query: 532 ggtagatcattctcacccttcttgacaa 559
           || ||||||||||| |||||||| ||||
Sbjct: 434 ggcagatcattctcccccttcttaacaa 407



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 gcaagcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttg 309
           ||||| |||||||| || || || |||||||||||   |||||| || ||||||||||||
Sbjct: 716 gcaagaagcttctgataatcagctgcctctgacttagccttggcaattctcttcttcttg 657

                      
Query: 310 tcggcaattct 320
           || ||||||||
Sbjct: 656 tcagcaattct 646



to top

>gb|BT014365.1| Lycopersicon esculentum clone 133651F, mRNA sequence
          Length = 1065

 Score =  103 bits (52), Expect = 6e-19
 Identities = 217/272 (79%)
 Strand = Plus / Minus

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           |||||| || |||||||||||||| || ||||| || | ||||||||| || ||||| ||
Sbjct: 686 cttggcaattctcttcttcttgtcagcgattcttgctctcttcctctgaagagtcaatgg 627

                                                                       
Query: 348 agtcacaagacgctggatcttgggggccttgctcaccttctttcccttcttgttaaggaa 407
            || || || | ||||||||| || |||||||| ||||  || ||||| |||||   |||
Sbjct: 626 tgttaccagcctctggatcttaggagccttgctaacctctttcccctttttgtttgtgaa 567

                                                                       
Query: 408 ggtcctgcggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaag 467
            || | ||| || ||||| |||||  | | |||||||||||| || ||||||||||| ||
Sbjct: 566 tgttcggcgataggtgttaacatacttcctgacatcatcatcttttccaaggttgaagag 507

                                                                       
Query: 468 cttcttgatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaag 527
           |||  | ||||| |||||||| |||||||| ||||| || || || |||||||| || ||
Sbjct: 506 cttgctaatcttggaagcccttttgggtcctctcattctaggtttttcagtgtctgtcag 447

                                           
Query: 528 gcctggtagatcattctcacccttcttgacaa 559
            || || ||||||||||| |||||||| ||||
Sbjct: 446 tccaggaagatcattctctcccttcttcacaa 415



to top

>emb|BX831797.1|CNS0A23Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH2ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 692

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 98/115 (85%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                       
Query: 288 cttggcgatcctcttcttcttgtcggcaattctggcacgcttcctctggagggtcaaggg 347
           ||||||||| |||||||||||||| |||||||| || | ||||||||||||||| || ||
Sbjct: 363 cttggcgattctcttcttcttgtcagcaattctagctctcttcctctggagggtaaatgg 304

                                                                  
Query: 348 agtcacaagacgc-tggatcttgggggccttgctcaccttctttcccttcttgtt 401
           |||||| |  ||  |||||||| ||  ||||||| |||||||| |||||||||||
Sbjct: 303 agtcaccaagcgtgtggatcttaggacccttgctaaccttcttgcccttcttgtt 249



to top

>emb|AJ010227.1|CAR010227 Cicer arietinum mRNA for 40S ribosomal protein S6, partial
          Length = 920

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 124/151 (82%)
 Strand = Plus / Minus

                                                                       
Query: 200 tcttggccatgctctcactccggcgatccctctgctccttcagcctctgtgcaagcagct 259
           |||| |||| ||||||||| ||||| ||||||||||||||||  ||   |||||| || |
Sbjct: 593 tctttgccaagctctcacttcggcgttccctctgctccttcaatctggatgcaaggagtt 534

                                                                       
Query: 260 tctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttgtcggcaattc 319
           | || |||||||| |||||||| ||   |||||| || ||||||||||| || |||||||
Sbjct: 533 tttgatactctgctgcctctgattttgccttggcaattctcttcttcttatctgcaattc 474

                                          
Query: 320 tggcacgcttcctctggagggtcaagggagt 350
           | || |||||||| ||||| ||||| |||||
Sbjct: 473 ttgctcgcttcctttggagtgtcaaaggagt 443



to top

>gb|AY105798.1| Zea mays PCO089449 mRNA sequence
          Length = 777

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 72/81 (88%), Gaps = 3/81 (3%)
 Strand = Plus / Minus

                                                                       
Query: 229 ctctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctgacttcttc 288
           ||||| |||||||||||||| ||||| ||||| |||||||| |||||||| ||   ||||
Sbjct: 725 ctctgttccttcagcctctgagcaagaagcttttggtactcggcagcctcaga---cttc 669

                                
Query: 289 ttggcgatcctcttcttcttg 309
           |||||||||||||||||||||
Sbjct: 668 ttggcgatcctcttcttcttg 648



to top

>emb|BX827692.1|CNS0A3WM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZH02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 580

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 126/154 (81%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 222 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 163

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 162 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 103

                                             
Query: 419 atgtgttgacatagctgcggacatcatcatcctt 452
           | |||||||||||| | | ||||||||| |||||
Sbjct: 102 aagtgttgacataggtcctgacatcatcttcctt 69



to top

>gb|AF034217.1|AF034217 Arabidopsis thaliana ribosomal protein S6 (rps6) mRNA, complete cds
          Length = 945

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 126/154 (81%)
 Strand = Plus / Minus

                                                                       
Query: 299 tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
           ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 604 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 545

                                                                       
Query: 359 gctggatcttgggggccttgctcaccttctttcccttcttgttaaggaaggtcctgcggt 418
            ||||||||| ||||| ||||| || | ||| |||||||||||   |||  | | |||||
Sbjct: 544 tctggatcttaggggctttgctaacttccttgcccttcttgtttgtgaacttgcggcggt 485

                                             
Query: 419 atgtgttgacatagctgcggacatcatcatcctt 452
           | |||||||||||| | | ||||||||| |||||
Sbjct: 484 aagtgttgacataggtcctgacatcatcttcctt 451



to top

>gb|DQ241846.1| Solanum tuberosum clone 186G09 unknown mRNA
          Length = 1056

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 113/137 (82%)
 Strand = Plus / Minus

                                                                       
Query: 415 cggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttg 474
           ||||| |||||||||||  | | ||||||||| ||||||  ||| ||||| |||||  ||
Sbjct: 535 cggtaagtgttgacatacttcctgacatcatcttccttggaaagattgaagagctttctg 476

                                                                       
Query: 475 atcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggt 534
           ||||| |||||||| |||||||| |||||||| ||||| || ||||| || || || || 
Sbjct: 475 atcttggaagcccttttgggtcctctcatccttggcttttcggtgtcggtgagtccaggc 416

                            
Query: 535 agatcattctcaccctt 551
           ||||||||||| |||||
Sbjct: 415 agatcattctccccctt 399



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 gcaagcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttg 309
           ||||| |||||||| || || || |||||||||||   |||||| || ||||||||||||
Sbjct: 700 gcaagaagcttctgataatcagctgcctctgacttagccttggcaattctcttcttcttg 641

                      
Query: 310 tcggcaattct 320
           || ||||||||
Sbjct: 640 tcagcaattct 630



to top

>gb|AY453394.1| Glycine max ribosomal protein S6 (RPS6) mRNA, complete cds
          Length = 1020

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 187 agcttcgacctcctcttggccatgctctcactccggcgatccctctgctccttcagcctc 246
           ||||| || |||||||| ||||  |||||||| ||||| || ||||||||||||| ||| 
Sbjct: 778 agcttggatctcctcttagccaaactctcactgcggcggtctctctgctccttcaacctg 719

                                                                       
Query: 247 tgtgcaagcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttc 306
              ||||| || |||||||||||||| ||||| || ||   |||||| ||||||||||||
Sbjct: 718 gaggcaaggagtttctggtactctgctgcctcagattttgccttggcaatcctcttcttc 659

                                  
Query: 307 ttgtcggcaattctggcacgctt 329
           || || |||||||| || |||||
Sbjct: 658 ttatcagcaattcttgcccgctt 636



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 499 ctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcacccttcttgaca 558
           |||||||| |||||||||   ||||| |  ||||||| |||||||||||| ||||| |||
Sbjct: 466 ctcatccttggcttctcaacatcagtcaatcctggtaaatcattctcacctttcttcaca 407

            
Query: 559 a 559
           |
Sbjct: 406 a 406



to top

>dbj|D78497.1| Brassica rapa mRNA for putative ribosomal protein, partial cds
          Length = 426

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 474 gatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctgg 533
           |||||| || || ||||| |||||||||||||| |||||||| || || ||||| || ||
Sbjct: 378 gatcttggacgctctcttaggtcccctcatccttggcttctcggtatcggtaagcccggg 319

                                     
Query: 534 tagatcattctcacccttcttgacaa 559
            ||||| |||||||||||||||||||
Sbjct: 318 aagatccttctcacccttcttgacaa 293



to top

>dbj|AP006076.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT19M07, TM0114,
             complete sequence
          Length = 94533

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 118/145 (81%)
 Strand = Plus / Minus

                                                                         
Query: 415   cggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttg 474
             |||||||||||||||||  | |  ||||||||||||||    || ||||| |||||   |
Sbjct: 18918 cggtatgtgttgacatacttcctcacatcatcatccttagacagattgaacagcttgcgg 18859

                                                                         
Query: 475   atcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggt 534
             || || |||||||||||||| ||||||||||| |||||||||   ||||| | ||| |||
Sbjct: 18858 attttagaagccctcttgggacccctcatccttggcttctcaacatcagtcaagccaggt 18799

                                      
Query: 535   agatcattctcacccttcttgacaa 559
             | |||||| ||||||||||| ||||
Sbjct: 18798 aaatcattgtcacccttcttcacaa 18774



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 139/176 (78%)
 Strand = Plus / Minus

                                                                         
Query: 211   ctctcactccggcgatccctctgctccttcagcctctgtgcaagcagcttctggtactct 270
             ||||| || ||||| |||||||||||||||| |||    ||||| || |||||||| |||
Sbjct: 19580 ctctcgctacggcgttccctctgctccttcaacctggaggcaagtagtttctggtattct 19521

                                                                         
Query: 271   gcagcctctgacttcttcttggcgatcctcttcttcttgtcggcaattctggcacgcttc 330
             || |||||||| ||    ||||| || ||||||||||| || |||||||| || | ||||
Sbjct: 19520 gctgcctctgattttgctttggcaattctcttcttcttatctgcaattcttgccctcttc 19461

                                                                     
Query: 331   ctctggagggtcaagggagtcacaagacgctggatcttgggggccttgctcacctt 386
             || || || ||||  ||||| || |  ||||| ||||| || || |||||||||||
Sbjct: 19460 ctttgaagtgtcagaggagtgaccaatcgctgaatcttaggagctttgctcacctt 19405



to top

>ref|XM_570222.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein
           s6-b (CND02780) partial mRNA
          Length = 825

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 325 cgcttcctctggagggtcaagggagtcacaagacgctggatcttgggggccttg 378
           ||||||||||||||   |||||| || |||||||||||||||||||||||||||
Sbjct: 587 cgcttcctctggagacgcaagggggtgacaagacgctggatcttgggggccttg 534



to top

>emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 75
          Length = 196242

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                          
Query: 299    tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
              ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 112399 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 112458

                                    
Query: 359    gctggatcttgggggccttgct 380
               ||||||||| ||||| |||||
Sbjct: 112459 tctggatcttaggggctttgct 112480



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                          
Query: 474    gatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctgg 533
              |||||| || || ||||| ||||| ||||| || ||||||||||| || ||||| || ||
Sbjct: 112668 gatcttggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccagg 112727

                                        
Query: 534    tagatcattctcacccttcttgacaa 559
               ||||| |||||||||||||| ||||
Sbjct: 112728 aagatcgttctcacccttcttcacaa 112753



to top

>emb|AL031004.1|ATF28M20 Arabidopsis thaliana DNA chromosome 4, BAC clone F28M20 (ESSAII
             project)
          Length = 90902

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 299   tcttcttcttgtcggcaattctggcacgcttcctctggagggtcaagggagtcacaagac 358
             ||||||||||||| |||||||| || | ||||||||| || ||||| || |||||||| |
Sbjct: 40872 tcttcttcttgtcagcaattctagctctcttcctctgaagagtcaatggggtcacaagcc 40813

                                   
Query: 359   gctggatcttgggggccttgct 380
              ||||||||| ||||| |||||
Sbjct: 40812 tctggatcttaggggctttgct 40791



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                         
Query: 474   gatcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctgg 533
             |||||| || || ||||| ||||| ||||| || ||||||||||| || ||||| || ||
Sbjct: 40603 gatcttggaggctctctttggtcctctcattcttggcttctcagtatcggtaagcccagg 40544

                                       
Query: 534   tagatcattctcacccttcttgacaa 559
              ||||| |||||||||||||| ||||
Sbjct: 40543 aagatcgttctcacccttcttcacaa 40518



to top

>ref|XM_654476.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN1964.2), mRNA
          Length = 714

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 345 gggagtcacaagacgctggatcttgggggccttg 378
           ||||||||| ||||||||||||||||||||||||
Sbjct: 546 gggagtcaccagacgctggatcttgggggccttg 513



to top

>dbj|AK109085.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-H09, full
           insert sequence
          Length = 1049

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 231 ctgctccttcagcctctgtgcaagcagcttctggtactctgcagcctctg 280
           ||||||||||||||||||  | |||||||| ||||||||||| |||||||
Sbjct: 731 ctgctccttcagcctctggacgagcagcttgtggtactctgctgcctctg 682



to top

>gb|AC146855.5| Medicago truncatula clone mth2-16c23, complete sequence
          Length = 137979

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                          
Query: 415    cggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttg 474
              ||||| |||||||||||  | | ||||||||||||||||   || ||||| |||||   |
Sbjct: 135508 cggtaggtgttgacatacttcctgacatcatcatccttggacagattgaagagcttacgg 135567

                                                                          
Query: 475    atcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggt 534
              || || ||||||||||| || |||||||| |||||||| |||   ||||| |  ||||| 
Sbjct: 135568 attttggaagccctcttaggacccctcattctgggcttttcaacatcagtcaaacctggc 135627

                                       
Query: 535    agatcattctcacccttcttgacaa 559
              | |||||| ||||||||||| ||||
Sbjct: 135628 aaatcattttcacccttcttcacaa 135652



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 211    ctctcactccggcgatccctctgctccttca 241
              |||||||| ||||| ||||||||||||||||
Sbjct: 134320 ctctcactgcggcgttccctctgctccttca 134350



to top

>gb|AC149801.3| Medicago truncatula chromosome 2 BAC clone mth2-32i15, complete
             sequence
          Length = 96221

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                         
Query: 415   cggtatgtgttgacatagctgcggacatcatcatccttgccaaggttgaaaagcttcttg 474
             ||||| |||||||||||  | | ||||||||||||||||   || ||||| |||||   |
Sbjct: 94045 cggtaggtgttgacatacttcctgacatcatcatccttggacagattgaagagcttacgg 93986

                                                                         
Query: 475   atcttcgaagccctcttgggtcccctcatcctgggcttctcagtgtcagtaaggcctggt 534
             || || ||||||||||| || |||||||| |||||||| |||   ||||| |  ||||| 
Sbjct: 93985 attttggaagccctcttaggacccctcattctgggcttttcaacatcagtcaaacctggc 93926

                                      
Query: 535   agatcattctcacccttcttgacaa 559
             | |||||| ||||||||||| ||||
Sbjct: 93925 aaatcattttcacccttcttcacaa 93901



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 211   ctctcactccggcgatccctctgctccttca 241
             |||||||| ||||| ||||||||||||||||
Sbjct: 95233 ctctcactgcggcgttccctctgctccttca 95203



to top

>gb|AF294917.1|AF294917 Aplysia californica ribosomal protein S6 mRNA, complete cds
          Length = 760

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 349 gtcacaagacgctggatcttgggggccttgctc 381
           ||||| |||||||||||||||||||||||||||
Sbjct: 549 gtcaccagacgctggatcttgggggccttgctc 517



to top

>gb|AF525803.1| Chlamys farreri ribosomal protein S6-like mRNA, partial sequence
          Length = 554

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 346 ggagtcacaagacgctggatcttgggggcctt 377
           ||||||||||| ||||||||||||||||||||
Sbjct: 300 ggagtcacaagtcgctggatcttgggggcctt 269



to top

>ref|XM_751713.1| Ustilago maydis 521 hypothetical protein (UM00659.1) partial mRNA
          Length = 789

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 349 gtcacaagacgctggatcttgggggccttg 378
           ||||||||||||||||||||||| ||||||
Sbjct: 611 gtcacaagacgctggatcttgggagccttg 582



to top

>ref|XM_746654.1| Aspergillus fumigatus Af293 40S ribosomal protein S6 (Afu4g10800)
           partial mRNA
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 345 gggagtcacaagacgctggatcttgggggccttg 378
           |||||| || ||||||||||||||||||||||||
Sbjct: 546 gggagtgaccagacgctggatcttgggggccttg 513



to top

>dbj|AB226198.1| Aspergillus oryzae cDNA, contig sequence: AoEST3057
          Length = 1185

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||||||||||
Sbjct: 659 agacgctggatcttgggggccttg 636



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 355     agacgctggatcttgggggccttg 378
               ||||||||||||||||||||||||
Sbjct: 3098267 agacgctggatcttgggggccttg 3098244



to top

>emb|AJ438987.1|PLI438987 Paracentrotus lividus mRNA for S6 ribosomal protein (rps6 gene)
          Length = 983

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||||||||||
Sbjct: 564 agacgctggatcttgggggccttg 541



to top

>gb|AY752838.1| Culicoides sonorensis clone CsRPS6A ribosomal protein S6 mRNA,
           partial cds
          Length = 1086

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 537 atcattctcacccttcttgacaa 559
           |||||||||||||||||||||||
Sbjct: 378 atcattctcacccttcttgacaa 356



to top

>gb|AY237125.1| Telmatoscopus sp. AMF-2003 ribosomal protein S6 mRNA, partial cds
          Length = 599

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 432 gctgcggacatcatcatccttgccaaggttgaaaagctt 470
           ||||||||||||||| |||||||  |||||||| |||||
Sbjct: 243 gctgcggacatcatcctccttgctcaggttgaacagctt 205



to top

>gb|AY095266.1| Culicoides sonorensis RPS6 mRNA, partial cds
          Length = 804

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 537 atcattctcacccttcttgacaa 559
           |||||||||||||||||||||||
Sbjct: 96  atcattctcacccttcttgacaa 74



to top

>emb|X68050.1|NTRPS6 N.tabacum mRNA for ribosomal protein S6
          Length = 804

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 493 ggtcccctcatcctgggcttctcagtgtcagtaaggcctggtagatcattctcaccctt 551
           ||||| |||||||| || || |||||||| || || || || |||||||||||||||||
Sbjct: 528 ggtcctctcatccttggtttttcagtgtctgtcagtccaggcagatcattctcaccctt 586



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 250 gcaagcagcttctggtactctgcagcctctgacttcttcttggcgatcctcttcttcttg 309
           ||||| |||||||| || || || ||||| |||||   |||||| || ||||||||||| 
Sbjct: 300 gcaagaagcttctgatattcagctgcctccgacttagccttggcaattctcttcttctta 359

                                                          
Query: 310 tcggcaattctggcacgcttcctctggagggtcaagggagtcacaag 356
           || |||||||| || | ||| || || || |||||||| ||||||||
Sbjct: 360 tcagcaattcttgccctctttctttgaagagtcaagggtgtcacaag 406



to top

>ref|XM_360693.1| Magnaporthe grisea 70-15 hypothetical protein (MG03236.4) partial
           mRNA
          Length = 720

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 345 gggagtcacaagacgctggatcttgggggccttg 378
           |||||| || || |||||||||||||||||||||
Sbjct: 552 gggagtaaccaggcgctggatcttgggggccttg 519



to top

>ref|XM_867656.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S6
           (LOC508350), partial mRNA
          Length = 709

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 346 ggagtcacaagacgctggatcttggg 371
           ||||||||||||||||| ||||||||
Sbjct: 464 ggagtcacaagacgctgaatcttggg 439



to top

>ref|XM_505593.1| Yarrowia lipolytica CLIB122, YALI0F18766g predicted mRNA
          Length = 729

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 533 cgctggatcttgggggccttg 513



to top

>gb|AC092437.4| Homo sapiens BAC clone RP11-326I19 from 4, complete sequence
          Length = 203583

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 225   atccctctgctccttcagcctctgt 249
             |||||||| ||||||||||||||||
Sbjct: 84827 atccctctcctccttcagcctctgt 84851



to top

>gb|AC067728.25| Homo sapiens 3 BAC RP11-117F22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 86751

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 387   ctttcccttcttgttaaggaa 407
             |||||||||||||||||||||
Sbjct: 79815 ctttcccttcttgttaaggaa 79835



to top

>dbj|AP000757.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-728F11, complete
             sequences
          Length = 184926

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 226   tccctctgctccttcagcctc 246
             |||||||||||||||||||||
Sbjct: 21454 tccctctgctccttcagcctc 21474



to top

>dbj|AP001554.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-35P15, complete
              sequence
          Length = 171747

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 226    tccctctgctccttcagcctc 246
              |||||||||||||||||||||
Sbjct: 130125 tccctctgctccttcagcctc 130145



to top

>emb|CT033435.1| Platynereis dumerilii EST IB0AAA20BE05EM1
          Length = 829

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 572 cgctggatcttgggggccttg 552



to top

>emb|CT033434.1| Platynereis dumerilii EST IB0AAA20BE05FM1
          Length = 830

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 259 cgctggatcttgggggccttg 279



to top

>emb|CT033340.1| Platynereis dumerilii EST IB0AAA22BC10EM1
          Length = 871

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 614 cgctggatcttgggggccttg 594



to top

>emb|CT033339.1| Platynereis dumerilii EST IB0AAA22BC10FM1
          Length = 837

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 258 cgctggatcttgggggccttg 278



to top

>emb|CT033115.1| Platynereis dumerilii EST IB0AAA26BH05EM1
          Length = 406

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 150 cgctggatcttgggggccttg 130



to top

>emb|CT033114.1| Platynereis dumerilii EST IB0AAA26BH05FM1
          Length = 406

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 257 cgctggatcttgggggccttg 277



to top

>emb|CT032815.1| Platynereis dumerilii EST IB0AAA31AB08EM1
          Length = 841

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 569 cgctggatcttgggggccttg 549



to top

>emb|CT032814.1| Platynereis dumerilii EST IB0AAA31AB08FM1
          Length = 818

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 273 cgctggatcttgggggccttg 293



to top

>emb|CT032774.1| Platynereis dumerilii EST IB0AAA31DB11EM1
          Length = 813

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 569 cgctggatcttgggggccttg 549



to top

>emb|CT032738.1| Platynereis dumerilii EST IB0AAA32CB08EM1
          Length = 796

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 522 cgctggatcttgggggccttg 502



to top

>emb|CT032539.1| Platynereis dumerilii EST IB0AAA36DA11EM1
          Length = 844

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 569 cgctggatcttgggggccttg 549



to top

>emb|CT032538.1| Platynereis dumerilii EST IB0AAA36DA11FM1
          Length = 728

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 276 cgctggatcttgggggccttg 296



to top

>emb|CT032484.1| Platynereis dumerilii EST IB0AAA37CB10EM1
          Length = 827

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 572 cgctggatcttgggggccttg 552



to top

>emb|CT032483.1| Platynereis dumerilii EST IB0AAA37CB10FM1
          Length = 691

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 358 cgctggatcttgggggccttg 378
           |||||||||||||||||||||
Sbjct: 256 cgctggatcttgggggccttg 276



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 358     cgctggatcttgggggccttg 378
               |||||||||||||||||||||
Sbjct: 2505326 cgctggatcttgggggccttg 2505346



to top

>gb|AC092189.3| Drosophila melanogaster clone BACR34M11, complete sequence
          Length = 168540

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 285   cttcttggcgatcctcttct 304
             ||||||||||||||||||||
Sbjct: 18677 cttcttggcgatcctcttct 18658



to top

>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence
          Length = 1212674

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 381    caccttctttcccttcttgt 400
              ||||||||||||||||||||
Sbjct: 703729 caccttctttcccttcttgt 703748



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 381    caccttctttcccttcttgt 400
              ||||||||||||||||||||
Sbjct: 642024 caccttctttcccttcttgt 642005



to top

>gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, complete sequence
          Length = 193489

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 329    tcctctggagggtcaaggga 348
              ||||||||||||||||||||
Sbjct: 136138 tcctctggagggtcaaggga 136119



to top

>gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome 8, complete sequence
          Length = 190381

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 498    cctcatcctgggcttctcag 517
              ||||||||||||||||||||
Sbjct: 137070 cctcatcctgggcttctcag 137089



to top

>ref|XM_842713.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0783)
            partial mRNA
          Length = 1968

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 381  caccttctttcccttcttgt 400
            ||||||||||||||||||||
Sbjct: 1056 caccttctttcccttcttgt 1037



to top

>ref|XM_842723.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0793)
            partial mRNA
          Length = 1947

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 381  caccttctttcccttcttgt 400
            ||||||||||||||||||||
Sbjct: 1056 caccttctttcccttcttgt 1037



to top

>gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome 8, complete sequence
          Length = 193083

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 498   cctcatcctgggcttctcag 517
             ||||||||||||||||||||
Sbjct: 98693 cctcatcctgggcttctcag 98712



to top

>gb|AC126263.4| Mus musculus BAC clone RP23-359P12 from chromosome 8, complete sequence
          Length = 223991

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 198   cctcttggccatgctctcac 217
             ||||||||||||||||||||
Sbjct: 82373 cctcttggccatgctctcac 82354



to top

>ref|XM_775406.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S6, transcript variant 1 (LOC577989), mRNA
          Length = 940

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 564 agacgctggatcttgggtgccttg 541



to top

>ref|XM_796910.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S6, transcript variant 5 (LOC577989), mRNA
          Length = 916

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 540 agacgctggatcttgggtgccttg 517



to top

>emb|AJ439463.2|OOS439463 Ostertagia ostertagi mRNA for metalloprotease I (metal I gene)
          Length = 1772

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  catcatcatccttgccaagg 459
            ||||||||||||||||||||
Sbjct: 1225 catcatcatccttgccaagg 1206



to top

>emb|AJ419180.1|OOS419180 Ostertagia ostertagi partial mRNA for metalloprotease
          Length = 1238

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  catcatcatccttgccaagg 459
            ||||||||||||||||||||
Sbjct: 1150 catcatcatccttgccaagg 1131



to top

>emb|CR938364.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 852

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 579 agacgctggatcttgggtgccttg 556



to top

>emb|CR938363.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YB17BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 805

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 621 agacgctggatcttgggtgccttg 644



to top

>gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-248L18, Complete
              Sequence, complete sequence
          Length = 231039

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 498    cctcatcctgggcttctcag 517
              ||||||||||||||||||||
Sbjct: 199938 cctcatcctgggcttctcag 199957



to top

>gb|DQ399013.1| Ictalurus punctatus clone SAE03 hypothetical protein mRNA, partial
           cds
          Length = 539

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 aagcagagacagccggagcc 171
           ||||||||||||||||||||
Sbjct: 89  aagcagagacagccggagcc 108



to top

>gb|AF154067.1|AF154067 Aedes aegypti ribosomal protein S6 mRNA, complete cds
          Length = 1041

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 539 agacgctggatcttgggtgccttg 516



to top

>gb|AF154066.1|AF154066 Aedes albopictus ribosomal protein S6 (rpS6) mRNA, complete cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 agacgctggatcttgggggccttg 378
           ||||||||||||||||| ||||||
Sbjct: 539 agacgctggatcttgggagccttg 516



to top

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     tcggcaattctggcacgctt 329
               ||||||||||||||||||||
Sbjct: 4123462 tcggcaattctggcacgctt 4123443



to top

>gb|AC115949.13| Mus musculus chromosome 3, clone RP24-568B16, complete sequence
          Length = 177771

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 329  tcctctggagggtcaaggga 348
            ||||||||||||||||||||
Sbjct: 7942 tcctctggagggtcaaggga 7923



to top

>gb|AY924261.1| Aedes aegypti ribosomal protein S6 gene, partial cds
          Length = 1476

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 355  agacgctggatcttgggggccttg 378
            ||||||||||||||||| ||||||
Sbjct: 1087 agacgctggatcttgggtgccttg 1064



to top

>gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 of 83 of the complete
              sequence
          Length = 303641

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 285    cttcttggcgatcctcttct 304
              ||||||||||||||||||||
Sbjct: 202386 cttcttggcgatcctcttct 202367



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 291     ggcgatcctcttcttcttgtcggc 314
               ||||||| ||||||||||||||||
Sbjct: 3860237 ggcgatcgtcttcttcttgtcggc 3860260



to top

>gb|AC138025.4| Mus musculus BAC clone RP24-430F5 from 8, complete sequence
          Length = 165737

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   cctcttggccatgctctcac 217
             ||||||||||||||||||||
Sbjct: 14193 cctcttggccatgctctcac 14212



to top

>gb|AC004369.1|AC004369 Drosophila melanogaster DNA sequence (P1 DS07066 (D70)), complete
             sequence
          Length = 77798

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   cttcttggcgatcctcttct 304
             ||||||||||||||||||||
Sbjct: 64172 cttcttggcgatcctcttct 64191


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,535,904
Number of Sequences: 3902068
Number of extensions: 5535904
Number of successful extensions: 119842
Number of sequences better than 10.0: 109
Number of HSP's better than 10.0 without gapping: 109
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119389
Number of HSP's gapped (non-prelim): 433
length of query: 578
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 555
effective length of database: 17,143,297,704
effective search space: 9514530225720
effective search space used: 9514530225720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top