| Clone Name | rbags38c07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY483155.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA6) mRNA, complete cds Length = 3745 Score = 957 bits (483), Expect = 0.0 Identities = 493/495 (99%), Gaps = 1/495 (0%) Strand = Plus / Minus Query: 117 tcacaatgtacactgcaggtttcgtagacagtggttctcagcggcatggggcgactaaca 176 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3606 tcacaatgtacgctgcaggtttcgtagacagtggttctcagcggcatggggcgactaaca 3547 Query: 177 aaggggcaataatttagataaaaatccttccgtcttcatctacaaccaaaaaatcccgtc 236 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3546 aaggggcaataatttagataaaaatccttccgtcttcatctacaaccaaaaaatcccgtc 3487 Query: 237 taaccccctccggtatttacactaggggggcagatactcccgagcgccgatgatccgatc 296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3486 taaccccctccggtatttacactaggggggcagatactcccgagcgccgatgatccgatc 3427 Query: 297 agcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagggt 356 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3426 agcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagggt 3367 Query: 357 cgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacga 416 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3366 cgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacga 3307 Query: 417 tggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagga 476 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3306 tggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagga 3247 Query: 477 tcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccgctg 536 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 3246 tcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaa-ccgctg 3188 Query: 537 ttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtggtc 596 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3187 ttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtggtc 3128 Query: 597 ggagggatgaggaga 611 ||||||||||||||| Sbjct: 3127 ggagggatgaggaga 3113 Score = 170 bits (86), Expect = 3e-39 Identities = 96/98 (97%), Gaps = 1/98 (1%) Strand = Plus / Minus Query: 1 acagctgccttatataaatagttggtgtc-tagtgtataaatacaattctgacatgatat 59 ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 3723 acagctgccttatataaattgttggtgtcatagtgtataaatacaattctgacatgatat 3664 Query: 60 actctaagcaacaaagaacaggtaccacaaatgggggc 97 |||||||||||||||||||||||||||||||||||||| Sbjct: 3663 actctaagcaacaaagaacaggtaccacaaatgggggc 3626
>gb|DQ020207.1| Bambusa oldhamii cellulose synthase BoCesA1a mRNA, complete cds Length = 3547 Score = 385 bits (194), Expect = e-103 Identities = 288/318 (90%), Gaps = 1/318 (0%) Strand = Plus / Minus Query: 294 atcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaag 353 |||||||||| || ||||||||||||| ||| ||||| ||||||||| ||| ||||||| Sbjct: 3254 atcagcagttcacaccgcactgccccaaggcgacggctttctgggtaggggatatgaaag 3195 Query: 354 ggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatga 413 ||||||||||||||||||||||||||||||| || || |||||||| ||||||||||||| Sbjct: 3194 ggtcgatcttcacccagaggagggagaagattgacgcaaggaggatggaccaaacgatga 3135 Query: 414 cgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgga 473 | ||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||| Sbjct: 3134 caatggttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtagagatgga 3075 Query: 474 ggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccg 533 |||| |||||||||||||||||||||||||||||||| || ||||| ||||||||| || Sbjct: 3074 ggataacccagattgagaagaagagctttccaaagagtggaccccaagattggtaa-cca 3016 Query: 534 ctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtg 593 ||||| ||||| |||||||| ||||||||||||||||||||||| || || || || ||| Sbjct: 3015 ctgttaatggcatatgatattcctgccaccatgcccaccaggttaatgacaagcacagtg 2956 Query: 594 gtcggagggatgaggaga 611 |||||||||||||||||| Sbjct: 2955 gtcggagggatgaggaga 2938 Score = 60.0 bits (30), Expect = 9e-06 Identities = 46/50 (92%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 209 tcttcatctacaaccaaaaaatcccgtctaaccccctccggtatttacac 258 |||||||||||||| |||||||||| || ||||||||| ||||||||||| Sbjct: 3351 tcttcatctacaac-aaaaaatcccatccaaccccctcaggtatttacac 3303
>gb|AC135426.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0617A08, complete sequence Length = 144781 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Plus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 128287 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 128346 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 128347 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 128406 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 128407 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 128466 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 128467 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 128525 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 128526 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 128585 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 128586 gtggtcgggggaatgaggaga 128606
>gb|AC144738.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0029B02, complete sequence Length = 156649 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Plus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 17130 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 17189 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 17190 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 17249 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 17250 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 17309 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 17310 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 17368 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 17369 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 17428 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 17429 gtggtcgggggaatgaggaga 17449
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Plus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 4506663 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 4506722 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 4506723 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 4506782 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 4506783 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 4506842 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 4506843 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 4506901 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 4506902 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 4506961 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 4506962 gtggtcgggggaatgaggaga 4506982
>dbj|AK102140.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033085K01, full insert sequence Length = 3768 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK100188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034D20, full insert sequence Length = 3897 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK099281.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023125F05, full insert sequence Length = 3801 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK099228.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091P03, full insert sequence Length = 3732 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK098978.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092B06, full insert sequence Length = 3764 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK067967.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013125H24, full insert sequence Length = 3802 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 3421 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 3362 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 3361 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 3302 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3301 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3242 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 3241 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 3183 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 3182 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 3123 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 3122 gtggtcgggggaatgaggaga 3102
>dbj|AK060079.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-C08, full insert sequence Length = 1097 Score = 359 bits (181), Expect = 7e-96 Identities = 287/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 672 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 613 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 612 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 553 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 552 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 493 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 492 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 434 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 433 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 374 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 373 gtggtcgggggaatgaggaga 353
>gb|DQ020208.1| Bambusa oldhamii cellulose synthase BoCesA1b mRNA, complete cds Length = 3453 Score = 351 bits (177), Expect = 2e-93 Identities = 286/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||| ||||||| || ||||||||||||| ||||||||| ||||| ||| ||| |||| Sbjct: 3414 ccgattagcagttcacaccgcactgccccaaggcaacggctttctgagtaggggatatga 3355 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 ||||||||||||||||||| || ||||||||||| || ||||||||||| |||||||| | Sbjct: 3354 aagggtcgatcttcacccacagcagggagaagattgacgcgaggaggatggaccaaacaa 3295 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 |||| ||||| ||||||||||||||| | ||||||||||||||||||||||||||||||| Sbjct: 3294 tgacaatggttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtagagat 3235 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||||||||||||||||||||| || || || ||||| ||||||||| Sbjct: 3234 ggaggatcacccagattgagaagaagagctttccgaaaagtggaccccaagattggtaa- 3176 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 || ||||| ||||| |||||||| ||||||||||||||||||||||| || || || || Sbjct: 3175 ccactgttaatggcatatgatattcctgccaccatgcccaccaggttaatgacaagcaca 3116 Query: 591 gtggtcggagggatgaggaga 611 ||||| ||||||||||||||| Sbjct: 3115 gtggttggagggatgaggaga 3095
>dbj|AK060838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-D02, full insert sequence Length = 1426 Score = 351 bits (177), Expect = 2e-93 Identities = 286/321 (89%), Gaps = 1/321 (0%) Strand = Plus / Minus Query: 291 ccgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatga 350 ||||||||||||| || ||||| ||||||| ||| ||||| ||||| ||| ||||||| Sbjct: 1098 ccgatcagcagttcacaccgcattgccccaaggcgacggctttctgagtaggcgaaatga 1039 Query: 351 aagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacga 410 |||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| |||| Sbjct: 1038 aaggatcgatcttgacccacagaagggagaagatcgacgcgaggaggatcgaccagacga 979 Query: 411 tgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagat 470 ||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 978 tgacgatggtcggagtgcggttctgcctgcccatgagacccttgaggaaggggtagagac 919 Query: 471 ggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaac 530 |||||||||||||||| ||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 918 ggaggatcacccagatggagaagaagagctttccaaagagaggaccccatgattggtaa- 860 Query: 531 ccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacg 590 |||||||| ||||| |||||||| || ||||||||||||||||||||||| || || ||| Sbjct: 859 ccgctgttaatggcatatgatatacccgccaccatgcccaccaggttgatgacaagcacg 800 Query: 591 gtggtcggagggatgaggaga 611 |||||||| || ||||||||| Sbjct: 799 gtggtcgggggaatgaggaga 779
>gb|AF200526.1|AF200526 Zea mays cellulose synthase-2 (CesA-2) mRNA, complete cds Length = 3725 Score = 280 bits (141), Expect = 5e-72 Identities = 232/261 (88%), Gaps = 1/261 (0%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 |||||||| |||||||||||||| || | ||||||||| || || |||||||| |||||| Sbjct: 3351 atgaaaggatcgatcttcacccacagcaaggagaagatagacgcaaggaggatggaccaa 3292 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 ||||||||||| || ||||||||||||||| | ||||||||||||||||||||||||||| Sbjct: 3291 acgatgacgattgttggcgtgcggttctgcctgcccatgagacccttgaggaaggggtag 3232 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 526 |||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||| Sbjct: 3231 agatggaggatcacccagatcgagaagaacagctttccaaagagcggaccccaggattgg 3172 Query: 527 taacccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgag 586 | | |||||||| ||||| || || || ||||||||||| || |||||||| || || || Sbjct: 3171 t-agccgctgttaatggcatacgaaattcctgccaccattccgaccaggttaatgacaag 3113 Query: 587 gacggtggtcggagggatgag 607 || ||||||||||||||||| Sbjct: 3112 aacagtggtcggagggatgag 3092 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 212 tcatctacaaccaaaaaatcccgtctaaccccctccggtatttacactaggggg 265 ||||||||||| ||||| |||| |||| ||||||| ||||||||||| |||||| Sbjct: 3501 tcatctacaacaaaaaattcccatctagccccctcaggtatttacacgaggggg 3448
>gb|AF200525.1|AF200525 Zea mays cellulose synthase-1 (CesA-1) mRNA, complete cds Length = 3752 Score = 254 bits (128), Expect = 3e-64 Identities = 270/316 (85%), Gaps = 1/316 (0%) Strand = Plus / Minus Query: 292 cgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaa 351 |||||||||||||||||| || ||||||| |||| | || ||||| || ||| ||||| Sbjct: 3413 cgatcagcagttgacgccacattgccccaaggcagcagctttctgtgtcggggagatgaa 3354 Query: 352 agggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgat 411 ||| |||||||||||||| || | ||||||||| || || || ||||| ||||| || || Sbjct: 3353 aggatcgatcttcacccacagcaaggagaagatagatgcaagaaggatggaccagacaat 3294 Query: 412 gacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatg 471 |||||| || || |||||||||||| | |||||||||||||||||||||||||||||||| Sbjct: 3293 gacgattgttggtgtgcggttctgccttcccatgagacccttgaggaaggggtagagatg 3234 Query: 472 gaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacc 531 ||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||| | | Sbjct: 3233 gaggatcacccagatcgagaagaacagctttccaaagagcggaccccaggattggt-agc 3175 Query: 532 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacgg 591 | ||||| ||||| || || || ||||||||||| || |||||||| || || || || | Sbjct: 3174 cactgttaatggcataagaaattcctgccaccattccgaccaggttaatgacaagaacag 3115 Query: 592 tggtcggagggatgag 607 |||||||||| ||||| Sbjct: 3114 tggtcggaggaatgag 3099
>gb|DQ020210.1| Bambusa oldhamii cellulose synthase BoCesA3a mRNA, complete cds Length = 3571 Score = 248 bits (125), Expect = 2e-62 Identities = 267/313 (85%), Gaps = 1/313 (0%) Strand = Plus / Minus Query: 295 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 354 ||||||||| || ||||||||||||| || ||||| ||||||||| || |||||||| Sbjct: 3304 tcagcagtttacaccgcactgccccagggtgacggctttctgggtaggagatatgaaagg 3245 Query: 355 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 414 |||||||||||||| || || ||||||||||| || |||||||| |||||||| ||||| Sbjct: 3244 atcgatcttcacccacagcagtgagaagatggaagcaaggaggatggaccaaacaatgac 3185 Query: 415 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 474 ||||| || ||||||||||| |||||||||||||||| ||||| ||||| |||||||| Sbjct: 3184 aatggttggagtgcggttctgtctccccatgagaccctttaggaaagggtaaagatggag 3125 Query: 475 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccgc 534 ||||||||||||||||||||| ||||| || || ||||| ||||||||||||||| || | Sbjct: 3124 gatcacccagattgagaagaaaagcttaccgaaaagcggaccccaggattggtaa-ccac 3066 Query: 535 tgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtgg 594 |||| || ||||| |||| |||||||| || ||||||||||| || || || ||||||| Sbjct: 3065 tgttaatagcgtacgatactcctgccactatacccaccaggttaatgacaagcacggtgg 3006 Query: 595 tcggagggatgag 607 | || |||||||| Sbjct: 3005 ttggggggatgag 2993
>gb|DQ020209.1| Bambusa oldhamii cellulose synthase BoCesA2 mRNA, complete cds Length = 3648 Score = 232 bits (117), Expect = 1e-57 Identities = 256/301 (85%), Gaps = 1/301 (0%) Strand = Plus / Minus Query: 295 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 354 ||||||||| || ||||||||||||| |||||| || ||||||||| || |||||||| Sbjct: 3325 tcagcagtttacaccgcactgccccaaggcaacagctttctgggtaggagatatgaaagg 3266 Query: 355 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 414 |||||||||||||| || | ||||||||||| || |||||||| |||||||| ||||| Sbjct: 3265 atcgatcttcacccacagcaacgagaagatggaagcaaggaggatggaccaaacaatgac 3206 Query: 415 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 474 || ||||| ||||||||||| ||||||||||||||||| ||||| ||||| |||||||| Sbjct: 3205 aattgtcggtgtgcggttctgtttccccatgagaccctttaggaaagggtaaagatggag 3146 Query: 475 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccgc 534 ||||||||||||||||||||| ||||| ||||| || || ||||| ||||||| | |||| Sbjct: 3145 gatcacccagattgagaagaaaagcttcccaaaaagtggaccccaagattggt-agccgc 3087 Query: 535 tgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtgg 594 |||| || || || |||| ||||||||| || ||||| ||||| || || || ||||||| Sbjct: 3086 tgttaatagcataagatacgcctgccactatacccactaggttaatgacaagcacggtgg 3027 Query: 595 t 595 | Sbjct: 3026 t 3026 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 226 aaaatcccgtctaaccccctccggtatttacactagggggg 266 |||||| | ||||||| |||| ||||||||||| ||||||| Sbjct: 3417 aaaatcacatctaaccacctctggtatttacacgagggggg 3377
>gb|AY110415.1| Zea mays CL1166_1 mRNA sequence Length = 3898 Score = 224 bits (113), Expect = 3e-55 Identities = 266/316 (84%), Gaps = 1/316 (0%) Strand = Plus / Minus Query: 292 cgatcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaa 351 |||||||||||||||||| || ||||||| |||| | || ||||| || ||| ||||| Sbjct: 3419 cgatcagcagttgacgccacattgccccaaggcagcagctttctgtgtcggggagatgaa 3360 Query: 352 agggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgat 411 ||| |||||||||||||| || | ||||||||| || || || ||||| ||||| || || Sbjct: 3359 aggatcgatcttcacccacagcaaggagaagatagatgcaagaaggatggaccagacaat 3300 Query: 412 gacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatg 471 |||||| || || |||||||||||| | |||||||||||||||||||| | ||| ||||| Sbjct: 3299 gacgattgttggtgtgcggttctgccttcccatgagacccttgaggaacgtgtacagatg 3240 Query: 472 gaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacc 531 ||||| ||||||||| |||||||| ||||||||||||||||| ||||||||||||| | | Sbjct: 3239 gaggancacccagatcgagaagaacagctttccaaagagcggaccccaggattggt-agc 3181 Query: 532 cgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacgg 591 | ||||| ||||| || || || ||||||||||| || |||||||| || || || || | Sbjct: 3180 cactgttaatggcatacgaaattcctgccaccattccgaccaggttaatgacaagaacag 3121 Query: 592 tggtcggagggatgag 607 |||||||||| ||||| Sbjct: 3120 tggtcggaggaatgag 3105
>gb|DQ020216.1| Bambusa oldhamii cellulose synthase BoCesA3b mRNA, complete cds Length = 3707 Score = 218 bits (110), Expect = 2e-53 Identities = 261/310 (84%), Gaps = 1/310 (0%) Strand = Plus / Minus Query: 295 tcagcagttgacgccgcactgccccatggcaacggccttctgggtatcggaaatgaaagg 354 ||||||||| || ||||||||||||| || || || ||||||||| || |||||||| Sbjct: 3310 tcagcagtttacaccgcactgccccagggtgacagctttctgggtaggagatatgaaagg 3251 Query: 355 gtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgac 414 |||||||||||||| || || ||||||||||| || ||||||| |||||||| ||||| Sbjct: 3250 atcgatcttcacccacagcagtgagaagatggaagcaaggaggacggaccaaacaatgac 3191 Query: 415 gatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggag 474 ||||| || ||||| ||||| |||||||||||||||| ||||| ||||| |||||||| Sbjct: 3190 aatggttggagtgcgattctgtctccccatgagaccctttaggaaagggtaaagatggag 3131 Query: 475 gatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccgc 534 ||||||||||||||||||||| ||||| || || ||||| ||||||||||||||| || | Sbjct: 3130 gatcacccagattgagaagaaaagcttaccgaaaagcggaccccaggattggtaa-ccac 3072 Query: 535 tgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgaggacggtgg 594 |||| || ||||| |||| |||||||| || ||||||||||| || || || ||||||| Sbjct: 3071 tgttaatagcgtacgatactcctgccactatacccaccaggttaatgacaagcacggtgg 3012 Query: 595 tcggagggat 604 | || ||||| Sbjct: 3011 ttggggggat 3002
>gb|AF200527.1|AF200527 Zea mays cellulose synthase-3 (CesA-3) mRNA, partial cds Length = 2828 Score = 190 bits (96), Expect = 4e-45 Identities = 174/200 (87%) Strand = Plus / Minus Query: 329 gccttctgggtatcggaaatgaaagggtcgatcttcacccagaggagggagaagatggag 388 |||||||||||| ||| ||||| ||||||||||||||||| || || ||||| ||||| Sbjct: 2432 gccttctgggtaggggatatgaaggggtcgatcttcacccacagcagcgagaatatggaa 2373 Query: 389 gcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgaga 448 || || |||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 2372 gcaagaaggacggaccaaacgatgacgatggtcggtgtgcggttctgcttccccatgaga 2313 Query: 449 cccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaag 508 ||||| ||||| |||||||| ||||||||||||||||||| ||||| ||||| || || Sbjct: 2312 cccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaat 2253 Query: 509 agcgggccccaggattggta 528 || || ||||| |||||||| Sbjct: 2252 agtggaccccatgattggta 2233
>gb|BT019010.1| Zea mays clone Contig501.F mRNA sequence Length = 1532 Score = 184 bits (93), Expect = 2e-43 Identities = 184/213 (86%), Gaps = 1/213 (0%) Strand = Plus / Minus Query: 395 aggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttg 454 ||||| |||| ||| ||||| || || || |||||||||||| | ||||||| ||||||| Sbjct: 986 aggatggacccaacaatgaccattgttggggtgcggttctgccttcccatgaaacccttg 927 Query: 455 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 514 |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| Sbjct: 926 aggaaggggtagagatggaggatcacccagatcgagaagaacagctttccaaagagcgga 867 Query: 515 ccccaggattggtaacccgctgttgatggcgtatgatatgcctgccaccatgcccaccag 574 ||||||||||||| | || ||||| ||||| || || || ||||||||||| || ||||| Sbjct: 866 ccccaggattggt-agccactgttaatggcatacgaaattcctgccaccattccgaccag 808 Query: 575 gttgatcacgaggacggtggtcggagggatgag 607 ||| || || || || ||||||||||| ||||| Sbjct: 807 gttaatgacaagaacagtggtcggaggaatgag 775
>gb|AY104236.1| Zea mays PCO121439 mRNA sequence Length = 2872 Score = 182 bits (92), Expect = 9e-43 Identities = 173/200 (86%) Strand = Plus / Minus Query: 329 gccttctgggtatcggaaatgaaagggtcgatcttcacccagaggagggagaagatggag 388 |||||||||||| ||| ||||| ||||||||||||||||| || || ||||| ||||| Sbjct: 2454 gccttctgggtaggggatatgaaggggtcgatcttcacccacagcagcgagaatatggaa 2395 Query: 389 gcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgaga 448 || || |||| |||||||| |||||||||||||| |||||||||||||||||||||||| Sbjct: 2394 gcaagaaggacggaccaaacaatgacgatggtcggtgtgcggttctgcttccccatgaga 2335 Query: 449 cccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaag 508 ||||| ||||| |||||||| ||||||||||||||||||| ||||| ||||| || || Sbjct: 2334 cccttcaggaaagggtagaggtggaggatcacccagattgcaaagaacagcttcccgaat 2275 Query: 509 agcgggccccaggattggta 528 || || ||||| |||||||| Sbjct: 2274 agtggaccccatgattggta 2255
>ref|NM_196933.1| Oryza sativa (japonica cultivar-group) putative cellulose synthase (OSJNBa0006L06.10), mRNA Length = 3408 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 3143 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 3084 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 3083 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 3024 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 3023 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 2971
>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete sequence Length = 162339 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 95863 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 95804 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 95803 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 95744 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 95743 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 95691
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 16751346 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 16751287 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 16751286 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 16751227 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 16751226 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 16751174 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 |||||||| |||||| ||||||||||||||| Sbjct: 22545405 cccatgaggcccttggcgaaggggtagagatg 22545374
>dbj|AK120265.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047D23, full insert sequence Length = 612 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 402 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 343 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 342 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 283 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 282 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 230
>dbj|AK072259.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009D02, full insert sequence Length = 3426 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 3176 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 3117 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 3116 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 3057 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 3056 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 3004
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 176 bits (89), Expect = 6e-41 Identities = 152/173 (87%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||| | ||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 16760386 atgaaggggtcgatcctgacccagacgagggagaagatggaggcgaggaggatggaccag 16760327 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||| ||||| ||||| ||||||||| |||||||||| |||||||||||||||||| Sbjct: 16760326 agcacgacaatggtgggcgtccggttctgcctccccatgagccccttgaggaaggggtag 16760267 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 || |||||||| ||||||| |||||||||||||| || || ||||||||||| Sbjct: 16760266 aggtggaggatgacccagaaggagaagaagagcttcccgaacagcgggcccca 16760214 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 |||||||| |||||| ||||||||||||||| Sbjct: 22557873 cccatgaggcccttggcgaaggggtagagatg 22557842
>gb|AY372244.1| Zea mays cellulose synthase catalytic subunit 10 (CesA10) mRNA, complete cds Length = 3470 Score = 170 bits (86), Expect = 3e-39 Identities = 149/170 (87%) Strand = Plus / Minus Query: 353 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 412 ||||||||| | ||||||| ||| ||||||||||||||||||||||| ||||| | | | Sbjct: 3210 gggtcgatcctgacccagacgagcgagaagatggaggcgaggaggatggaccagagcacg 3151 Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||| ||||||||| |||||||||| ||||||||||| |||||||| ||| Sbjct: 3150 acgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggtagaggtgg 3091 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | ||| ||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 3090 acgatgacccagaaggagaagaagagcttgccgaagagcgggccccagga 3041
>gb|AY107656.1| Zea mays PCO126464 mRNA sequence Length = 1189 Score = 170 bits (86), Expect = 3e-39 Identities = 149/170 (87%) Strand = Plus / Minus Query: 353 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 412 ||||||||| | ||||||| ||| ||||||||||||||||||||||| ||||| | | | Sbjct: 909 gggtcgatcctgacccagacgagcgagaagatggaggcgaggaggatggaccagagcacg 850 Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||| ||||||||| |||||||||| ||||||||||| |||||||| ||| Sbjct: 849 acgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggtagaggtgg 790 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | ||| ||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 789 acgatgacccagaaggagaagaagagcttgccgaagagcgggccccagga 740
>gb|AF200528.1|AF200528 Zea mays cellulose synthase-4 (CesA-4) mRNA, complete cds Length = 3745 Score = 149 bits (75), Expect = 1e-32 Identities = 196/235 (83%), Gaps = 1/235 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 |||||||||||| || || ||||| | ||| |||| |||||||||||| ||||||||||| Sbjct: 3475 ggagaagatggacgccagcaggatggcccagacgacgacgatggtcggggtgcggttctg 3416 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | |||||||| ||||||||||| ||||| || |||| ||| ||||||| | |||||| Sbjct: 3415 cctgcccatgaggcccttgaggaacgggtacaggtggacgatgacccagaaggcgaagaa 3356 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgc 555 |||||| || |||||||||||||| || |||| | ||||||||||||||||| || |||| Sbjct: 3355 gagcttgccgaagagcgggccccacgactggt-atccgctgttgatggcgtaggagatgc 3297 Query: 556 ctgccaccatgcccaccaggttgatcacgaggacggtggtcggagggatgaggag 610 | || || | ||| ||||||||||| | |||| |||||| || ||||| ||||| Sbjct: 3296 cggcgacgacgccgaccaggttgatgatcaggatggtggtgggcgggatcaggag 3242
>gb|AY108113.1| Zea mays PCO126465 mRNA sequence Length = 3763 Score = 149 bits (75), Expect = 1e-32 Identities = 196/235 (83%), Gaps = 1/235 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 |||||||||||| || || ||||| | ||| |||| |||||||||||| ||||||||||| Sbjct: 3493 ggagaagatggacgccagcaggatggcccagacgacgacgatggtcggggtgcggttctg 3434 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | |||||||| ||||||||||| ||||| || |||| ||| ||||||| | |||||| Sbjct: 3433 cctgcccatgaggcccttgaggaacgggtacaggtggacgatgacccagaaggcgaagaa 3374 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgc 555 |||||| || |||||||||||||| || |||| | ||||||||||||||||| || |||| Sbjct: 3373 gagcttgccgaagagcgggccccacgactggt-atccgctgttgatggcgtaggagatgc 3315 Query: 556 ctgccaccatgcccaccaggttgatcacgaggacggtggtcggagggatgaggag 610 | || || | ||| ||||||||||| | |||| |||||| || ||||| ||||| Sbjct: 3314 cggcgacgacgccgaccaggttgatgatcaggatggtggtgggcgggatcaggag 3260
>gb|AY483154.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA4) mRNA, partial cds Length = 1819 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Minus Query: 346 aatgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgacca 405 |||||| ||||||||| | ||||| | |||||||||||||||||||| |||| ||||| Sbjct: 1575 aatgaaggggtcgatcctgacccacacaagggagaagatggaggcgagcaggacagacca 1516 Query: 406 aacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggta 465 | | |||||||| ||||| ||||||||| |||||||||| ||||||||||| ||||| Sbjct: 1515 gagcacaacgatggtgggcgtccggttctgcctccccatgagccccttgaggaacgggta 1456 Query: 466 gagatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 ||| || | ||| ||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 1455 gaggtgaacgatgacccagaaggagaagaagagcttcccgaagagcgggccccagga 1399
>gb|AY483156.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA8) mRNA, partial cds Length = 1255 Score = 133 bits (67), Expect = 7e-28 Identities = 215/263 (81%), Gaps = 1/263 (0%) Strand = Plus / Minus Query: 348 tgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaa 407 |||| ||||||||| | ||||| || |||||||| |||||||| || || | ||||| | Sbjct: 1040 tgaaggggtcgatcctgacccaaagcagggagaacatggaggctagcagcacggaccata 981 Query: 408 cgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtaga 467 |||||| ||||| ||||| | ||||||| ||||||||| |||||||||||| ||||||| Sbjct: 980 tgatgacaatggtgggcgtcctgttctgcctccccatgaaacccttgaggaacgggtaga 921 Query: 468 gatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggt 527 |||| | ||||||||||| | |||||||||||| || || ||||| ||||| || |||| Sbjct: 920 gatgcacgatcacccagaaggcgaagaagagcttaccgaatagcggcccccacgactggt 861 Query: 528 aacccgctgttgatggcgtatgatatgcctgccaccatgcccaccaggttgatcacgagg 587 ||||| |||||||||||| || ||||| ||||||| ||| | | ||||||||| || Sbjct: 860 -acccgttgttgatggcgtcagaaatgcccgccaccacgccgatgatgttgatcaccagc 802 Query: 588 acggtggtcggagggatgaggag 610 | || ||| ||||||||||||| Sbjct: 801 agcgtcgtctgagggatgaggag 779 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 292 cgatcagcagttgacgccgcactgc 316 |||||||||||||| |||||||||| Sbjct: 1093 cgatcagcagttgatgccgcactgc 1069
>gb|AY372245.1| Zea mays cellulose synthase catalytic subunit 11 (CesA11) mRNA, complete cds Length = 3231 Score = 131 bits (66), Expect = 3e-27 Identities = 144/170 (84%) Strand = Plus / Minus Query: 353 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 412 ||||||||||| ||||| ||||||||||||| |||||||||||||| ||||| | | Sbjct: 2914 gggtcgatcttgacccacaggagggagaagacggaggcgaggaggacggaccagagcacc 2855 Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||||||||||||||| |||||||||||||||||||| ||||| || || Sbjct: 2854 acgatggtcggcgtgcggttctggcggcccatgagacccttgaggaacgggtacaggtgc 2795 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 2794 atgatcacccacatggcgaagaacaccttaccgaagagcgggccccagga 2745
>gb|AY389728.1| Hyacinthus orientalis cellulose synthase protein mRNA, partial cds Length = 782 Score = 131 bits (66), Expect = 3e-27 Identities = 193/234 (82%), Gaps = 1/234 (0%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||| || |||||||||||||| || | || |||||||| |||||||||||| Sbjct: 639 gagaagatggaagccaggaggatcgaccagacaaccacaatggtcggagtgcggttctgc 580 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 ||||||| | ||||||||||||||||||| |||| |||||||||| | ||||||| Sbjct: 579 ctccccatcgggaccttgaggaaggggtagaggtggacaatcacccagaaggcgaagaag 520 Query: 497 agctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgcc 556 ||||| || || ||||| ||||| || |||| |||||||||||| ||||| || ||||| Sbjct: 519 agcttcccgaaaagcggaccccacgactggt-acccgctgttgacagcgtaagagatgcc 461 Query: 557 tgccaccatgcccaccaggttgatcacgaggacggtggtcggagggatgaggag 610 || |||| ||||||||||||| ||||||| ||| || ||||| || ||||| Sbjct: 460 agcgaccacacccaccaggttgacgacgaggagggtcgtaggaggaattaggag 407
>gb|AY106476.1| Zea mays PCO143801 mRNA sequence Length = 833 Score = 131 bits (66), Expect = 3e-27 Identities = 144/170 (84%) Strand = Plus / Minus Query: 353 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 412 ||||||||||| ||||| ||||||||||||| |||||||||||||| ||||| | | Sbjct: 517 gggtcgatcttgacccacaggagggagaagacggaggcgaggaggacggaccagagcacc 458 Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||||||||||||||| |||||||||||||||||||| ||||| || || Sbjct: 457 acgatggtcggcgtgcggttctggcggcccatgagacccttgaggaacgggtacaggtgc 398 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 397 atgatcacccacatggcgaagaacaccttaccgaagagcgggccccagga 348
>gb|AF200533.1|AF200533 Zea mays cellulose synthase-9 (CesA-9) mRNA, complete cds Length = 3795 Score = 129 bits (65), Expect = 1e-26 Identities = 171/205 (83%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || || ||||||| ||| || | ||||||||||| ||||||||||| Sbjct: 3399 ggagaagatcgacgccagcaggatcgcccagacaaccacgatggtcggggtgcggttctg 3340 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||||||||| ||||| || || | ||||||||||| | |||||| Sbjct: 3339 ccgacccatgagacccttgaggaacgggtacaggtgaacgatcacccagaaggcgaagaa 3280 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgc 555 |||||| || |||||||| ||||| || |||| ||||||||||||||||||| || |||| Sbjct: 3279 gagcttgccgaagagcggaccccacgactggt-acccgctgttgatggcgtaggagatgc 3221 Query: 556 ctgccaccatgcccaccaggttgat 580 | || || | ||| ||||||||||| Sbjct: 3220 cggcaacaacgccgaccaggttgat 3196
>gb|AY112236.1| Zea mays CL1160_1 mRNA sequence Length = 3728 Score = 129 bits (65), Expect = 1e-26 Identities = 171/205 (83%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || || ||||||| ||| || | ||||||||||| ||||||||||| Sbjct: 3399 ggagaagatcgacgccagcaggatcgcccagacaaccacgatggtcggggtgcggttctg 3340 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||||||||| ||||| || || | ||||||||||| | |||||| Sbjct: 3339 ccgacccatgagacccttgaggaacgggtacaggtgaacgatcacccagaaggcgaagaa 3280 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgc 555 |||||| || |||||||| ||||| || |||| ||||||||||||||||||| || |||| Sbjct: 3279 gagcttgccgaagagcggaccccacgactggt-acccgctgttgatggcgtaggagatgc 3221 Query: 556 ctgccaccatgcccaccaggttgat 580 | || || | ||| ||||||||||| Sbjct: 3220 cggcaacaacgccgaccaggttgat 3196
>ref|NM_191233.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2820 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 2768 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 2709 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 2708 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 2649 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 2648 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 2593
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 31421516 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 31421457 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 31421456 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 31421397 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 31421396 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 31421341
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 15580 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 15521 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 15520 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 15461 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 15460 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 15405
>dbj|AK105078.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-G07, full insert sequence Length = 1504 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 1162 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 1103 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 1102 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 1043 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 1042 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 987
>dbj|AK100475.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093O20, full insert sequence Length = 3462 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 3050 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 2991 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 2990 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 2931 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 2930 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 2875
>dbj|AK100374.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084J22, full insert sequence Length = 2024 Score = 127 bits (64), Expect = 5e-26 Identities = 148/176 (84%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| ||||| Sbjct: 1616 atgaacgggtcgatcttgacccagaggagggagaagacggaggcgagcaggacagaccag 1557 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | | ||||||||| ||||| |||||||| |||||||||||||||||||||||||| Sbjct: 1556 agcacgacgatggtgggcgtccggttctggcgacccatgagacccttgaggaaggggtac 1497 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccagga 522 | || | ||||||||| || | |||||| | ||| || ||||||||||||||||| Sbjct: 1496 aagtgcatgatcacccacatggcgaagaacaccttgccgaagagcgggccccagga 1441
>gb|BT019277.1| Zea mays clone Contig950.F mRNA sequence Length = 789 Score = 125 bits (63), Expect = 2e-25 Identities = 172/207 (83%), Gaps = 1/207 (0%) Strand = Plus / Plus Query: 374 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 433 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 270 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 329 Query: 434 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 493 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 330 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 389 Query: 494 aagagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatat 553 |||||||| || || || || ||||| || |||||| ||||| ||||| ||||| || || Sbjct: 390 aagagcttcccgaaaagaggtccccatgactggtaa-ccgctattgattgcgtaggaaat 448 Query: 554 gcctgccaccatgcccaccaggttgat 580 ||| || |||| ||| ||||||||||| Sbjct: 449 gccagcgaccacgccgaccaggttgat 475
>gb|AF200529.1|AF200529 Zea mays cellulose synthase-5 (CesA-5) mRNA, complete cds Length = 3676 Score = 125 bits (63), Expect = 2e-25 Identities = 172/207 (83%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 374 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 433 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 3408 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 3349 Query: 434 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 493 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 3348 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 3289 Query: 494 aagagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatat 553 |||||||| || || || || ||||| || |||||| ||||| ||||| ||||| || || Sbjct: 3288 aagagcttcccgaaaagaggtccccatgactggtaa-ccgctattgattgcgtaggaaat 3230 Query: 554 gcctgccaccatgcccaccaggttgat 580 ||| || |||| ||| ||||||||||| Sbjct: 3229 gccagcgaccacgccgaccaggttgat 3203
>gb|AY110079.1| Zea mays CL1164_1 mRNA sequence Length = 3696 Score = 125 bits (63), Expect = 2e-25 Identities = 172/207 (83%), Gaps = 1/207 (0%) Strand = Plus / Minus Query: 374 agggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttc 433 ||||| ||||| || || |||||||| | ||| || | ||| |||||||||||||||||| Sbjct: 3408 agggaaaagatcgacgcaaggaggatagcccagacaacgacaatggtcggcgtgcggttc 3349 Query: 434 tgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaag 493 |||||||||||||| ||||||||||||||||| || |||| |||||||||| | ||| Sbjct: 3348 tgcttccccatgaggcccttgaggaaggggtacaggtggacaatcacccagaacgcaaag 3289 Query: 494 aagagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatat 553 |||||||| || || || || ||||| || |||||| ||||| ||||| ||||| || || Sbjct: 3288 aagagcttcccgaaaagaggtccccatgactggtaa-ccgctattgattgcgtaggaaat 3230 Query: 554 gcctgccaccatgcccaccaggttgat 580 ||| || |||| ||| ||||||||||| Sbjct: 3229 gccagcgaccacgccgaccaggttgat 3203
>gb|AY372246.1| Zea mays cellulose synthase catalytic subunit 12 (CesA12) mRNA, complete cds Length = 3443 Score = 119 bits (60), Expect = 1e-23 Identities = 166/200 (83%), Gaps = 1/200 (0%) Strand = Plus / Minus Query: 347 atgaaagggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaa 406 ||||||||||||||| | |||||||| ||||||||||||||||| || || || ||||| Sbjct: 3201 atgaaagggtcgatcctgacccagagcagggagaagatggaggccagcagaatggaccag 3142 Query: 407 acgatgacgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtag 466 | || || | ||| ||||| | |||||| ||||||||| ||||||||||| |||||| Sbjct: 3141 atgacaacaacggtgggcgtcctgttctggcgccccatgagccccttgaggaacgggtag 3082 Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 526 || |||| ||| ||||||| | |||||||||||| || ||||| || |||||||| ||| Sbjct: 3081 aggtggacgatgacccagaaggcgaagaagagcttgccgaagaggggcccccaggactgg 3022 Query: 527 taacccgctgttgatggcgt 546 | ||||| |||||||||||| Sbjct: 3021 t-acccgttgttgatggcgt 3003
>gb|BT019129.1| Zea mays clone Contig756.F mRNA sequence Length = 754 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 485 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 426 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 425 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 366 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || || || |||||||| Sbjct: 365 aaggcgaagaagagcttcccgaacagggggcccca 331
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 15230807 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 15230748 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 15230747 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 15230688 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || |||||||||||||| Sbjct: 15230687 aaggcgaagaagagcttcccgaagagcgggcccca 15230653
>gb|AF200532.1|AF200532 Zea mays cellulose synthase-8 (CesA-8) mRNA, complete cds Length = 3812 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 3428 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 3369 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 3368 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 3309 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || || || |||||||| Sbjct: 3308 aaggcgaagaagagcttcccgaacagggggcccca 3274
>dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1740_D06 Length = 187410 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 124783 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 124724 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 124723 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 124664 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || |||||||||||||| Sbjct: 124663 aaggcgaagaagagcttcccgaagagcgggcccca 124629
>dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0418B08 Length = 165909 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 9996 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 9937 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 9936 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 9877 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || |||||||||||||| Sbjct: 9876 aaggcgaagaagagcttcccgaagagcgggcccca 9842
>dbj|AK121170.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081B08, full insert sequence Length = 3631 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 |||||||| | ||| |||||||||||||| || | ||||| | || || ||||| ||| Sbjct: 3196 acccagagcaaggaaaagatggaggcgagcagcacggaccagatgacaacaatggtgggc 3137 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || ||||||||| |||||||||| |||||||||||||||||||| |||| ||| |||||| Sbjct: 3136 gtccggttctgcctccccatgagccccttgaggaaggggtagaggtggacgatgacccag 3077 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || |||||||||||||| Sbjct: 3076 aaggcgaagaagagcttcccgaagagcgggcccca 3042
>gb|AY103701.1| Zea mays PCO120363 mRNA sequence Length = 3788 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 ||||| ||||| |||||||| ||||| || ||||| ||||| ||||||||||| |||||| Sbjct: 3413 acccacaggagcgagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggc 3354 Query: 425 gtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccag 484 || | ||||||| |||||| |||||||||||||| ||||| || |||| |||||||||| Sbjct: 3353 gtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccag 3294 Query: 485 attgagaagaagagctttccaaagagcgggcccca 519 | | |||||||||||| || || || |||||||| Sbjct: 3293 aacgcgaagaagagcttcccgaacagggggcccca 3259
>gb|DQ020213.1| Bambusa oldhamii cellulose synthase BoCesA5 mRNA, complete cds Length = 3613 Score = 111 bits (56), Expect = 3e-21 Identities = 144/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | ||| |||| || |||||||| ||||||||||| Sbjct: 3373 ggagaagatagatgcaaggaggatggcccagacgacaacaatggtcggtgtgcggttctg 3314 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| | |||| |||||||||| | |||||| Sbjct: 3313 ccgacccatgagacccttaaggaaggggtacaagtggacaatcacccagaaggcgaagaa 3254 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| ||||||||||| ||||| || |||||| ||||||||||| ||||| Sbjct: 3253 gagcttcccaaagagcggtccccatgactggtaa-ccgctgttgatcgcgta 3203
>gb|BT018125.1| Zea mays clone EL01N0554C08.c mRNA sequence Length = 1450 Score = 105 bits (53), Expect = 2e-19 Identities = 168/205 (81%), Gaps = 1/205 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || || ||||||| |||||| | ||||||||||| ||||||||||| Sbjct: 1184 ggagaagatcgacgccagcaggatcgcccaaacaaccacgatggtcggggtgcggttctg 1125 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||||||||| ||||| || | | ||||||||||| | ||| || Sbjct: 1124 ccgacccatgagacccttgaggaacgggtacaggggaacgatcacccagaaggcgaaaaa 1065 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgc 555 ||||| || || ||||| ||||| || |||| ||||||||||||||||||| || |||| Sbjct: 1064 aagcttgccgaaaagcggaccccacgactggt-acccgctgttgatggcgtaggagatgc 1006 Query: 556 ctgccaccatgcccaccaggttgat 580 | || || | ||| ||||||||||| Sbjct: 1005 cggcaacaacgccgaccaggttgat 981
>gb|BT009583.1| Triticum aestivum clone wre1n.pk0043.h8:fis, full insert mRNA sequence Length = 993 Score = 103 bits (52), Expect = 7e-19 Identities = 143/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 703 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 644 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 643 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 584 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| ||||||||||| ||||| ||||||||| || |||||||||||||| Sbjct: 583 gagcttcccaaagagcggcccccatgattggtaa-ccactgttgatggcgta 533
>gb|BT009438.1| Triticum aestivum clone wlmk4.pk0015.a11:fis, full insert mRNA sequence Length = 3626 Score = 103 bits (52), Expect = 7e-19 Identities = 143/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3224 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3165 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 3164 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 3105 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| ||||||||||| ||||| ||||||||| || |||||||||||||| Sbjct: 3104 gagcttcccaaagagcggcccccatgattggtaa-ccactgttgatggcgta 3054
>dbj|AB158407.1| Triticum aestivum CesA mRNA for putative cellulose synthase, complete cds Length = 3681 Score = 103 bits (52), Expect = 7e-19 Identities = 143/172 (83%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || |||||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3250 ggagaagatagaagcgaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3191 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | ||||| |||||||||||||| ||||| | || | |||||||||| | ||||| Sbjct: 3190 cctgcccataagacccttgaggaatgggtataagtgaacaatcacccagaaggcaaagaa 3131 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| ||||||||||| ||||| ||||||||| || |||||||||||||| Sbjct: 3130 gagcttcccaaagagcggcccccatgattggtaa-ccactgttgatggcgta 3080
>gb|AY483153.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA5) mRNA, partial cds Length = 2814 Score = 101 bits (51), Expect = 3e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 353 gggtcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatg 412 ||||||||||| ||||||||||||||||||| ||||| || |||| ||||| | ||| Sbjct: 2579 gggtcgatcttgacccagaggagggagaagaccgaggccagcaggacggaccagagtatg 2520 Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| || || ||||||||| |||||||||||||||||||| ||||| || || Sbjct: 2519 acgatggtgggagtccggttctgccggcccatgagacccttgaggaacgggtacaggtgc 2460 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggcccca 519 | |||||||| || |||||||| | ||| || |||||||| ||||| Sbjct: 2459 ataatcacccacatggagaagaacaccttgccgaagagcggccccca 2413
>ref|XM_477093.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3954 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 3567 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 3508 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 3507 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 3449 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 3448 gctgttgatcgcgtatga 3431
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 5885322 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 5885381 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 5885382 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 5885440 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 5885441 gctgttgatcgcgtatga 5885458 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Plus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 13688719 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 13688778 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 13688779 ggtccccatgatt 13688791 Score = 44.1 bits (22), Expect = 0.53 Identities = 46/54 (85%) Strand = Plus / Minus Query: 448 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 501 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 8533242 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 8533189
>dbj|AP003748.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1136_A05 Length = 120823 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 27770 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 27829 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 27830 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 27888 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 27889 gctgttgatcgcgtatga 27906
>dbj|AP003837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1559_F09 Length = 87792 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 59996 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 60055 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 60056 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 60114 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 60115 gctgttgatcgcgtatga 60132
>dbj|AK072356.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023059I02, full insert sequence Length = 3954 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 3567 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 3508 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 3507 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 3449 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 3448 gctgttgatcgcgtatga 3431
>dbj|AK062007.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-E01, full insert sequence Length = 1241 Score = 99.6 bits (50), Expect = 1e-17 Identities = 117/138 (84%), Gaps = 1/138 (0%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 ||||||||||| |||||||| ||| ||||| |||||||||||||||||||| | ||| Sbjct: 854 acgatggtcggagtgcggttttgccgacccataagacccttgaggaaggggtacaagtgg 795 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaaccc 532 | |||||||||| | ||||||||||| ||||||||||| ||||| ||||||| | || Sbjct: 794 acaatcacccagaaggcaaagaagagcttgccaaagagcggtccccatgattggt-agcc 736 Query: 533 gctgttgatggcgtatga 550 ||||||||| |||||||| Sbjct: 735 gctgttgatcgcgtatga 718
>gb|AY483150.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3605 Score = 95.6 bits (48), Expect = 2e-16 Identities = 142/172 (82%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || ||||||| | ||| |||||||| || ||||| |||||||| || Sbjct: 3225 ggagaagattgaagccaggaggacagcccagacgatgacaatcgtcggtgtgcggttttg 3166 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | ||||| |||||||||||||||||||| | || | |||||||||| | ||||| Sbjct: 3165 cctgcccataagacccttgaggaaggggtataagtgaacaatcacccagaaggcaaagaa 3106 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| || |||||||| ||||| ||||||||| || |||||||||||||| Sbjct: 3105 gagcttcccgaagagcggcccccaagattggtaa-ccactgttgatggcgta 3055
>ref|XM_470040.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3607 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 3529 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 3470 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 3469 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 3410 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 3409 gagcttcccaaagagcggaccccatgactggta 3377
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Plus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 33476953 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 33477012 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 33477013 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 33477072 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 33477073 gagcttcccaaagagcggaccccatgactggta 33477105
>gb|AC145384.2| Oryza sativa chromosome 3 BAC OSJNBa0060M17 genomic sequence, complete sequence Length = 41693 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Plus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 6180 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 6239 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 6240 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 6299 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 6300 gagcttcccaaagagcggaccccatgactggta 6332
>gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete sequence Length = 154555 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 21158 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 21099 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 21098 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 21039 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 21038 gagcttcccaaagagcggaccccatgactggta 21006
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Plus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 33567463 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 33567522 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 33567523 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 33567582 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 33567583 gagcttcccaaagagcggaccccatgactggta 33567615
>dbj|AK069196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003G18, full insert sequence Length = 4282 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 3418 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 3359 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 3358 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 3299 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 3298 gagcttcccaaagagcggaccccatgactggta 3266
>dbj|AK061688.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B05, full insert sequence Length = 1582 Score = 89.7 bits (45), Expect = 1e-14 Identities = 126/153 (82%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||| || || |||||||| | |||||| | || |||||||| || |||||||| Sbjct: 1083 ggagaagatcgatgcaaggaggatggcccaaacaacaacaatggtcggtgtacggttctg 1024 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | |||||||||||||| ||||||||||| || |||| |||||||||| | ||||| Sbjct: 1023 ccgacccatgagacccttaaggaaggggtacaggtggacaatcacccagaaggcaaagaa 964 Query: 496 gagctttccaaagagcgggccccaggattggta 528 |||||| ||||||||||| ||||| || ||||| Sbjct: 963 gagcttcccaaagagcggaccccatgactggta 931
>dbj|AP004509.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT16K17, TM0037a, complete sequence Length = 84322 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Plus Query: 416 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 475 ||||||||||||||||||||| ||||| | ||| |||||||| || |||||||||| Sbjct: 44306 atggtcggcgtgcggttctgccgacccatcaaacctttgaggaatggatagagatggaca 44365 Query: 476 atcacccagattgagaagaagagctttccaaagagcgggccccaggattggta 528 |||||||||| || ||||||||||| ||||| || || |||||||||||||| Sbjct: 44366 atcacccagaaggaaaagaagagcttcccaaatagtggtccccaggattggta 44418
>gb|DQ020212.1| Bambusa oldhamii cellulose synthase BoCesA4b mRNA, partial cds Length = 3409 Score = 83.8 bits (42), Expect = 6e-13 Identities = 106/126 (84%), Gaps = 1/126 (0%) Strand = Plus / Minus Query: 416 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 475 ||||||||||||||||| ||| | |||||||||||||||||||| ||||| | || | Sbjct: 3086 atggtcggcgtgcggttttgcctacccatgagacccttgaggaatgggtacaagtgaaca 3027 Query: 476 atcacccagattgagaagaagagctttccaaagagcgggccccaggattggtaacccgct 535 |||||||||| | ||||||||||| |||||||| || ||||| ||||||| | ||||| Sbjct: 3026 atcacccagaaagcaaagaagagcttcccaaagagtggcccccatgattggt-agccgct 2968 Query: 536 gttgat 541 |||||| Sbjct: 2967 gttgat 2962
>gb|DQ020211.1| Bambusa oldhamii cellulose synthase BoCesA4a mRNA, complete cds Length = 3756 Score = 79.8 bits (40), Expect = 1e-11 Identities = 140/172 (81%), Gaps = 1/172 (0%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 ||||||||||||||| ||||| || | ||| |||| || ||||| || |||||||| || Sbjct: 3404 ggagaagatggaggcaaggagaattgcccagacgacaacaatggttggtgtgcggttttg 3345 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | | |||||||||||||| ||||| ||||| | || | |||||||||| | ||||| Sbjct: 3344 cctacccatgagacccttcaggaatgggtacaagtgaacaatcacccagaaggcaaagaa 3285 Query: 496 gagctttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 |||||| |||||||| || ||||| ||||||| | ||||||||||| ||||| Sbjct: 3284 gagcttcccaaagagtggcccccatgattggt-agccgctgttgatcgcgta 3234
>gb|AF200530.1|AF200530 Zea mays cellulose synthase-6 (CesA-6) mRNA, complete cds Length = 3538 Score = 79.8 bits (40), Expect = 1e-11 Identities = 121/148 (81%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 |||||||| || || |||||||| ||||| || ||||| || || ||||| | ||||||| Sbjct: 3140 gagaagatcgaagccaggaggatggaccagacaatgacaatcgttggcgtcctgttctgc 3081 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 |||| | |||||||||||||| ||||| ||||||| ||||||||| | || |||||| Sbjct: 3080 ctcccaaccagacccttgaggaacgggtaaagatggacgatcacccaaaatgcaaagaag 3021 Query: 497 agctttccaaagagcgggccccaggatt 524 ||||| || || || |||||||| |||| Sbjct: 3020 agcttcccgaacagggggccccatgatt 2993
>gb|AY104730.1| Zea mays PCO100501 mRNA sequence Length = 3783 Score = 79.8 bits (40), Expect = 1e-11 Identities = 121/148 (81%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 |||||||| || || |||||||| ||||| || ||||| || || ||||| | ||||||| Sbjct: 3373 gagaagatcgaagccaggaggatggaccagacaatgacaatcgttggcgtcctgttctgc 3314 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 |||| | |||||||||||||| ||||| ||||||| ||||||||| | || |||||| Sbjct: 3313 ctcccaaccagacccttgaggaacgggtaaagatggacgatcacccaaaatgcaaagaag 3254 Query: 497 agctttccaaagagcgggccccaggatt 524 ||||| || || || |||||||| |||| Sbjct: 3253 agcttcccgaacagggggccccatgatt 3226
>gb|AY483151.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA3) mRNA, partial cds Length = 3362 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Minus Query: 376 ggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctg 435 |||||||||||| || || ||||| | ||| |||| ||||||||||||||||||||||| Sbjct: 3078 ggagaagatggatgcaagaaggatggcccagacgacaacgatggtcggcgtgcggttctg 3019 Query: 436 cttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaa 495 | ||||| || ||||||||||| ||||| | |||| |||||||||| | ||||| Sbjct: 3018 ccgtcccattagccccttgaggaatgggtacaagtggataatcacccagaaggcaaagaa 2959 Query: 496 gagctttccaaagagcgggcccca 519 |||||| || || ||||| ||||| Sbjct: 2958 gagcttcccgaaaagcggtcccca 2935
>emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-76H16 on chromosome 3, complete sequence Length = 133910 Score = 71.9 bits (36), Expect = 2e-09 Identities = 96/116 (82%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||| |||||||| ||||| ||||| || |||||||||||||||||| Sbjct: 129712 acgatggttggcgttcggttctggcgtcccataagacctttaaggaaggggtagagatgg 129653 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggta 528 | ||||||||| | || ||||| || || |||||||| || ||||| |||||||| Sbjct: 129652 atgatcacccaaaatgcaaagaaaagtttaccaaagagtggtccccatgattggta 129597
>gb|AC149572.14| Medicago truncatula clone mth2-116e22, complete sequence Length = 120017 Score = 71.9 bits (36), Expect = 2e-09 Identities = 96/116 (82%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||| |||||||| ||||| ||||| || |||||||||||||||||| Sbjct: 93734 acgatggttggcgttcggttctggcgtcccataagacctttaaggaaggggtagagatgg 93675 Query: 473 aggatcacccagattgagaagaagagctttccaaagagcgggccccaggattggta 528 | ||||||||| | || ||||| || || |||||||| || ||||| |||||||| Sbjct: 93674 atgatcacccaaaatgcaaagaaaagtttaccaaagagtggtccccatgattggta 93619
>gb|DQ124221.1| Fagus sylvatica putative cellulose synthase mRNA, partial cds Length = 825 Score = 69.9 bits (35), Expect = 9e-09 Identities = 90/107 (84%), Gaps = 1/107 (0%) Strand = Plus / Minus Query: 441 ccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagct 500 |||| ||||| || |||||||| || ||||||| |||||||| | | ||||||||||| Sbjct: 824 ccatcagacctttaaggaagggataaagatggacaatcacccaaaaggcgaagaagagct 765 Query: 501 ttccaaagagcgggccccaggattggtaacccgctgttgatggcgta 547 | |||||||| || ||||| ||||||||| |||||||| |||||||| Sbjct: 764 tcccaaagagaggaccccatgattggtaa-ccgctgtttatggcgta 719
>gb|AY221087.1| Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds Length = 3997 Score = 69.9 bits (35), Expect = 9e-09 Identities = 102/123 (82%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 499 ||||||||||| |||||||||||||| || || | ||||||||||| | ||||| | Sbjct: 3441 cccatgagacctttgaggaaggggtaaaggtgaacgatcacccagaaagcaaagaataat 3382 Query: 500 tttccaaagagcgggccccaggattggtaacccgctgttgatggcgtatgatatgcctgc 559 || |||||||| || ||||| ||||||||| || ||||||||||| ||||| ||||| || Sbjct: 3381 ttaccaaagaggggaccccatgattggtaa-ccactgttgatggcatatgagatgccggc 3323 Query: 560 cac 562 ||| Sbjct: 3322 cac 3320
>gb|AY483152.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2) mRNA, complete cds Length = 3907 Score = 67.9 bits (34), Expect = 4e-08 Identities = 106/130 (81%) Strand = Plus / Minus Query: 395 aggatcgaccaaacgatgacgatggtcggcgtgcggttctgcttccccatgagacccttg 454 ||||| ||||| ||||| ||||| ||||| || | ||||||| | |||| ||||||||| Sbjct: 3250 aggatggaccagacgatcacgatcgtcggggtcctgttctgccttcccaacagacccttg 3191 Query: 455 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 514 ||||| ||||| ||||| | |||||||||| | |||||||||||| || ||||| || Sbjct: 3190 aggaacgggtacagatgaacaatcacccagaacgcgaagaagagcttcccgaagagaggc 3131 Query: 515 ccccaggatt 524 ||||| |||| Sbjct: 3130 ccccatgatt 3121
>gb|DQ014506.1| Eucalyptus grandis cellulose synthase 2 (CesA2) mRNA, complete cds Length = 3471 Score = 67.9 bits (34), Expect = 4e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 430 gttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccagattga 489 |||||| || ||||| ||||| |||||||| ||||||||||||| ||||||||| | | Sbjct: 3099 gttctgttttcccatcagacctttgaggaaagggtagagatggacgatcacccaaaaggc 3040 Query: 490 gaagaagagctttccaaagagcgggcccca 519 |||||||||||| || || || |||||||| Sbjct: 3039 gaagaagagcttcccgaacagagggcccca 3010
>gb|AY633545.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA5) gene, partial cds Length = 2345 Score = 63.9 bits (32), Expect = 6e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggc 424 ||||| ||||| ||||||||||||||||| || || ||||| ||||| || ||||| ||| Sbjct: 2341 acccacaggagagagaagatggaggcgagcagaatggaccacacgatcacaatggtaggc 2282 Query: 425 gtgcggttctgc 436 || ||||||||| Sbjct: 2281 gttcggttctgc 2270
>gb|AY262815.1| Pinus radiata cellulose synthase (CesA3) mRNA, partial cds Length = 1333 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||||||||| ||| ||||||||||| ||||||||||| || | |||| Sbjct: 878 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 819 Query: 473 aggatcacccagattgagaa 492 || |||||||| | |||||| Sbjct: 818 agaatcacccatactgagaa 799
>gb|AF150630.2|AF150630 Gossypium hirsutum cellulose synthase catalytic subunit (celA3) mRNA, complete cds Length = 3723 Score = 63.9 bits (32), Expect = 6e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 457 gaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcgggcc 516 ||||||||||||||||| ||||||||||| | ||||| ||||| |||||||| || || Sbjct: 3313 gaaggggtagagatggatgatcacccagaaggcaaagaatagcttaccaaagaggggacc 3254 Query: 517 ccaggattggta 528 ||| |||||||| Sbjct: 3253 ccatgattggta 3242
>gb|AY789650.1| Pinus taeda cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3127 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatgg 472 |||||||| ||||||||||| ||| ||||||||||| ||||||||||| || | |||| Sbjct: 2861 acgatggtaggcgtgcggttttgccgacccatgagacctttgaggaagggatacaaatgg 2802 Query: 473 aggatcacccagattgagaa 492 || |||||||| | |||||| Sbjct: 2801 agaatcacccatactgagaa 2782
>gb|AY643520.1| Acacia mangium CesA2 mRNA, complete cds Length = 3643 Score = 58.0 bits (29), Expect = 4e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 499 ||||||||||| ||||||| || |||||||||| |||||||| | || |||||| ||| Sbjct: 3349 cccatgagacctctgaggaaaggatagagatggataatcacccaaaatgcgaagaaaagc 3290 Query: 500 tttccaaagagcgggccccaggattggta 528 || ||||| ||||| ||||| || ||||| Sbjct: 3289 ttgccaaatagcggaccccatgactggta 3261
>gb|DQ160225.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA7) mRNA, complete cds Length = 4016 Score = 58.0 bits (29), Expect = 4e-05 Identities = 131/165 (79%) Strand = Plus / Minus Query: 364 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 423 |||||| || || ||||||||||| || || ||||||||||| ||||| ||||| ||||| Sbjct: 3358 cacccacagaagcgagaagatggacgccagcaggatcgaccacacgatcacgatcgtcgg 3299 Query: 424 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 483 || |||||||| ||||| |||||||| ||||| || || | || | ||||||||| Sbjct: 3298 tgtccggttctgtcgtcccatcagacccttcaggaacggatacaagtgaacgatcaccca 3239 Query: 484 gattgagaagaagagctttccaaagagcgggccccaggattggta 528 || | ||| || ||||| || || ||||||||||| || ||||| Sbjct: 3238 gaacgcgaaaaacagcttcccgaacagcgggccccacgactggta 3194
>gb|DQ160224.1| Physcomitrella patens cellulose synthase catalytic subunit (CesA6) mRNA, complete cds Length = 4070 Score = 58.0 bits (29), Expect = 4e-05 Identities = 131/165 (79%) Strand = Plus / Minus Query: 364 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 423 |||||| || || ||||||||||| || || ||||||||||| ||||| ||||| ||||| Sbjct: 3385 cacccacagaagcgagaagatggacgccagcaggatcgaccacacgatcacgatcgtcgg 3326 Query: 424 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 483 || |||||||| ||||| |||||||| ||||| || || | || | ||||||||| Sbjct: 3325 tgtccggttctgtcgtcccatcagacccttcaggaacggatacaagtgaacgatcaccca 3266 Query: 484 gattgagaagaagagctttccaaagagcgggccccaggattggta 528 || | ||| || ||||| || || ||||||||||| || ||||| Sbjct: 3265 gaacgcgaaaaacagcttcccgaacagcgggccccacgactggta 3221
>gb|AY095297.1| Populus tremuloides cellulose synthase (CesA2) mRNA, complete cds Length = 3277 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 438 tccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaaga 497 ||||||| ||||| |||||||| ||||||||||||| |||||||||| | ||||||| Sbjct: 2979 tccccattagacctttgaggaatgggtagagatggacaatcacccagaaggcaaagaaga 2920 Query: 498 gctt 501 |||| Sbjct: 2919 gctt 2916
>gb|DQ014508.1| Eucalyptus grandis cellulose synthase 4 (CesA4) mRNA, complete cds Length = 3782 Score = 56.0 bits (28), Expect = 1e-04 Identities = 97/120 (80%) Strand = Plus / Minus Query: 364 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcgg 423 |||||| || || ||||| ||||| || ||||||||||||||||| | || ||||| || Sbjct: 3355 cacccacagaagtgagaaaatggatgctaggaggatcgaccaaacaactacaatggttgg 3296 Query: 424 cgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcaccca 483 ||||| ||||| ||||| ||||| |||||||||||||| || || | ||||||||| Sbjct: 3295 tgtgcgtttctggcgtcccatcagacctttgaggaaggggtacaggtgaacgatcaccca 3236
>gb|DQ014505.1| Eucalyptus grandis cellulose synthase 1 (CesA1) mRNA, complete cds Length = 3341 Score = 56.0 bits (28), Expect = 1e-04 Identities = 130/164 (79%) Strand = Plus / Minus Query: 356 tcgatcttcacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacg 415 |||||||||||||||| ||| ||||||| || || || || | |||||| | | || Sbjct: 2988 tcgatcttcacccagacgagagagaagacagaagccagaagcaccgaccagagaaccaca 2929 Query: 416 atggtcggcgtgcggttctgcttccccatgagacccttgaggaaggggtagagatggagg 475 |||||||| || | ||||||| | ||||||||||| || ||||| || |||||||| || Sbjct: 2928 atggtcggagtcctgttctgcctacccatgagacctttcaggaatggatagagatgaaga 2869 Query: 476 atcacccagattgagaagaagagctttccaaagagcgggcccca 519 |||||||||| || ||||||| ||| || ||||| || ||||| Sbjct: 2868 atcacccagaatgcaaagaagaccttgccgaagaggggtcccca 2825
>gb|AF525360.1| Mesotaenium caldariorum cellulose synthase catalytic subunit (CesA1) gene, complete cds Length = 6176 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagc 499 ||||||||||||||||||||||| || || || | | |||||||| | ||||||||| Sbjct: 5771 cccatgagacccttgaggaagggatacaggtgcacaaccacccagaaggcaaagaagagc 5712 Query: 500 tttccaaagagcgggcccca 519 ||||| ||||| |||||||| Sbjct: 5711 tttccgaagagggggcccca 5692
>gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose synthase gene, partial cds Length = 452 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 223
>gb|AY639654.1| Pinus radiata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds Length = 3911 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 3308 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 3262
>gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRNA, partial cds Length = 2287 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1823 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1764 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 1763 aaaagcggtccccatgactggta 1741
>gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRNA, partial cds Length = 2588 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 2156 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 2097 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 2096 aaaagcggtccccatgactggta 2074
>gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRNA, partial cds Length = 2489 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1935 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1876 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 1875 aaaagcggtccccatgactggta 1853
>gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRNA, partial cds Length = 1989 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 1377 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 1318 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 1317 aaaagcggtccccatgactggta 1295
>gb|AY262814.1| Pinus radiata cellulose synthase (CesA11) mRNA, partial cds Length = 1258 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 818 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 759 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 758 aaaagcggtccccatgactggta 736
>gb|AY789652.1| Pinus taeda cellulose synthase catalytic subunit (CesA3) mRNA, complete cds Length = 3959 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | |||||||||||||||||||| Sbjct: 3298 acgatggtgggtgttcggttctgcctgcccatgagacccttgaggaa 3252
>gb|AY789651.1| Pinus taeda cellulose synthase catalytic subunit (CesA2) mRNA, complete cds Length = 3478 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 446 agacccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttcca 505 ||||||||||||||||| || ||||| | ||||||||| | |||||| ||||||||| Sbjct: 3083 agacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaatagctttcca 3024 Query: 506 aagagcgggccccaggattggta 528 || ||||| ||||| || ||||| Sbjct: 3023 aaaagcggtccccatgactggta 3001
>gb|DQ014507.1| Eucalyptus grandis cellulose synthase 3 (CesA3) mRNA, complete cds Length = 3452 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Minus Query: 428 cggttctgcttccccatgagacccttgaggaaggggtagagatggaggatcacccaga 485 |||||||| ||||||| || || || |||||||| ||||||||||| |||||||||| Sbjct: 3026 cggttctgtctccccatcagccctttcaggaagggatagagatggagaatcacccaga 2969
>gb|AY055724.2| Populus tremuloides cellulose synthase (CesA5) mRNA, complete cds Length = 3532 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 455 aggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagcggg 514 ||||| || |||||||||| ||||||||||| | |||||| ||||| |||||||| || Sbjct: 3315 aggaaaggatagagatggacgatcacccagaaagcgaagaaaagcttgccaaagagtgga 3256 Query: 515 cccca 519 ||||| Sbjct: 3255 cccca 3251
>gb|AC150787.15| Medicago truncatula clone mth2-171n13, complete sequence Length = 82665 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 491 aagaagagctttccaaagagcgggccccaggattggtaacc 531 ||||||||||||||||| || || ||||| ||||||||||| Sbjct: 48754 aagaagagctttccaaatagtggaccccaagattggtaacc 48794
>gb|AC140546.12| Medicago truncatula clone mth2-35l19, complete sequence Length = 106962 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 526 ||||||| |||||||||| || |||||||| |||||||| || || ||||| |||||| Sbjct: 31271 agatggacaatcacccagaaggaaaagaagagttttccaaatagaggtccccatgattgg 31212 Query: 527 taacc 531 ||||| Sbjct: 31211 taacc 31207
>gb|AC150446.8| Medicago truncatula clone mth2-101n14, complete sequence Length = 109162 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 467 agatggaggatcacccagattgagaagaagagctttccaaagagcgggccccaggattgg 526 ||||||| |||||||||| || |||||||| |||||||| || || ||||| |||||| Sbjct: 107059 agatggacaatcacccagaaggaaaagaagagttttccaaatagaggtccccatgattgg 107000 Query: 527 taacc 531 ||||| Sbjct: 106999 taacc 106995
>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0084P08 Length = 158656 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Plus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 156338 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 156397 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 156398 ggtccccatgatt 156410
>dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0409D09 Length = 150485 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Plus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 39711 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 39770 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 39771 ggtccccatgatt 39783
>dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086F23, full insert sequence Length = 4127 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 3380 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 3321 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 3320 ggtccccatgatt 3308
>dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013085H01, full insert sequence Length = 1867 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 1185 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 1126 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 1125 ggtccccatgatt 1113
>dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099F14, full insert sequence Length = 3221 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 2474 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 2415 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 2414 ggtccccatgatt 2402
>dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H11, full insert sequence Length = 1827 Score = 50.1 bits (25), Expect = 0.009 Identities = 61/73 (83%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| ||||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 1080 ttgaggaatgggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 1021 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 1020 ggtccccatgatt 1008
>gb|AY573575.1| Populus tremula x Populus tremuloides cellulose synthase (CesA4) mRNA, complete cds Length = 3778 Score = 48.1 bits (24), Expect = 0.034 Identities = 30/32 (93%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcaccca 483 ||||||||||||||||| |||||||| ||||| Sbjct: 3335 ttgaggaaggggtagaggtggaggatgaccca 3304
>gb|AY162180.1| Populus tremuloides cellulose synthase (CesA7) mRNA, complete cds Length = 3809 Score = 48.1 bits (24), Expect = 0.034 Identities = 30/32 (93%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcaccca 483 ||||||||||||||||| |||||||| ||||| Sbjct: 3301 ttgaggaaggggtagaggtggaggatgaccca 3270
>gb|DQ020215.1| Bambusa oldhamii cellulose synthase BoCesA7 mRNA, partial cds Length = 2997 Score = 48.1 bits (24), Expect = 0.034 Identities = 57/68 (83%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| || || ||||||| |||||||||| || ||||||||||| |||||||| Sbjct: 2223 ttgaggaatggatatagatggacaatcacccagaatgcaaagaagagcttcccaaagaga 2164 Query: 512 gggcccca 519 || ||||| Sbjct: 2163 ggccccca 2156
>gb|AY764732.1|AY764731S2 Pinus taeda isolate 27 cellulose synthase gene, partial cds Length = 452 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Minus Query: 413 acgatggtcggcgtgcggttctgcttccccatgagacccttgaggaa 459 |||||||| || || ||||||||| | ||||||||||| |||||||| Sbjct: 269 acgatggtgggtgttcggttctgcctgcccatgagacctttgaggaa 223
>ref|XM_477282.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3746 Score = 44.1 bits (22), Expect = 0.53 Identities = 46/54 (85%) Strand = Plus / Minus Query: 448 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 501 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 3191 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 3138
>gb|AY632360.1| Gossypium hirsutum BAC 106I22, complete sequence Length = 135862 Score = 44.1 bits (22), Expect = 0.53 Identities = 40/46 (86%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 485 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 62232 cccataagacctttgaggaatggataaagatggaggatgacccaga 62187
>gb|AY632359.1| Gossypium hirsutum BAC 155C17, complete sequence Length = 103930 Score = 44.1 bits (22), Expect = 0.53 Identities = 40/46 (86%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 485 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 61247 cccataagacctttgaggaatggataaagatggaggatgacccaga 61202
>ref|XM_540001.2| PREDICTED: Canis familiaris similar to ring finger protein 127 (LOC482886), mRNA Length = 3897 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 203 cttccgtcttcatctacaacca 224 |||||||||||||||||||||| Sbjct: 1739 cttccgtcttcatctacaacca 1718
>ref|XM_499743.1| Yarrowia lipolytica CLIB122, YALI0A03949g predicted mRNA Length = 2712 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 451 cttgaggaaggggtagagatgg 472 |||||||||||||||||||||| Sbjct: 2229 cttgaggaaggggtagagatgg 2208
>gb|AF413210.1|AF413210 Gossypium hirsutum cellulose synthase A4 (CesA4) gene, complete cds Length = 6886 Score = 44.1 bits (22), Expect = 0.53 Identities = 40/46 (86%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 485 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 6618 cccataagacctttgaggaatggataaagatggaggatgacccaga 6573
>dbj|AP005824.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0669H03 Length = 167878 Score = 44.1 bits (22), Expect = 0.53 Identities = 46/54 (85%) Strand = Plus / Minus Query: 448 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 501 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 65710 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 65657
>dbj|AK100914.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133D04, full insert sequence Length = 3746 Score = 44.1 bits (22), Expect = 0.53 Identities = 46/54 (85%) Strand = Plus / Minus Query: 448 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 501 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 3191 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 3138
>dbj|AK059649.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C05, full insert sequence Length = 1335 Score = 44.1 bits (22), Expect = 0.53 Identities = 46/54 (85%) Strand = Plus / Minus Query: 448 acccttgaggaaggggtagagatggaggatcacccagattgagaagaagagctt 501 |||||||||||| || || ||||||| |||||||||| || ||||||||||| Sbjct: 528 acccttgaggaacggatatagatggacaatcacccagaatgcaaagaagagctt 475
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 451 cttgaggaaggggtagagatgg 472 |||||||||||||||||||||| Sbjct: 441477 cttgaggaaggggtagagatgg 441456
>gb|U58283.1|GHU58283 Gossypium hirsutum cellulose synthase (celA1) mRNA, complete cds Length = 3186 Score = 44.1 bits (22), Expect = 0.53 Identities = 40/46 (86%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatggaggatcacccaga 485 ||||| ||||| |||||||| || || ||||||||||| ||||||| Sbjct: 2853 cccataagacctttgaggaatggataaagatggaggatgacccaga 2808
>ref|XM_529209.1| PREDICTED: Pan troglodytes plexin A3 (PLXNA3), mRNA Length = 5649 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 412 gaggaggaagaagagggaggcgaggagga 440
>gb|BC000028.2| Homo sapiens family with sequence similarity 50, member A, mRNA (cDNA clone MGC:1514 IMAGE:3505365), complete cds Length = 1358 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>gb|AC146111.3| Pan troglodytes BAC clone RP43-38O16 from 7, complete sequence Length = 158242 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacca 573 ||||||||||||||||||||| Sbjct: 102612 tgcctgccaccatgcccacca 102632
>ref|NM_004699.1| Homo sapiens family with sequence similarity 50, member A (FAM50A), mRNA Length = 1311 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 448 gaggaggaagaagagggaggcgaggagga 476
>gb|AF394543.1| Oryza sativa alpha-expansin OsEXPA1 (EXPA1) gene, complete cds Length = 2637 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 182 gcaataatttagataaaaatc 202 ||||||||||||||||||||| Sbjct: 740 gcaataatttagataaaaatc 760
>emb|BX936365.3| Human DNA sequence from clone WI2-81657B9 on chromosome X Contains the 3' end of the GDI1 gene for GDP dissociation inhibitor 1, the FAM50A gene for family with sequence similarity 50, member A, a novel gene (DXS9879E) gene , the PLXNA3 gene for plexin A3 and a CpG island, complete sequence Length = 39835 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 4488 gaggaggaagaagagggaggcgaggagga 4516
>emb|AL513218.27| Human DNA sequence from clone RP11-155O18 on chromosome 1 Contains the 3' end of the MADHIP gene for MAD (mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor), gene KIAA1836, a phospholipase A2 group XII (PLA2G12) pseudogene, the ORC1L gene for origin recognition complex subunit 1-like (yeast) and the 5' end of gene FLJ34719, complete sequence Length = 107627 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 548 tgatatgcctgccaccatgcccacc 572 |||| |||||||||||||||||||| Sbjct: 93614 tgatttgcctgccaccatgcccacc 93590
>emb|AL355333.18| Human DNA sequence from clone RP11-575N15 on chromosome 10, complete sequence Length = 180545 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 ctaagcaacaaagaacaggta 83 ||||||||||||||||||||| Sbjct: 106696 ctaagcaacaaagaacaggta 106716
>emb|AL034346.31|HS668J24 Human DNA sequence from clone RP4-668J24 on chromosome 6p25.1-25.3 Contians the FOXF2 gene for forkhead box F2, complete sequence Length = 120429 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 446 agacccttgaggaaggggtag 466 ||||||||||||||||||||| Sbjct: 113401 agacccttgaggaaggggtag 113421
>emb|Z46376.1|HSCHK2 H.sapiens HK2 mRNA for hexokinase II Length = 5292 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 864 gaggaggaagaagagggaggcgaggagga 836
>gb|DQ124074.1| Coffea arabica clone MN-SSH3-C06 mRNA sequence Length = 241 Score = 42.1 bits (21), Expect = 2.1 Identities = 48/57 (84%) Strand = Plus / Plus Query: 364 cacccagaggagggagaagatggaggcgaggaggatcgaccaaacgatgacgatggt 420 ||||||||| | |||||||||||| || ||||| || ||||| || ||||| ||||| Sbjct: 177 cacccagagcaaggagaagatggatgcaaggagtatggaccagacaatgacaatggt 233
>emb|BX927148.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 1/10 Length = 348071 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 554 gcctgccaccatgcccaccag 574 ||||||||||||||||||||| Sbjct: 47800 gcctgccaccatgcccaccag 47820
>emb|CR625912.1| full-length cDNA clone CS0DN002YB06 of Adult brain of Homo sapiens (human) Length = 1243 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 449 gaggaggaagaagagggaggcgaggagga 477
>emb|CR623814.1| full-length cDNA clone CS0DI060YH13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1295 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 458 gaggaggaagaagagggaggcgaggagga 486
>emb|CR619686.1| full-length cDNA clone CS0DI061YG13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1286 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 458 gaggaggaagaagagggaggcgaggagga 486
>emb|CR614465.1| full-length cDNA clone CS0DM009YL24 of Fetal liver of Homo sapiens (human) Length = 1294 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>emb|CR612868.1| full-length cDNA clone CS0DF027YP23 of Fetal brain of Homo sapiens (human) Length = 1628 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 454 gaggaggaagaagagggaggcgaggagga 482
>gb|AC123593.1| Genomic sequence for Medicago truncatula, clone MTABa0052G10, complete sequence Length = 100769 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Minus Query: 491 aagaagagctttccaaagagcgggccccaggattggtaacc 531 ||||||||||||||||| || || |||| ||||||||||| Sbjct: 5209 aagaagagctttccaaatagtggaccccgagattggtaacc 5169
>emb|CR597867.1| full-length cDNA clone CS0DI006YF07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1430 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 443 gaggaggaagaagagggaggcgaggagga 471
>gb|AD001530.1|HUMXAP5 Homo sapiens XAP-5 mRNA, complete cds Length = 1311 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 448 gaggaggaagaagagggaggcgaggagga 476
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 182 gcaataatttagataaaaatc 202 ||||||||||||||||||||| Sbjct: 8556250 gcaataatttagataaaaatc 8556270
>dbj|D83389.2| Homo sapiens HXC-26 gene, complete cds Length = 4733 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 1883 gaggaggaagaagagggaggcgaggagga 1911
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 554 gcctgccaccatgcccaccag 574 ||||||||||||||||||||| Sbjct: 47800 gcctgccaccatgcccaccag 47820
>gb|DQ014510.1| Eucalyptus grandis cellulose synthase 6 (CesA6) mRNA, complete cds Length = 3782 Score = 42.1 bits (21), Expect = 2.1 Identities = 42/49 (85%) Strand = Plus / Minus Query: 365 acccagaggagggagaagatggaggcgaggaggatcgaccaaacgatga 413 ||||| || |||||||||||||| ||||| | ||| ||||| ||||||| Sbjct: 3271 acccacagaagggagaagatggaagcgagcaagattgaccacacgatga 3223
>dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042D15, full insert sequence Length = 4208 Score = 42.1 bits (21), Expect = 2.1 Identities = 60/73 (82%) Strand = Plus / Minus Query: 452 ttgaggaaggggtagagatggaggatcacccagattgagaagaagagctttccaaagagc 511 |||||||| |||| ||||||| ||||||||| | || ||||||||||| || ||||| Sbjct: 3462 ttgaggaattggtaaagatggacgatcacccaaaatgcaaagaagagcttcccgaagagg 3403 Query: 512 gggccccaggatt 524 || ||||| |||| Sbjct: 3402 ggtccccatgatt 3390
>gb|L44140.1|HUMFLNG6PD Homo sapiens chromosome X region from filamin (FLN) gene to glucose-6-phosphate dehydrogenase (G6PD) gene, complete cds's Length = 219447 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 116920 gaggaggaagaagagggaggcgaggagga 116948
>emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065B15, complete sequence Length = 150007 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 182 gcaataatttagataaaaatc 202 ||||||||||||||||||||| Sbjct: 16693 gcaataatttagataaaaatc 16713
>dbj|D83260.1| Human HXC-26 mRNA, complete cds Length = 1216 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 370 gaggagggagaagatggaggcgaggagga 398 ||||||| |||||| |||||||||||||| Sbjct: 353 gaggaggaagaagagggaggcgaggagga 381
>emb|AL670680.6| Mouse DNA sequence from clone RP23-314D24 on chromosome 4, complete sequence Length = 150897 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacca 573 ||||||||||||||||||||| Sbjct: 50371 tgcctgccaccatgcccacca 50351
>ref|NM_121748.2| Arabidopsis thaliana IRX3 (IRREGULAR XYLEM 3); cellulose synthase AT5G17420 (IRX3) mRNA, complete cds Length = 3693 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 2984 cccatcagacctttgaggaatgggtagagatg 2953
>ref|NM_121747.2| Arabidopsis thaliana unknown protein AT5G17410 transcript variant AT5G17410.1 mRNA, complete cds Length = 3027 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 2664 cccatcagacctttgaggaatgggtagagatg 2695
>ref|NM_180507.1| Arabidopsis thaliana unknown protein AT5G17410 transcript variant AT5G17410.2 mRNA, complete cds Length = 3030 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 2667 cccatcagacctttgaggaatgggtagagatg 2698
>ref|NM_119393.2| Arabidopsis thaliana CESA1 (CELLULASE SYNTHASE 1); transferase, transferring glycosyl groups AT4G32410 (CESA1) mRNA, complete cds Length = 3912 Score = 40.1 bits (20), Expect = 8.3 Identities = 119/152 (78%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 3441 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 3382 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 3381 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 3322 Query: 497 agctttccaaagagcgggccccaggattggta 528 ||||| || || ||||| ||||| || ||||| Sbjct: 3321 agcttcccgaaaagcggaccccacgactggta 3290
>ref|NM_123746.2| Arabidopsis thaliana unknown protein AT5G43790 mRNA, complete cds Length = 1475 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 199 aatccttccgtcttcatctacaac 222 ||||||||||||||| |||||||| Sbjct: 202 aatccttccgtcttcctctacaac 225
>ref|NM_197900.1| Oryza sativa (japonica cultivar-group) putative cellulose synthase (OSJNBa0035H01.10), mRNA Length = 3384 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 |||||||| |||||| ||||||||||||||| Sbjct: 3245 cccatgaggcccttggcgaaggggtagagatg 3214
>gb|BT017973.1| Zea mays clone EL01N0524D09.c mRNA sequence Length = 1387 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 407 acgatgacgatggtcggcgtgcgg 430 |||| ||||||||||||||||||| Sbjct: 996 acgaagacgatggtcggcgtgcgg 973
>gb|AC186368.1| Pan troglodytes chromosome 7 clone CH251-329G12, complete sequence Length = 146205 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 7398 tgcctgccaccatgcccacc 7379
>gb|AC132332.2| Mus musculus BAC clone RP24-222H7 from chromosome 10, complete sequence Length = 155268 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 369 agaggagggagaagatggag 388 |||||||||||||||||||| Sbjct: 88976 agaggagggagaagatggag 88957
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold Length = 1996640 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 gcaataatttagataaaaat 201 |||||||||||||||||||| Sbjct: 836324 gcaataatttagataaaaat 836305
>ref|XM_535932.2| PREDICTED: Canis familiaris similar to solute carrier family 4, sodium bicarbonate transporter-like, member 10 (LOC478766), mRNA Length = 4639 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 424 cgtgcggttctgcttccccatgag 447 |||| ||||||||||||||||||| Sbjct: 2215 cgtggggttctgcttccccatgag 2192
>gb|AC112676.8| Mus musculus chromosome 9, clone RP23-174F7, complete sequence Length = 230293 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 551 tatgcctgccaccatgccca 570 |||||||||||||||||||| Sbjct: 115879 tatgcctgccaccatgccca 115860
>gb|AC122388.5| Mus musculus BAC clone RP24-80J12 from chromosome 16, complete sequence Length = 214268 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 aatttagataaaaatccttc 206 |||||||||||||||||||| Sbjct: 145940 aatttagataaaaatccttc 145959
>gb|AC107214.5| Homo sapiens BAC clone RP11-367N14 from 4, complete sequence Length = 183317 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 8731 tgcctgccaccatgcccacc 8750
>gb|AC098883.3| Mus musculus BAC clone RP23-122F3 from 16, complete sequence Length = 211348 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 aatttagataaaaatccttc 206 |||||||||||||||||||| Sbjct: 182268 aatttagataaaaatccttc 182249
>gb|AC110302.4| Mus musculus BAC clone RP24-194G21 from 12, complete sequence Length = 168601 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 369 agaggagggagaagatggag 388 |||||||||||||||||||| Sbjct: 146375 agaggagggagaagatggag 146394
>gb|AC073136.6| Homo sapiens BAC clone RP11-700P18 from 7, complete sequence Length = 80796 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 33430 tgcctgccaccatgcccacc 33449
>emb|AL645758.9| Human DNA sequence from clone RP4-739J5 on chromosome 1, complete sequence Length = 40662 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 1747 tgcctgccaccatgcccacc 1766
>emb|AL592294.15| Human DNA sequence from clone RP3-475G16 on chromosome 1 Contains the 5' end of one variant of the ZSWIM5 gene for zinc finger SWIM domain containing 5 and four CpG islands, complete sequence Length = 177710 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 177457 tgcctgccaccatgcccacc 177476
>emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on chromosome 10 Contains the gene for a novel protein similar to ARF GTPase-activating protein (MRIP2), a ribosomal protein L35a (RPL35A) pseudogene and a CpG island, complete sequence Length = 86155 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 56663 tgcctgccaccatgcccacc 56682
>emb|AL357149.13| Human DNA sequence from clone RP11-352E13 on chromosome 6 Contains the 3' end of the UTRN gene for utrophin (homologous to dystrophin), complete sequence Length = 201399 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 453 tgaggaaggggtagagatggagga 476 ||||| |||||||||||||||||| Sbjct: 141738 tgaggtaggggtagagatggagga 141761
>emb|AL158062.22| Human DNA sequence from clone RP11-144H23 on chromosome 13 Contains the 5' end of the gene for a novel protein similar to ubiquitin specific protease 12 (LOC219333), a novel gene, the 5' end of a novel gene and a CpG island, complete sequence Length = 105880 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 52380 tgcctgccaccatgcccacc 52361
>emb|AL139398.20| Human DNA sequence from clone RP11-528B10 on chromosome Xp11.21-11.23, complete sequence Length = 125999 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 19358 tgcctgccaccatgcccacc 19339
>emb|AL157814.14| Human DNA sequence from clone RP11-285E18 on chromosome 13q22.1-22.3 Contains a novel gene, complete sequence Length = 111350 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 taaatacaattctgacatga 56 |||||||||||||||||||| Sbjct: 28757 taaatacaattctgacatga 28776
>emb|AL136123.19| Human DNA sequence from clone RP11-236M15 on chromosome 13 Contains a meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene, the C13orf1 gene for chromosome 13 open reading frame 1 and a CpG island, complete sequence Length = 178151 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 175713 tgcctgccaccatgcccacc 175694
>emb|AL132773.14|HSDJ741H3 Human DNA sequence from clone RP4-741H3 on chromosome 20 Contains the 3' end of the ATRN gene for attractin (with dipeptidylpeptidase IV activity) (KIAA0548), ESTs, STSs and GSSs, complete sequence Length = 104907 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 1146 tgcctgccaccatgcccacc 1127
>gb|AC027037.6| Oryza sativa chromosome 10 BAC OSJNBa0035H01 genomic sequence, complete sequence Length = 64582 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 |||||||| |||||| ||||||||||||||| Sbjct: 61123 cccatgaggcccttggcgaaggggtagagatg 61092
>gb|BC094061.1| Mus musculus basic helix-loop-helix domain containing, class B, 8, mRNA (cDNA clone MGC:102506 IMAGE:4165423), complete cds Length = 3487 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatc 400 ||||||||||||| |||||||||| Sbjct: 889 gagaagatggaggtgaggaggatc 866
>emb|AL391142.1|ATT10B6 Arabidopsis thaliana DNA chromosome 5, BAC clone T10B6 (ESSA project) Length = 33563 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Plus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 20805 cccatcagacctttgaggaatgggtagagatg 20836
>emb|AL161581.2|ATCHRIV77 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 77 Length = 197252 Score = 40.1 bits (20), Expect = 8.3 Identities = 119/152 (78%) Strand = Plus / Plus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 55100 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 55159 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 55160 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 55219 Query: 497 agctttccaaagagcgggccccaggattggta 528 ||||| || || ||||| ||||| || ||||| Sbjct: 55220 agcttcccgaaaagcggaccccacgactggta 55251
>emb|AL034567.1|ATF8B4 Arabidopsis thaliana DNA chromosome 4, BAC clone F8B4 (ESSA project) Length = 93257 Score = 40.1 bits (20), Expect = 8.3 Identities = 119/152 (78%) Strand = Plus / Plus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 41383 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 41442 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 41443 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 41502 Query: 497 agctttccaaagagcgggccccaggattggta 528 ||||| || || ||||| ||||| || ||||| Sbjct: 41503 agcttcccgaaaagcggaccccacgactggta 41534
>gb|BC011486.1| Mus musculus basic helix-loop-helix domain containing, class B, 8, mRNA (cDNA clone MGC:19046 IMAGE:4189225), complete cds Length = 3472 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatc 400 ||||||||||||| |||||||||| Sbjct: 863 gagaagatggaggtgaggaggatc 840
>gb|BT008654.1| Arabidopsis thaliana clone RAFL09-89-G08 (R19778) putative cellulose synthase catalytic subunit (RSW1) (At4g32410) mRNA, complete cds Length = 3763 Score = 40.1 bits (20), Expect = 8.3 Identities = 119/152 (78%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 3308 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 3249 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 3248 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 3189 Query: 497 agctttccaaagagcgggccccaggattggta 528 ||||| || || ||||| ||||| || ||||| Sbjct: 3188 agcttcccgaaaagcggaccccacgactggta 3157
>emb|AL592065.7| Mouse DNA sequence from clone RP23-50E4 on chromosome 11 Contains the 3' end of a novel gene, two novel genes, the 5' end of the Brip1 gene for BRCA1 interacting protein C-terminal helicase 1 and a mitochondrial F0 complex H+ transporting ATP synthase subunit g (Atp5l) pseudogene, complete sequence Length = 200624 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 551 tatgcctgccaccatgccca 570 |||||||||||||||||||| Sbjct: 180607 tatgcctgccaccatgccca 180626
>gb|AY139754.1| Arabidopsis thaliana AT5g17420/T10B6_80 mRNA, complete cds Length = 3355 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 2984 cccatcagacctttgaggaatgggtagagatg 2953
>gb|AC154393.8| Mus musculus chromosome 1, clone RP23-64O1, complete sequence Length = 253733 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 cacaatgtacactgcaggtt 137 |||||||||||||||||||| Sbjct: 24735 cacaatgtacactgcaggtt 24716
>gb|AC087518.5| Homo sapiens chromosome , clone RP11-359E19, complete sequence Length = 168531 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 20800 tgcctgccaccatgcccacc 20819
>gb|AC148939.8| Pan troglodytes BAC clone CH251-51M11 from chromosome 7, complete sequence Length = 183313 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 12412 tgcctgccaccatgcccacc 12431
>gb|AY124001.1| Arabidopsis thaliana AT5g43790/MQD19_14 mRNA sequence Length = 1379 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 199 aatccttccgtcttcatctacaac 222 ||||||||||||||| |||||||| Sbjct: 106 aatccttccgtcttcctctacaac 129
>gb|AC113933.2| Homo sapiens chromosome 3 clone RP11-1006P7, complete sequence Length = 173769 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 45602 tgcctgccaccatgcccacc 45583
>ref|NM_010800.3| Mus musculus basic helix-loop-helix domain containing, class B, 8 (Bhlhb8), mRNA Length = 3520 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatc 400 ||||||||||||| |||||||||| Sbjct: 913 gagaagatggaggtgaggaggatc 890
>gb|AC182463.3| Pan troglodytes BAC clone CH251-511B8 from chromosome 16, complete sequence Length = 194406 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 174719 tgcctgccaccatgcccacc 174738
>gb|AC182736.3| Pan troglodytes BAC clone CH251-15A9 from chromosome 7, complete sequence Length = 181648 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 35185 tgcctgccaccatgcccacc 35204
>gb|AC108056.3| Homo sapiens BAC clone RP11-366I1 from 4, complete sequence Length = 174916 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 143 gacagtggttctcagcggca 162 |||||||||||||||||||| Sbjct: 118421 gacagtggttctcagcggca 118440
>gb|AC097520.2| Homo sapiens BAC clone RP11-562F9 from 4, complete sequence Length = 173479 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 36 ataaatacaattctgacatgatat 59 |||||||||||| ||||||||||| Sbjct: 81415 ataaatacaattatgacatgatat 81392
>gb|AC080089.5| Homo sapiens BAC clone RP11-785J10 from 4, complete sequence Length = 174023 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 368 cagaggagggagaagatgga 387 |||||||||||||||||||| Sbjct: 68142 cagaggagggagaagatgga 68123
>gb|AC093155.2| Homo sapiens chromosome 1 clone RP11-384B12, complete sequence Length = 189760 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 62033 tgcctgccaccatgcccacc 62014
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 278 gagcgccgatgatccgatcagcag 301 |||||| ||||||||||||||||| Sbjct: 2092163 gagcgcagatgatccgatcagcag 2092186
>gb|AF440619.1|AF440619 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus section 1 of 2 Length = 350000 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 20977 tgcctgccaccatgcccacc 20958
>gb|AC025175.4| Homo sapiens chromosome 5 clone CTD-2081C10, complete sequence Length = 166907 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 7365 tgcctgccaccatgcccacc 7346
>gb|AC024571.5| Homo sapiens chromosome 5 clone CTD-2220M16, complete sequence Length = 109134 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 553 tgcctgccaccatgcccacc 572 |||||||||||||||||||| Sbjct: 85702 tgcctgccaccatgcccacc 85683
>dbj|AK220815.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit, partial cds, clone: RAFL22-31-O12 Length = 930 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 ||||| ||||| |||||||| ||||||||||| Sbjct: 614 cccatcagacctttgaggaatgggtagagatg 583
>dbj|AK222115.1| Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit, complete cds, clone: RAFL22-92-A12 Length = 1456 Score = 40.1 bits (20), Expect = 8.3 Identities = 119/152 (78%) Strand = Plus / Minus Query: 377 gagaagatggaggcgaggaggatcgaccaaacgatgacgatggtcggcgtgcggttctgc 436 ||||||||||||||||| || | ||||| || ||||||||||| || || ||||| || Sbjct: 1037 gagaagatggaggcgagaagaacagaccagacaatgacgatggttggtgttcggttttgt 978 Query: 437 ttccccatgagacccttgaggaaggggtagagatggaggatcacccagattgagaagaag 496 | |||| ||||| || | ||| |||||||||||| || ||||| | | ||||||| Sbjct: 977 cttcccaacagacctttcaagaaagggtagagatgggcaataacccataaggcgaagaag 918 Query: 497 agctttccaaagagcgggccccaggattggta 528 ||||| || || ||||| ||||| || ||||| Sbjct: 917 agcttcccgaaaagcggaccccacgactggta 886
>gb|AC018727.10| Oryza sativa chromosome 10 BAC OSJNBa0056G17 genomic sequence, complete sequence Length = 139999 Score = 40.1 bits (20), Expect = 8.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 440 cccatgagacccttgaggaaggggtagagatg 471 |||||||| |||||| ||||||||||||||| Sbjct: 74 cccatgaggcccttggcgaaggggtagagatg 43
>gb|AC009654.8| Homo sapiens chromosome 15, clone RP11-82L7, complete sequence Length = 192296 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 tcacccagattgagaagaag 496 |||||||||||||||||||| Sbjct: 166789 tcacccagattgagaagaag 166808
>gb|AC159296.2| Mus musculus BAC clone RP23-278O17 from chromosome 12, complete sequence Length = 194140 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 369 agaggagggagaagatggag 388 |||||||||||||||||||| Sbjct: 35932 agaggagggagaagatggag 35951 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,321,429 Number of Sequences: 3902068 Number of extensions: 5321429 Number of successful extensions: 191914 Number of sequences better than 10.0: 290 Number of HSP's better than 10.0 without gapping: 291 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 190788 Number of HSP's gapped (non-prelim): 1060 length of query: 611 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 588 effective length of database: 17,143,297,704 effective search space: 10080259049952 effective search space used: 10080259049952 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)