ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags37k13 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 1045 bits (527), Expect = 0.0 Identities = 553/566 (97%) Strand = Plus / Minus Query: 1 cagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1252 cagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaac 1193 Query: 61 aaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcactc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1192 aaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcactc 1133 Query: 121 nnnnnnnnnnnnatatcccacatgaagataatattgtgcatttattcatatatatgtatg 180 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1132 ctctctctctctatatcccacatgaagataatattgtgcatttattcatatatatgtatg 1073 Query: 181 tatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1072 tatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttga 1013 Query: 241 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1012 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 953 Query: 301 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 952 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 893 Query: 361 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 892 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 833 Query: 421 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 832 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 773 Query: 481 caaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggc 540 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 772 caaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggc 713 Query: 541 ggccaccatggcgaccagcacgagct 566 |||||||||||||||||||||||||| Sbjct: 712 ggccaccatggcgaccagcacgagct 687
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 1045 bits (527), Expect = 0.0 Identities = 553/566 (97%) Strand = Plus / Minus Query: 1 cagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2648 cagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaac 2589 Query: 61 aaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcactc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2588 aaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacatacgcactc 2529 Query: 121 nnnnnnnnnnnnatatcccacatgaagataatattgtgcatttattcatatatatgtatg 180 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2528 ctctctctctctatatcccacatgaagataatattgtgcatttattcatatatatgtatg 2469 Query: 181 tatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2468 tatgtgtgacctcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttga 2409 Query: 241 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2408 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 2349 Query: 301 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2348 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 2289 Query: 361 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2288 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 2229 Query: 421 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2228 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 2169 Query: 481 caaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggc 540 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 2168 caaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgatgagcatggc 2109 Query: 541 ggccaccatggcgaccagcacgagct 566 |||||||||||||||||||||||||| Sbjct: 2108 ggccaccatggcgaccagcacgagct 2083
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 722 bits (364), Expect = 0.0 Identities = 418/435 (96%), Gaps = 1/435 (0%) Strand = Plus / Minus Query: 133 atatcccacatgaagataatatt-gtgcatttattcatatatatgtatgtatgtgtgacc 191 |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| Sbjct: 516 atatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgtgacc 457 Query: 192 tcaacgtactcagcgtcgatcgctggggctataggcagcaagtggttgatcagcgaatct 251 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 456 tcaacgtactcagcgtcgattgctggggctataggcagcaagtggttgatcagcgaatct 397 Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 396 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 337 Query: 312 ttccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcacgccg 371 | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 336 tgccggcggccttgccagcgtttagcccaccagcagcgctcttgatgcacttgcacgccg 277 Query: 372 cttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcagcagg 431 |||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||| Sbjct: 276 cttgtttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcagcagg 217 Query: 432 ccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagagc 491 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 216 ccgcaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggcagagc 157 Query: 492 tcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggcggccaccatgg 551 ||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||| || Sbjct: 156 tcacctgaccgcaggagatggccgcgtcggcggctacgaggagcatggcggccaccaggg 97 Query: 552 cgaccagcacgagct 566 ||||||||||||||| Sbjct: 96 cgaccagcacgagct 82 Score = 176 bits (89), Expect = 5e-41 Identities = 107/113 (94%) Strand = Plus / Minus Query: 1 cagtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaac 60 ||||||||||| |||||| |||||||||||| | |||||||||||||||||||||||||| Sbjct: 666 cagtgcacatggtacaaaatacaataaactcttgggtcccctcaaagggagtgaaggaac 607 Query: 61 aaccaaacatcgatagtacagtatggccggccatgcagaactggctcaacata 113 |||||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 606 aaccaaacatggatagaacagtatggccggccatgcagaactggctcaacata 554
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 605 bits (305), Expect = e-170 Identities = 331/340 (97%) Strand = Plus / Minus Query: 227 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 286 ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 1391 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 1332 Query: 287 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 346 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1331 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 1272 Query: 347 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1271 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 1212 Query: 407 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 466 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1211 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 1152 Query: 467 gagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagct 526 |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 1151 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 1092 Query: 527 acgatgagcatggcggccaccatggcgaccagcacgagct 566 |||| |||||| |||||||||||||||||||||||||||| Sbjct: 1091 acgaggagcatagcggccaccatggcgaccagcacgagct 1052 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 2 agtgcacatgttacaaagtacaataaactca 32 |||||||||| |||||||||||| ||||||| Sbjct: 1649 agtgcacatggtacaaagtacaacaaactca 1619 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 86 gccggccatgcagaactggctcaacatacg 115 |||||||||||||| |||||||||| |||| Sbjct: 1566 gccggccatgcagagctggctcaacgtacg 1537 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 158 gcatttattcatatatatgtatgtatgtgt 187 |||||||||||||||||||| ||| ||||| Sbjct: 1489 gcatttattcatatatatgtgtgtgtgtgt 1460
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 502 bits (253), Expect = e-139 Identities = 318/340 (93%) Strand = Plus / Minus Query: 227 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 286 ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 376 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 317 Query: 287 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 346 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 316 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgca 257 Query: 347 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 406 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 256 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggcc 197 Query: 407 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 466 | ||||||||| ||||||||||||||| |||| | || |||||||||||| ||||||| Sbjct: 196 aatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcatag 137 Query: 467 gagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagct 526 || |||||||||| |||||||||||||||||||||||| |||||||| ||||||| ||| Sbjct: 136 gaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggct 77 Query: 527 acgatgagcatggcggccaccatggcgaccagcacgagct 566 |||| |||||| |||||||||||||||||||||||||||| Sbjct: 76 acgaggagcatagcggccaccatggcgaccagcacgagct 37 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 2 agtgcacatgttacaaagtacaataaactca 32 |||||||||| |||||||||||| ||||||| Sbjct: 647 agtgcacatggtacaaagtacaacaaactca 617 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 158 gcatttattcatatatatgtatgtatgtgtg 188 |||||||||||||||||||| ||| |||||| Sbjct: 487 gcatttattcatatatatgtgtgtgtgtgtg 457 Score = 44.1 bits (22), Expect = 0.49 Identities = 31/34 (91%) Strand = Plus / Minus Query: 200 ctcagcgtcgatcgctggggctataggcagcaag 233 |||||| ||||| ||||| ||||||||||||||| Sbjct: 415 ctcagcatcgatagctggagctataggcagcaag 382 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 acctcaacgtactcagcgtc 208 |||||||||||||||||||| Sbjct: 434 acctcaacgtactcagcgtc 415
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 442 bits (223), Expect = e-121 Identities = 312/342 (91%) Strand = Plus / Minus Query: 225 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 284 ||||||||||||| |||||| |||||||||||||||| ||||||| ||||||| ||||| Sbjct: 449 ggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtagg 390 Query: 285 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 344 ||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | | Sbjct: 389 ggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcgg 330 Query: 345 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 404 ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| Sbjct: 329 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccgg 270 Query: 405 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 464 ||| ||||||||| ||||||||||||||| |||| | || |||||||||||| ||||| Sbjct: 269 ccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcat 210 Query: 465 aggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtag 524 |||| |||||||||| |||||||||||||||||||||||| |||||||| ||||||| | Sbjct: 209 aggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcgg 150 Query: 525 ctacgatgagcatggcggccaccatggcgaccagcacgagct 566 |||||| |||||| |||||||||||||||||||||||||||| Sbjct: 149 ctacgaggagcatagcggccaccatggcgaccagcacgagct 108 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 159 catttattcatatatatgtatgtatgtgtg 188 ||||||||||||||||||| ||| |||||| Sbjct: 555 catttattcatatatatgtgtgtgtgtgtg 526 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 acctcaacgtactcagcgtc 208 |||||||||||||||||||| Sbjct: 505 acctcaacgtactcagcgtc 486
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 371 bits (187), Expect = 2e-99 Identities = 210/218 (96%) Strand = Plus / Minus Query: 349 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 408 |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226 Query: 409 tctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 468 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166 Query: 469 gatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctac 528 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106 Query: 529 gatgagcatggcggccaccatggcgaccagcacgagct 566 || |||||| |||||||||||||||||||||||||||| Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgagct 68
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 349 bits (176), Expect = 6e-93 Identities = 286/323 (88%) Strand = Plus / Minus Query: 241 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 300 ||||||||||||||||||||| || |||| |||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 301 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 360 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 361 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 420 ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | || || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 421 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 480 ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 481 caaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggc 540 |||||||||||||||||||||||| || | |||||| || || ||| ||| |||||| || Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49 Query: 541 ggccaccatggcgaccagcacga 563 |||||||| |||||| ||||||| Sbjct: 48 ggccaccacggcgacgagcacga 26
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 349 bits (176), Expect = 6e-93 Identities = 286/323 (88%) Strand = Plus / Minus Query: 241 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 300 ||||||||||||||||||||| || |||| |||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 301 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 360 | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 361 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 420 ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | || || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 421 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 480 ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 481 caaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggc 540 |||||||||||||||||||||||| || | |||||| || || ||| ||| |||||| || Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49 Query: 541 ggccaccatggcgaccagcacga 563 |||||||| |||||| ||||||| Sbjct: 48 ggccaccacggcgacgagcacga 26
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 349 bits (176), Expect = 6e-93 Identities = 298/339 (87%) Strand = Plus / Minus Query: 225 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 284 ||||||||||| | ||||||||||||||||||||||| || |||| ||||||||||||| Sbjct: 1633 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 1574 Query: 285 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 344 ||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | | Sbjct: 1573 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 1514 Query: 345 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 404 ||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || Sbjct: 1513 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 1454 Query: 405 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 464 | || ||| | || ||||||||||||||| ||| || |||||||||||||||| |||| Sbjct: 1453 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1394 Query: 465 aggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtag 524 |||||||||||||||||||||||||||||||||||||||| || | ||||| || || Sbjct: 1393 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 1334 Query: 525 ctacgatgagcatggcggccaccatggcgaccagcacga 563 || ||| |||||| |||||||||| |||||| ||||||| Sbjct: 1333 ctgcgaggagcatagcggccaccacggcgacgagcacga 1295 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 47 gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 99 ||||||| ||||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 1838 gggagtggaggaacaaccaaacatcgatacaacagtgtggccggccatgcaga 1786 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 185 tgtgacctcaacgtactcagcgtcgatc 212 ||||||||||||||||| ||||| |||| Sbjct: 1702 tgtgacctcaacgtactaagcgtagatc 1675
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 333 bits (168), Expect = 4e-88 Identities = 296/339 (87%) Strand = Plus / Minus Query: 225 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 284 ||||||| ||| | ||||||||||||||||||||||| || |||| ||||||||||||| Sbjct: 430 ggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtagg 371 Query: 285 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 344 ||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | | Sbjct: 370 ggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 311 Query: 345 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 404 ||||||||||||| ||||||||||||||||||||||||||||||||| |||||| || || Sbjct: 310 cagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 251 Query: 405 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 464 | || ||| | || ||||||||||||||| ||| ||| |||||||||||||||| |||| Sbjct: 250 ctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtgcat 191 Query: 465 aggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtag 524 |||||||||||||||||||||||||||||||||||||||| || | ||||| || || Sbjct: 190 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccgtga 131 Query: 525 ctacgatgagcatggcggccaccatggcgaccagcacga 563 || ||| |||||| |||||||||| |||||| ||||||| Sbjct: 130 ctgcgaggagcatagcggccaccacggcgacgagcacga 92 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 47 gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 99 ||||||| | ||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 638 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 586 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 183 tgtgtgacctcaacgtactcagcgtcgatc 212 ||||||||||||||||||| ||||| |||| Sbjct: 501 tgtgtgacctcaacgtactaagcgtagatc 472
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 333 bits (168), Expect = 4e-88 Identities = 296/339 (87%) Strand = Plus / Minus Query: 225 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 284 ||||||||||| | |||||| |||||||||||||||| || |||| ||||||||||||| Sbjct: 1621 ggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgtagg 1562 Query: 285 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 344 ||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| | | Sbjct: 1561 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccagcag 1502 Query: 345 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 404 ||||||||||||||||||||||| ||||||||||||||||||||||| |||||| || || Sbjct: 1501 cagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagctgg 1442 Query: 405 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 464 | || ||| | || ||||||||||||||| ||| || |||||||||||||||| |||| Sbjct: 1441 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 1382 Query: 465 aggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtag 524 |||||||||||||||||||||||||||||||||||||||| || | |||||| || || Sbjct: 1381 aggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcctccgtga 1322 Query: 525 ctacgatgagcatggcggccaccatggcgaccagcacga 563 || ||| |||||| |||||||||| |||||| ||||||| Sbjct: 1321 ctgcgaggagcatagcggccaccacggcgacgagcacga 1283 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 47 gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 99 ||||||| ||||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 1826 gggagtggaggaacaaccaaacatcgatataacagtgtggccggccatgcaga 1774 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 183 tgtgtgacctcaacgtactcagcgtcgatc 212 ||||||||||||||||||| ||||| |||| Sbjct: 1692 tgtgtgacctcaacgtactaagcgtagatc 1663 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 158 gcatttattcatatatatgtatgtatgtg 186 |||||||||||||||||||| ||| |||| Sbjct: 1725 gcatttattcatatatatgtgtgtgtgtg 1697
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 325 bits (164), Expect = 9e-86 Identities = 251/280 (89%) Strand = Plus / Minus Query: 225 ggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagg 284 ||||||||||| | ||||||||||||||||||||||| || |||| ||||||||||| | Sbjct: 329 ggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaag 270 Query: 285 ggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccg 344 ||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| | | Sbjct: 269 ggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccagcag 210 Query: 345 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccgg 404 ||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || Sbjct: 209 cagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagctgg 150 Query: 405 ccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcat 464 | || ||| | || ||||||||||||||| ||| || |||||||||||||||| |||| Sbjct: 149 ctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcat 90 Query: 465 aggagatgcaggggctcaaggcagagctcacctgaccgca 504 |||||||||||||||||||||||||||||||||||||||| Sbjct: 89 aggagatgcaggggctcaaggcagagctcacctgaccgca 50 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 47 gggagtgaaggaacaaccaaacatcgatagtacagtatggccggccatgcaga 99 ||||||| | ||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 535 gggagtggaagaacaaccaaacatcgatacaacagtgtggccggccatgcaga 483 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 183 tgtgtgacctcaacgtactcagcgtcgatc 212 ||||||||||||||||||| ||||| |||| Sbjct: 396 tgtgtgacctcaacgtactaagcgtagatc 367
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 317 bits (160), Expect = 2e-83 Identities = 249/279 (89%) Strand = Plus / Minus Query: 241 tcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgca 300 ||||||||||||||||||||||||||| | || ||||||||||||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 301 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 360 | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 361 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacacc 420 ||||||||||||||||||||||||||||||| | |||||||||||||| ||| ||||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169 Query: 421 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggct 480 |||||||||||| |||| || ||| |||| ||||||| |||||||||||||||||||| Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109 Query: 481 caaggcagagctcacctgaccgcangagatggccgcgtc 519 |||||||||||||||||| || || ||||| || ||||| Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtc 70
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 208 bits (105), Expect = 1e-50 Identities = 272/328 (82%) Strand = Plus / Minus Query: 239 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 298 |||||| | |||||||||||||||||||| || ||||||| |||||||| |||||||||| Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147 Query: 299 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 358 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087 Query: 359 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 418 ||| |||| |||||||||||||| ||||||||| | ||| |||||||| |||| | || Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 3027 Query: 419 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 478 ||| ||||||||| ||||||| |||| ||| |||| || ||||||| ||||| | Sbjct: 3026 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 2967 Query: 479 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatg 538 || ||||||| ||||||||||||| ||||| |||||||||| ||||| | |||||| Sbjct: 2966 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 2907 Query: 539 gcggccaccatggcgaccagcacgagct 566 || ||||||| ||||||||||||||||| Sbjct: 2906 gccgccaccagggcgaccagcacgagct 2879 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgatcgctggggctata 224 |||||||| | ||| |||||||||||||||||||| || || |||||||| |||||| Sbjct: 3289 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 3233 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 41 ctcaaagggagtgaaggaacaaccaaac 68 ||||||||||||||| |||||| ||||| Sbjct: 3436 ctcaaagggagtgaacgaacaatcaaac 3409
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 208 bits (105), Expect = 1e-50 Identities = 272/328 (82%) Strand = Plus / Minus Query: 239 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 298 |||||| | |||||||||||||||||||| || ||||||| |||||||| |||||||||| Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351 Query: 299 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 358 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291 Query: 359 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 418 ||| |||| |||||||||||||| ||||||||| | ||| |||||||| |||| | || Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 231 Query: 419 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 478 ||| ||||||||| ||||||| |||| ||| |||| || ||||||| ||||| | Sbjct: 230 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 171 Query: 479 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatg 538 || ||||||| ||||||||||||| ||||| |||||||||| ||||| | |||||| Sbjct: 170 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcatt 111 Query: 539 gcggccaccatggcgaccagcacgagct 566 || ||||||| ||||||||||||||||| Sbjct: 110 gccgccaccagggcgaccagcacgagct 83 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtgacctcaacgtactcagcgtcgatcgctggggctata 224 |||||||| | ||| |||||||||||||||||||| || || |||||||| |||||| Sbjct: 493 atatatatatgtgtgtgtgtgacctcaacgtactcggcatctatcgctggagctata 437 Score = 46.1 bits (23), Expect = 0.12 Identities = 56/67 (83%) Strand = Plus / Minus Query: 2 agtgcacatgttacaaagtacaataaactcataggtcccctcaaagggagtgaaggaaca 61 |||||||||| |||||||||||| |||||| || ||||||||||||||| ||||| Sbjct: 679 agtgcacatggtacaaagtacaacaaactcccgtctctgctcaaagggagtgaacgaaca 620 Query: 62 accaaac 68 | ||||| Sbjct: 619 atcaaac 613
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 206 bits (104), Expect = 6e-50 Identities = 265/319 (83%) Strand = Plus / Minus Query: 248 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 307 |||||||||||||||||||| || ||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 308 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 367 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 368 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 427 |||||||||||||| ||||||||| | ||| |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 428 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 487 |||||| ||||||| |||| ||| |||| || ||||||| ||||| | || |||| Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102 Query: 488 gagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggcggccacc 547 ||| ||||||||||||| ||||| |||||||||| ||||| | |||||| || |||||| Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgccgccacc 42 Query: 548 atggcgaccagcacgagct 566 | ||||||||||||||||| Sbjct: 41 agggcgaccagcacgagct 23
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 190 bits (96), Expect = 3e-45 Identities = 263/319 (82%) Strand = Plus / Minus Query: 248 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 307 ||||||||||| |||||||| || ||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 308 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 367 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 368 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 427 |||||||||||||| ||||||||| | ||| |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 428 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 487 |||||| ||||||| |||| ||| |||| || ||||||| ||||| | || |||| Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102 Query: 488 gagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggcggccacc 547 ||| ||||||||||||| | ||| |||||||||| ||||| | |||||| || |||||| Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgccgccacc 42 Query: 548 atggcgaccagcacgagct 566 | ||||||||||||||||| Sbjct: 41 agggcgaccagcacgagct 23
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 184 bits (93), Expect = 2e-43 Identities = 269/328 (82%) Strand = Plus / Minus Query: 239 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 298 |||||| | |||||||||||||||||||| || ||||| | ||||||||||||||||||| Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370 Query: 299 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 358 ||| ||||||| || || ||||||||| | ||| ||||| || ||| | ||||||| | Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310 Query: 359 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 418 ||| |||| | ||||||||||| ||||||||| | ||| |||||||| | || |||| Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250 Query: 419 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 478 ||||||||||||||| ||| ||| ||| ||| |||| ||||||| || ||||||| Sbjct: 249 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 190 Query: 479 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatg 538 ||||||||||||||||||| ||||| |||||||||||||| ||| ||| || ||| Sbjct: 189 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 130 Query: 539 gcggccaccatggcgaccagcacgagct 566 || ||||||| ||||||||||||||||| Sbjct: 129 gccgccaccagggcgaccagcacgagct 102 Score = 54.0 bits (27), Expect = 5e-04 Identities = 56/66 (84%), Gaps = 6/66 (9%) Strand = Plus / Minus Query: 158 gcatttattcatatatatgtatgtatgtgt------gacctcaacgtactcagcgtcgat 211 |||||||||||| ||||||||| ||||||| |||||||||||||||||| || || Sbjct: 528 gcatttattcatgtatatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaat 469 Query: 212 cgctgg 217 |||||| Sbjct: 468 cgctgg 463 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 41 ctcaaagggagtgaaggaacaaccaaac 68 ||||||||||||||| |||||| ||||| Sbjct: 645 ctcaaagggagtgaacgaacaatcaaac 618
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 184 bits (93), Expect = 2e-43 Identities = 269/328 (82%) Strand = Plus / Minus Query: 239 gatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccg 298 |||||| | |||||||||||||||||||| || ||||| | ||||||||||||||||||| Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311 Query: 299 cacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatg 358 ||| ||||||| || || ||||||||| | ||| ||||| || ||| | ||||||| | Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251 Query: 359 cacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgaca 418 ||| |||| | ||||||||||| ||||||||| | ||| |||||||| | || |||| Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191 Query: 419 ccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcagggg 478 ||||||||||||||| ||| ||| ||| ||| |||| ||||||| || ||||||| Sbjct: 190 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 131 Query: 479 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatg 538 ||||||||||||||||||| ||||| |||||||||||||| ||| ||| || ||| Sbjct: 130 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcatt 71 Query: 539 gcggccaccatggcgaccagcacgagct 566 || ||||||| ||||||||||||||||| Sbjct: 70 gccgccaccagggcgaccagcacgagct 43 Score = 54.0 bits (27), Expect = 5e-04 Identities = 56/66 (84%), Gaps = 6/66 (9%) Strand = Plus / Minus Query: 158 gcatttattcatatatatgtatgtatgtgt------gacctcaacgtactcagcgtcgat 211 |||||||||||| ||||||||| ||||||| |||||||||||||||||| || || Sbjct: 469 gcatttattcatgtatatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaat 410 Query: 212 cgctgg 217 |||||| Sbjct: 409 cgctgg 404
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 178 bits (90), Expect = 1e-41 Identities = 260/317 (82%) Strand = Plus / Minus Query: 248 atcttagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggag 307 |||||||||||||||||||| || ||||| | |||||||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 308 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 367 || || || ||||||||| | ||| ||||| || ||| | ||||||| |||| |||| Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222 Query: 368 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacaccgctgcag 427 | ||||||||||| ||||||||| | ||| |||||||| | || |||| ||||||||| Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162 Query: 428 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaggggctcaaggca 487 |||||| ||| ||| ||| ||| |||| ||||||| || ||||||| |||||||| Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102 Query: 488 gagctcacctgaccgcangagatggccgcgtcggtagctacgatgagcatggcggccacc 547 ||||||||||| ||||| |||||||||||||| ||| ||| || ||| || |||||| Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgccgccacc 42 Query: 548 atggcgaccagcacgag 564 | ||||||||||||||| Sbjct: 41 agggcgaccagcacgag 25
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 174 bits (88), Expect = 2e-40 Identities = 237/287 (82%) Strand = Plus / Minus Query: 280 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 339 ||||||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 340 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 399 ||| ||||| |||||||||||| ||||||||||| ||||||||||| |||| || Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190 Query: 400 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 459 |||||||| |||| |||| ||||||||||||||| ||| ||| |||||||||||||||| Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130 Query: 460 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtc 519 |||||||| | ||| |||| | ||| ||||||||||| ||||| ||||| |||||||| Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70 Query: 520 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagct 566 || ||||| | ||| | || ||||||| ||||||||||||||||| Sbjct: 69 ggaggctacaaggaggagtgccgccaccagggcgaccagcacgagct 23
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 151 bits (76), Expect = 3e-33 Identities = 234/287 (81%) Strand = Plus / Minus Query: 280 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 339 |||||||||||||||||||||| |||||||||| || |||||| |||| ||||| | | Sbjct: 311 gtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgc 252 Query: 340 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 399 || || | ||||||| |||| |||||| ||||||||||| ||||||||| | ||| Sbjct: 251 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 192 Query: 400 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 459 |||||||| ||||||||| ||||| |||||| || ||| || ||| |||| |||| Sbjct: 191 gccggccaatctcttgactccgctacagcagcccgcagaagggctggtgccgctgccttt 132 Query: 460 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtc 519 || |||| | |||||||| |||||||||||||||||| ||||| | |||||||||||| Sbjct: 131 tgcgtaggcggcgcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtc 72 Query: 520 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagct 566 || ||||||| |||||| || ||||||| |||||||||| |||||| Sbjct: 71 ggcggctacgaggagcattgccgccaccagggcgaccagcgcgagct 25 Score = 42.1 bits (21), Expect = 1.9 Identities = 52/62 (83%), Gaps = 4/62 (6%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatg----tgtgacctcaacgtactcagcgtcgatcgct 215 |||||||||| ||||||||| |||| |||||||||||| | | ||||||||||||| Sbjct: 447 atttattcatgtatatgtatatatgcgtatgtgacctcaacctgccaagcgtcgatcgct 388 Query: 216 gg 217 || Sbjct: 387 gg 386
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 135 bits (68), Expect = 2e-28 Identities = 232/287 (80%) Strand = Plus / Minus Query: 280 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 339 ||||||||||||||| |||||| |||||||||| || |||||| | || ||||| | | Sbjct: 382 gtaggggacgctgaccccgcacctggaggggatgcctgcggcccttccggcgttgtacgc 323 Query: 340 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 399 || || | ||||||| |||| |||||| ||||||||||| ||||||||| | ||| Sbjct: 322 gccggcgacactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaa 263 Query: 400 gccggccagtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcg 459 |||||||| ||||||||| ||||| |||||| || ||| || ||| |||| |||| Sbjct: 262 gccggccaatctcttgactccgctacagcagcccgcagaagggctggtgccgctgccttt 203 Query: 460 ggcataggagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtc 519 || |||| | |||||||| |||||||||||||||||| ||||| | |||||||||||| Sbjct: 202 tgcgtaggcggcgcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtc 143 Query: 520 ggtagctacgatgagcatggcggccaccatggcgaccagcacgagct 566 || ||||||| |||||| || ||||||| |||||||||| |||||| Sbjct: 142 ggcggctacgaggagcattgccgccaccagggcgaccagcgcgagct 96 Score = 42.1 bits (21), Expect = 1.9 Identities = 52/62 (83%), Gaps = 4/62 (6%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatg----tgtgacctcaacgtactcagcgtcgatcgct 215 |||||||||| ||||||||| |||| |||||||||||| | | ||||||||||||| Sbjct: 518 atttattcatgtatatgtatatatgcgtatgtgacctcaaccttccaagcgtcgatcgct 459 Query: 216 gg 217 || Sbjct: 458 gg 457
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 131 bits (66), Expect = 3e-27 Identities = 224/275 (81%), Gaps = 5/275 (1%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatgtgt----gacctcaacgtactcagcgtcgatcgct 215 |||||||||| ||||||||| ||||||| ||||||||| ||| ||||||||||||| Sbjct: 503 atttattcatgtatatgtatatatgtgtatgtgacctcaacctaccaagcgtcgatcgct 444 Query: 216 ggggctataggcagcaagtggttgatcagcgaatcttagagcagtccacggaagcactga 275 || | ||| || |||| ||| | |||||| | |||||||||||||| || || |||| Sbjct: 443 ggagatatggggagcacgtgttcgatcagtggatcttagagcagtcgacactggcgctga 384 Query: 276 tggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgttta 335 | | |||||||||||||||||||||| |||||||||| || |||||| |||| ||||| Sbjct: 383 tcgtgtaggggacgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgt 324 Query: 336 gcccacccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctggg 395 | | || ||| | ||||||| |||| |||||| ||||||||||| ||||||||| | | Sbjct: 323 acgcgccggca-cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcg 265 Query: 396 ctgcgccggccagtctcttgacaccgctgcagcag 430 || |||||||| ||||||||| ||||| |||||| Sbjct: 264 ctaagccggccaatctcttgactccgctacagcag 230 Score = 65.9 bits (33), Expect = 1e-07 Identities = 80/95 (84%), Gaps = 2/95 (2%) Strand = Plus / Minus Query: 472 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggtagctacgat 531 |||||||| |||||||||||||||||| ||||| | |||| |||||||| ||||||| Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgag 132 Query: 532 gagcatggcggccaccatggcgaccagcacgagct 566 |||||| || ||||||| || |||||| |||||| Sbjct: 131 gagcattgccgccaccaggggcaccagcgcgagct 97
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Plus Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| | |||||| ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080 Query: 312 ttccggcggccttgccagcgtttagccc 339 | | |||||| ||||| ||||| ||||| Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| | |||||| ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000 Query: 312 ttccggcggccttgccagcgtttagccc 339 | | |||||| ||||| ||||| ||||| Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 692746 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 692687 Query: 332 tt 333 || Sbjct: 692686 tt 692685 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 679451 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 2482379 atatatatgtatgtatgtgtg 2482399
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| | |||||| ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400 Query: 312 ttccggcggccttgccagcgtttagccc 339 | | |||||| ||||| ||||| ||||| Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| | |||||| ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399 Query: 312 ttccggcggccttgccagcgtttagccc 339 | | |||||| ||||| ||||| ||||| Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 252 tagagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggagggga 311 |||||||||| | |||||| ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179 Query: 312 ttccggcggccttgccagcgtttagccc 339 | | |||||| ||||| ||||| ||||| Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 692746 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 692687 Query: 332 tt 333 || Sbjct: 692686 tt 692685 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 679451 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 679404 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 2491453 atatatatgtatgtatgtgtg 2491473
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 732598 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 732539 Query: 332 tt 333 || Sbjct: 732538 tt 732537 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 722709 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 169 tatatatgtatgtatgtgtg 188 |||||||||||||||||||| Sbjct: 9389648 tatatatgtatgtatgtgtg 9389667
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 732598 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 732539 Query: 332 tt 333 || Sbjct: 732538 tt 732537 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 722709 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 722662 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 169 tatatatgtatgtatgtgtg 188 |||||||||||||||||||| Sbjct: 9389533 tatatatgtatgtatgtgtg 9389552
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| |||||||||| Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 46536 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 46595 Query: 332 tt 333 || Sbjct: 46596 tt 46597 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 56425 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 56472
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 265 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 324 |||||| ||||||| |||||||||||||||||||||| |||||||||| | |||||| || Sbjct: 427 ggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgtt 368 Query: 325 gccagcgtttagccc 339 ||| ||||| ||||| Sbjct: 367 gccggcgttgagccc 353
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Minus Query: 265 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 324 |||||| ||||||| |||||||||||||||||||||| |||||||||| | |||||| || Sbjct: 427 ggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgtt 368 Query: 325 gccagcgtttagccc 339 ||| ||||| ||||| Sbjct: 367 gccggcgttgagccc 353
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 83.8 bits (42), Expect = 6e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||||||||||||||||||| | |||||||| Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 50226 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 50285 Query: 332 tt 333 || Sbjct: 50286 tt 50287 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 63521 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 63568
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 265 ggaagcactgatggcgtaggggacgctgacgccgcacatggaggggattccggcggcctt 324 |||||| ||||||| |||||||||||||||||||||| | |||||||| | |||||| || Sbjct: 362 ggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatgctggcggcgtt 303 Query: 325 gccagcgtttagccc 339 ||| ||||| ||||| Sbjct: 302 gccggcgttgagccc 288
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 77.8 bits (39), Expect = 4e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 ||||||| ||| |||| ||||||| |||||||| ||||||||||||| |||||||||| Sbjct: 337 gagcagtacacagaagggctgatggtgtaggggatgctgacgccgcacttggaggggatg 278 Query: 314 ccggcggccttgccagcgtttag 336 | |||||| ||||| |||||||| Sbjct: 277 ctggcggcattgccggcgtttag 255
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 276 ctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcg 217 Query: 332 tt 333 || Sbjct: 216 tt 215 Score = 44.1 bits (22), Expect = 0.49 Identities = 27/29 (93%) Strand = Plus / Minus Query: 488 gagctcacctgaccgcangagatggccgc 516 ||||||||||| ||||| ||||||||||| Sbjct: 54 gagctcacctgcccgcaggagatggccgc 26
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||||||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 979 ctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcggcgttgccggcg 920 Query: 332 tt 333 || Sbjct: 919 tt 918 Score = 44.1 bits (22), Expect = 0.49 Identities = 27/29 (93%) Strand = Plus / Minus Query: 488 gagctcacctgaccgcangagatggccgc 516 ||||||||||| ||||| ||||||||||| Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 75.8 bits (38), Expect = 1e-10 Identities = 75/86 (87%), Gaps = 1/86 (1%) Strand = Plus / Minus Query: 254 gagcagtccacggaagcactgatggcgtaggggacgctgacgccgcacatggaggggatt 313 |||||||| | |||||| ||||||| |||||| ||||||||||||||| |||||||||| Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354 Query: 314 ccggcggccttgccagcgtttagccc 339 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgcc 327 ||||||| |||||||| ||||||||||||| |||||||||| | |||||||||||| Sbjct: 947 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggccttgcc 892
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 451 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 392 Query: 332 tt 333 || Sbjct: 391 tt 390
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 683 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 624 Query: 332 tt 333 || Sbjct: 623 tt 622
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 313 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 254 Query: 332 tt 333 || Sbjct: 253 tt 252
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 98 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 157 Query: 332 tt 333 || Sbjct: 158 tt 159
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 636 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 577 Query: 332 tt 333 || Sbjct: 576 tt 575
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 419 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 360 Query: 332 tt 333 || Sbjct: 359 tt 358
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 401 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggcg 342 Query: 332 tt 333 || Sbjct: 341 tt 340
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 405 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 346 Query: 332 tt 333 || Sbjct: 345 tt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 315 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 256 Query: 332 tt 333 || Sbjct: 255 tt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 307 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 248 Query: 332 tt 333 || Sbjct: 247 tt 246
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 307 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 248 Query: 332 tt 333 || Sbjct: 247 tt 246
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 416 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 357 Query: 332 tt 333 || Sbjct: 356 tt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 433 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 374 Query: 332 tt 333 || Sbjct: 373 tt 372
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 326 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 267 Query: 332 tt 333 || Sbjct: 266 tt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 241 Query: 332 tt 333 || Sbjct: 240 tt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 241 Query: 332 tt 333 || Sbjct: 240 tt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 396 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 337 Query: 332 tt 333 || Sbjct: 336 tt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 14437046 ctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcg 14436999 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 162 ttattcatatatatgtatgtatgt 185 |||| ||||||||||||||||||| Sbjct: 13185988 ttatacatatatatgtatgtatgt 13186011
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 45544 ctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcg 45497
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 416 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 367
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 60.0 bits (30), Expect = 8e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| ||||||| || | |||||| ||||| ||| Sbjct: 300 ctgatggtgtaggggatgctgacgccgcacttggagggtatgctggcggcgttgccggcg 241 Query: 332 tt 333 || Sbjct: 240 tt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 398 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 323 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 422 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 435 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 437 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 435 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 432 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 60.0 bits (30), Expect = 8e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 60.0 bits (30), Expect = 8e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||| ||| Sbjct: 397 ctgatggtgtaggggatgctgacgccgcacttggacgggatgctggcggcgttgccggcg 338 Query: 332 tt 333 || Sbjct: 337 tt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 246 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| |||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 433 ctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggc 384
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 412 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 3498 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 ||||| |||||||||| | ||||||||||| |||||||||| |||||| Sbjct: 414 ctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||| ||||| |||||||||| |||||| Sbjct: 416 ctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcg 369
>gb|AC131676.2| Mus musculus BAC clone RP23-330L3 from chromosome 6, complete sequence Length = 200673 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtg 188 |||||||||||||||||||||||||| Sbjct: 131928 tattcatatatatgtatgtatgtgtg 131903
>emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chromosome 13, complete sequence Length = 183907 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatgtg 186 |||||||||||||||||||||||||| Sbjct: 118142 tttattcatatatatgtatgtatgtg 118117 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 84210 atatatatgtatgtatgtgtg 84230
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcg 331 ||||||| |||||||| ||||||||||| |||||||||| | |||||| ||||| ||| Sbjct: 396 ctgatggtgtaggggatcgtgacgccgcacttggaggggatgctggcggcattgccggcg 337 Query: 332 tt 333 || Sbjct: 336 tt 335
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggc 321 ||||||| ||||||| ||||||||||||| |||||||||| | |||||| Sbjct: 301 ctgatggtataggggatgctgacgccgcacttggaggggatgctggcggc 252
>gb|AC131678.4| Mus musculus BAC clone RP23-333L1 from chromosome 3, complete sequence Length = 203750 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatgtgtg 188 |||||||||||| |||||||||||||||| Sbjct: 29729 atttattcatatgtatgtatgtatgtgtg 29701 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 159 catttattcatatatatgtatgtatgtgtg 188 |||| |||||||||||||||||| |||||| Sbjct: 123704 cattcattcatatatatgtatgtgtgtgtg 123733
>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence Length = 149431 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 155 tgtgcatttattcatatatatgtatgtat 183 ||||||| ||||||||||||||||||||| Sbjct: 78712 tgtgcatgtattcatatatatgtatgtat 78740
>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence Length = 178648 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 155 tgtgcatttattcatatatatgtatgtat 183 ||||||| ||||||||||||||||||||| Sbjct: 105788 tgtgcatgtattcatatatatgtatgtat 105760
>gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, complete sequence Length = 153477 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 155 tgtgcatttattcatatatatgtatgtat 183 ||||||| ||||||||||||||||||||| Sbjct: 75748 tgtgcatgtattcatatatatgtatgtat 75720 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtat 183 ||||||||||||||||||||| Sbjct: 75722 tattcatatatatgtatgtat 75702
>gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, complete sequence Length = 185452 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgtgtg 188 |||||||||||| |||||||||||||||| Sbjct: 59063 atttattcatatgtatgtatgtatgtgtg 59091
>gb|AC099975.11| Mus musculus chromosome 5, clone RP23-23A2, complete sequence Length = 213359 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatg 184 |||||||||||||||||||||||| Sbjct: 201655 tttattcatatatatgtatgtatg 201632
>gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, complete sequence Length = 181468 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 165 ttcatatatatgtatgtatgtgtg 188 |||||||||||||||||||||||| Sbjct: 91974 ttcatatatatgtatgtatgtgtg 91951
>gb|AC166342.3| Mus musculus BAC clone RP24-340A12 from chromosome 9, complete sequence Length = 174085 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtgac 190 |||||||||||||||||||||||| Sbjct: 1083 catatatatgtatgtatgtgtgac 1106
>gb|AC129336.4| Mus musculus BAC clone RP23-113I7 from chromosome 10, complete sequence Length = 215437 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 165 ttcatatatatgtatgtatgtgtg 188 |||||||||||||||||||||||| Sbjct: 230 ttcatatatatgtatgtatgtgtg 207
>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence Length = 259299 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatg 184 |||||||||||||||||||||||| Sbjct: 103346 tttattcatatatatgtatgtatg 103323
>gb|AC100506.17| Mus musculus chromosome 9, clone RP23-144D3, complete sequence Length = 198388 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtgac 190 |||||||||||||||||||||||| Sbjct: 118371 catatatatgtatgtatgtgtgac 118394
>gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosome 9, complete sequence Length = 162840 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtat 183 |||||||||||||||||||||||| Sbjct: 121866 atttattcatatatatgtatgtat 121889
>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part of the Ranbp17 gene for RAN binding protein 17, an acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (Anp32e) pseudogene and a high mobility group box 1 (Hmgb1) pseudogene, complete sequence Length = 198926 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 157 tgcatttattcatatatatgtatgtatgtgtg 188 ||||||||| ||||||||||||||||||||| Sbjct: 125883 tgcatttatgaatatatatgtatgtatgtgtg 125914
>gb|AC009205.6|AC009205 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone BACR04C20, complete sequence Length = 166918 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 154 ttgtgcatttattcatatatatgtatgtatgt 185 |||||| |||||| |||||||||||||||||| Sbjct: 57344 ttgtgcgtttattgatatatatgtatgtatgt 57375
>gb|AC011756.5|AC011756 Drosophila melanogaster, chromosome 2L, region 36E-37C, BAC clone BACR17A06, complete sequence Length = 170546 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 154 ttgtgcatttattcatatatatgtatgtatgt 185 |||||| |||||| |||||||||||||||||| Sbjct: 142912 ttgtgcgtttattgatatatatgtatgtatgt 142943
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 48.1 bits (24), Expect = 0.032 Identities = 42/48 (87%) Strand = Plus / Minus Query: 272 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 319 |||||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 2769 ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>gb|AC005126.4|AC005126 Drosophila melanogaster, chromosome 2L, region 37B9-37C7, P1 clone DS04995, complete sequence Length = 63571 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 154 ttgtgcatttattcatatatatgtatgtatgt 185 |||||| |||||| |||||||||||||||||| Sbjct: 9299 ttgtgcgtttattgatatatatgtatgtatgt 9330
>gb|AE003661.3| Drosophila melanogaster chromosome 2L, section 70 of 83 of the complete sequence Length = 265558 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 154 ttgtgcatttattcatatatatgtatgtatgt 185 |||||| |||||| |||||||||||||||||| Sbjct: 108050 ttgtgcgtttattgatatatatgtatgtatgt 108081
>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete sequence Length = 203581 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatgtgt 187 |||||||||||| ||||||||||||||| Sbjct: 198854 atttattcatatgtatgtatgtatgtgt 198827
>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence Length = 250957 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Plus Query: 159 catttattcatatatatgtatgtatgtg 186 |||| ||||||||||||||||||||||| Sbjct: 140060 cattcattcatatatatgtatgtatgtg 140087
>emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chromosome X, complete sequence Length = 213822 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgtgt 187 |||||||||||||||||||||||| Sbjct: 14549 attcatatatatgtatgtatgtgt 14526 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 14408 atatatatgtatgtatgtgtg 14428
>gb|AC129931.19| Mus musculus chromosome 15, clone RP23-136I22, complete sequence Length = 186914 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 166 tcatatatatgtatgtatgtgtg 188 ||||||||||||||||||||||| Sbjct: 63583 tcatatatatgtatgtatgtgtg 63561
>gb|AC131596.10| Mus musculus chromosome 10, clone RP23-476G10, complete sequence Length = 178668 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 109912 tattcatatatatgtatgtatgt 109934
>gb|AC146296.3| Mus musculus BAC clone RP23-277D1 from chromosome 9, complete sequence Length = 177641 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 91375 tattcatatatatgtatgtatgt 91353
>gb|AC122928.4| Mus musculus BAC clone RP23-10G8 from 9, complete sequence Length = 205725 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 32985 tattcatatatatgtatgtatgt 33007
>gb|AC121605.3| Mus musculus BAC clone RP23-312E16 from 1, complete sequence Length = 196494 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 39306 tattcatatatatgtatgtatgt 39328
>emb|AL391870.16| Human DNA sequence from clone RP11-491C24 on chromosome 9 Contains part of the CDK5RAP2 gene for CDK5 regulatory subunit associated protein 2 (C48) and a CpG island, complete sequence Length = 46372 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 13639 tattcatatatatgtatgtatgt 13617
>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete sequence Length = 203169 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 119047 tattcatatatatgtatgtatgt 119025
>gb|AC159096.2| Mus musculus chromosome 1, clone RP24-95N15, complete sequence Length = 189668 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 139373 tattcatatatatgtatgtatgt 139351
>gb|AC098971.2| Homo sapiens chromosome 3 clone RP11-118N13, complete sequence Length = 175409 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 165 ttcatatatatgtatgtatgtgt 187 ||||||||||||||||||||||| Sbjct: 155851 ttcatatatatgtatgtatgtgt 155873
>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence Length = 189590 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtga 189 ||||||||||||||||||| ||||||| Sbjct: 167821 tattcatatatatgtatgtgtgtgtga 167795
>gb|AC109469.2| Homo sapiens chromosome 5 clone RP11-349F8, complete sequence Length = 184776 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtga 189 ||||||||||||||||||| ||||||| Sbjct: 76982 tattcatatatatgtatgtgtgtgtga 76956
>gb|AC010474.5| Homo sapiens chromosome 5 clone CTD-2306F13, complete sequence Length = 88069 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgtgtga 189 ||||||||||||||||||| ||||||| Sbjct: 80840 tattcatatatatgtatgtgtgtgtga 80866
>emb|BX855592.19| Zebrafish DNA sequence from clone CH211-232K3, complete sequence Length = 159646 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tttattcatatatatgtatgtat 183 ||||||||||||||||||||||| Sbjct: 141945 tttattcatatatatgtatgtat 141967
>gb|AC107028.5| Homo sapiens 3 BAC RP11-547K2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 126716 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgtg 186 |||||||||||||||||||||| |||| Sbjct: 109602 atttattcatatatatgtatgtgtgtg 109628
>gb|AC104823.4| Homo sapiens BAC clone RP11-762E8 from 2, complete sequence Length = 46638 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 162 ttattcatatatatgtatgtatg 184 ||||||||||||||||||||||| Sbjct: 8434 ttattcatatatatgtatgtatg 8456
>gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complete sequence Length = 183695 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatgtgt 187 |||||||||||||||||||| |||||| Sbjct: 146967 tttattcatatatatgtatgaatgtgt 146941
>gb|AC093927.3| Homo sapiens chromosome 3 clone RP11-81I24, complete sequence Length = 183190 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 165 ttcatatatatgtatgtatgtgt 187 ||||||||||||||||||||||| Sbjct: 168554 ttcatatatatgtatgtatgtgt 168532
>gb|AC139299.3| Mus musculus BAC clone RP23-335D20 from 1, complete sequence Length = 204848 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatgtgt 187 |||||| |||||||||||||||||||| Sbjct: 167582 tttatttatatatatgtatgtatgtgt 167556
>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence Length = 149232 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 161 tttattcatatatatgtatgtatgtgt 187 |||||| |||||||||||||||||||| Sbjct: 17539 tttatttatatatatgtatgtatgtgt 17513
>emb|AL772393.11| Mouse DNA sequence from clone RP23-398D18 on chromosome 4, complete sequence Length = 207495 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgt 185 ||||||||||||||||||||||| Sbjct: 138493 tattcatatatatgtatgtatgt 138515
>gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200117 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 170990 catatatatgtatgtatgtgtg 171011
>gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold Length = 1952403 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 182234 catatatatgtatgtatgtgtg 182255
>gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0002L02, complete sequence Length = 165685 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 146182 catatatatgtatgtatgtgtg 146203
>gb|AC158148.5| Mus musculus chromosome 1, clone RP24-353B6, complete sequence Length = 158895 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 28104 catatatatgtatgtatgtgtg 28083
>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete sequence Length = 250421 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtga 189 |||||||||||||||||||||| Sbjct: 76637 atatatatgtatgtatgtgtga 76616
>gb|AY020626.1| Oryza sativa microsatellite MRG2951 containing (TA)X12, genomic sequence Length = 224 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 71 catatatatgtatgtatgtgtg 92
>gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 198520 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 184703 catatatatgtatgtatgtgtg 184682
>gb|AC115061.20| Mus musculus chromosome 1, clone RP24-399G3, complete sequence Length = 203058 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 141363 catatatatgtatgtatgtgtg 141342
>gb|AC137612.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0022B03, complete sequence Length = 151814 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 9018 catatatatgtatgtatgtgtg 9039
>gb|AC166816.2| Mus musculus chromosome 5, clone RP24-321O22, complete sequence Length = 156357 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 33285 catatatatgtatgtatgtgtg 33264
>gb|BT015295.1| Drosophila melanogaster GH02989 full insert cDNA Length = 4587 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgt 185 |||||| ||||||||||||||||||| Sbjct: 4454 atttatgcatatatatgtatgtatgt 4479
>gb|AC130649.2| Drosophila melanogaster clone BACR06L03, complete sequence Length = 144234 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatgt 185 |||||| ||||||||||||||||||| Sbjct: 45244 atttatgcatatatatgtatgtatgt 45219
>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence Length = 183218 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgt 185 |||||||||||| ||||||||||||| Sbjct: 57251 atttattcatatgtatgtatgtatgt 57276
>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence Length = 185361 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 114691 attcatatatatgtatgtatgt 114670
>gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, complete sequence Length = 218871 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 194564 catatatatgtatgtatgtgtg 194543
>gb|AY519500.1| Gallus gallus CNR/Pcdh-alpha gene cluster, complete sequence Length = 187517 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 151166 catatatatgtatgtatgtgtg 151187
>gb|AY190953.1| Drosophila virilis clone DVIF01_19_E15 (D1419) genomic sequence Length = 43320 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgtgtg 188 |||| ||||||||||||||||||||| Sbjct: 5312 tatttatatatatgtatgtatgtgtg 5337
>gb|AC144808.2| Mus musculus BAC clone RP24-434O1 from chromosome 5, complete sequence Length = 152463 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||||||||||| |||||||| Sbjct: 100028 tattcatatatatgtatatatgtgtg 100003
>gb|AC134434.4| Mus musculus BAC clone RP24-420E8 from chromosome 7, complete sequence Length = 214856 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 127196 catatatatgtatgtatgtgtg 127175
>gb|AC122386.3| Mus musculus BAC clone RP24-72H18 from chromosome 7, complete sequence Length = 161949 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||| |||||||||||||||| Sbjct: 71743 tattcatatgtatgtatgtatgtgtg 71768
>gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, complete sequence Length = 210702 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 182395 catatatatgtatgtatgtgtg 182374
>gb|AC125234.4| Mus musculus BAC clone RP23-14K16 from 13, complete sequence Length = 209715 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 35368 catatatatgtatgtatgtgtg 35347
>gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete sequence Length = 252095 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 35804 catatatatgtatgtatgtgtg 35783 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 169 tatatatgtatgtatgtgtg 188 |||||||||||||||||||| Sbjct: 233644 tatatatgtatgtatgtgtg 233663
>gb|AC122037.2| Mus musculus BAC clone RP24-426D9 from 3, complete sequence Length = 185938 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 34233 catatatatgtatgtatgtgtg 34212
>gb|AC112261.4| Mus musculus BAC clone RP23-204O17 from 3, complete sequence Length = 186290 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 164722 catatatatgtatgtatgtgtg 164701
>emb|CR695648.1|CNS0FZPO Tetraodon nigroviridis full-length cDNA Length = 1323 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1134 catatatatgtatgtatgtgtg 1155
>emb|CR692447.2|CNS0FX8R Tetraodon nigroviridis full-length cDNA Length = 1173 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1007 catatatatgtatgtatgtgtg 1028
>emb|CR691712.2|CNS0FWOC Tetraodon nigroviridis full-length cDNA Length = 1335 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1146 catatatatgtatgtatgtgtg 1167
>emb|CR683623.2|CNS0FQFN Tetraodon nigroviridis full-length cDNA Length = 1267 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1117 catatatatgtatgtatgtgtg 1138
>gb|AC092108.4| Homo sapiens BAC clone RP11-1263I10 from 7, complete sequence Length = 26349 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 5825 catatatatgtatgtatgtgtg 5804
>emb|CR681376.2|CNS0FOP8 Tetraodon nigroviridis full-length cDNA Length = 581 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 405 catatatatgtatgtatgtgtg 426
>emb|CR678828.2|CNS0FMQG Tetraodon nigroviridis full-length cDNA Length = 1058 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 883 catatatatgtatgtatgtgtg 904
>emb|CR675215.2|CNS0FJYT Tetraodon nigroviridis full-length cDNA Length = 1244 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1091 catatatatgtatgtatgtgtg 1112
>emb|CR675000.2|CNS0FJSU Tetraodon nigroviridis full-length cDNA Length = 1072 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 896 catatatatgtatgtatgtgtg 917
>emb|CR669102.2|CNS0FF90 Tetraodon nigroviridis full-length cDNA Length = 1070 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 894 catatatatgtatgtatgtgtg 915
>emb|CR662543.2|CNS0FA6T Tetraodon nigroviridis full-length cDNA Length = 1302 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1126 catatatatgtatgtatgtgtg 1147
>emb|CR662776.2|CNS0FADA Tetraodon nigroviridis full-length cDNA Length = 1294 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1117 catatatatgtatgtatgtgtg 1138
>emb|CR658057.2|CNS0F6Q7 Tetraodon nigroviridis full-length cDNA Length = 1072 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 896 catatatatgtatgtatgtgtg 917
>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence Length = 192682 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 101087 catatatatgtatgtatgtgtg 101108
>gb|AC119848.8| Mus musculus chromosome 7, clone RP23-73B20, complete sequence Length = 239297 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 61265 catatatatgtatgtatgtgtg 61286
>gb|AC165338.3| Mus musculus BAC clone RP24-456K15 from chromosome 10, complete sequence Length = 165515 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 79851 catatatatgtatgtatgtgtg 79830
>emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on chromosome 10 Contains the gene for a novel protein and a ribosomal protein L21 (RPL21)(L21) pseudogene, complete sequence Length = 125798 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 9882 catatatatgtatgtatgtgtg 9903
>emb|AL807736.6| Human DNA sequence from clone RP1-248F5 on chromosome X Contains the gene for PRO0659 protein (FLJ33130 FLJ35046 FLJ34279 FLJ38843 DFKZp667C0711) and a CpG island, complete sequence Length = 84792 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 74561 catatatatgtatgtatgtgtg 74582 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 74523 catatatatgtatgtatgtgtg 74544
>emb|AL592067.4| Human DNA sequence from clone RP11-361H7 on chromosome 13, complete sequence Length = 83141 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 18628 catatatatgtatgtatgtgtg 18607
>emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on chromosome 6, complete sequence Length = 68843 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 7770 catatatatgtatgtatgtgtg 7749
>emb|AL513189.13| Human DNA sequence from clone RP11-339I11 on chromosome 1 Contains part of a novel gene, complete sequence Length = 59522 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 12695 catatatatgtatgtatgtgtg 12674
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 535 catggcggccaccatggcgaccagca 560 ||||||||||||||||||| |||||| Sbjct: 1979245 catggcggccaccatggcgcccagca 1979270
>emb|AL583830.7| Human DNA sequence from clone RP11-172L10 on chromosome 1 Contains the 5' end of a variant of the KCNK2 gene for potassium channel subfamily K member 2 and a translocase of inner mitochondrial membrane 17 homolog A (yeast) (TIMM17A) pseudogene, complete sequence Length = 151469 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 120123 catatatatgtatgtatgtgtg 120102
>emb|AL442636.3| Human DNA sequence from clone RP11-322F18 on chromosome 13 Contains a CpG island, complete sequence Length = 165618 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgtgtga 189 |||||||||||||||||||| ||||| Sbjct: 40008 attcatatatatgtatgtatttgtga 39983
>emb|AL360015.25| Human DNA sequence from clone RP11-344F20 on chromosome 6 Contains a CGI-35 pseudogene, complete sequence Length = 153072 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||||||||||| |||||||| Sbjct: 7155 tattcatatatatgtatatatgtgtg 7130
>emb|AL357129.11| Human DNA sequence from clone RP11-114A21 on chromosome Xq21.31-22.1, complete sequence Length = 145380 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 140947 catatatatgtatgtatgtgtg 140968
>gb|AC112406.5| Rattus norvegicus 11 BAC CH230-329D3 (Children's Hospital Oakland Research Institute) complete sequence Length = 182245 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 45065 catatatatgtatgtatgtgtg 45044
>emb|AL161724.10| Human DNA sequence from clone RP11-114E4 on chromosome 9, complete sequence Length = 130767 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 159 catttattcatatatatgtatgtatgtgtg 188 |||| |||||||||||||||||||| |||| Sbjct: 45460 cattcattcatatatatgtatgtatatgtg 45489
>gb|AC099563.3| Homo sapiens chromosome 1 clone RP11-323K10, complete sequence Length = 91282 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 33182 catatatatgtatgtatgtgtg 33203
>gb|AC163635.5| Mus musculus BAC clone RP23-183F13 from chromosome 17, complete sequence Length = 185844 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 28060 catatatatgtatgtatgtgtg 28081
>emb|CR382400.1| Plasmodium falciparum chromosome 6, complete sequence; segment 3/5 Length = 348034 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 200069 catatatatgtatgtatgtgtg 200090 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgt 187 |||||||||||||||||||| Sbjct: 153551 atatatatgtatgtatgtgt 153532
>emb|AL596096.7| Mouse DNA sequence from clone RP23-42P20 on chromosome 11 Contains the 5' end of the Alox12e gene for epidermal arachidonate lipoxygenase, the gene for arachidonate 15-lipoxygenase, a novel pseudogene, two genes for novel proteins (4930563C04Rik, 1110030J09Rik), a Mitochondrial 28S ribosomal protein pseudogene, a NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8) pseudogene, the gene for a novel protein similar to Beta-arrestin 2 (Arrestin, beta 2) (LOC216869), the Cxcl16 gene for chemokine (C-X-C motif) ligand 16, the gene for a novel protein similar to human zinc finger MYND domain containg 15 (ZMYND15), the 5' end of the gene for a novel protein (2010003F10Rik) and three CpG islands, complete sequence Length = 193277 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 72588 attcatatatatgtatgtatgt 72609
>gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosome 10, complete sequence Length = 196603 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 43198 catatatatgtatgtatgtgtg 43177 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 153891 atatatatgtatgtatgtgtg 153871
>gb|AC182032.3| Spermophilus tridecemlineatus clone VMRC20-712F8, complete sequence Length = 172253 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1421 catatatatgtatgtatgtgtg 1442
>gb|AC162392.9| Mus musculus 6 BAC RP23-197G11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 195176 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgtgtga 189 |||||||||||||| | ||||||||||||| Sbjct: 114449 atttattcatatatgtatatgtatgtgtga 114478
>emb|AL592080.26| Mouse DNA sequence from clone RP23-102H10 on chromosome 11 Contains a endothelial differentiation-related factor 1 (Edf1) pseudogene, the 3' end of the gene for a novel protein similar to human sperm antigen HCMOGT-1 (B230396K10Rik) and a CpG island, complete sequence Length = 216023 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 159 catttattcatatatatgtatgtatgtgtg 188 ||||||| ||||||||||||||||| |||| Sbjct: 176322 catttatgcatatatatgtatgtatatgtg 176293
>emb|AL928625.5| Mouse DNA sequence from clone RP24-528P17 on chromosome 4, complete sequence Length = 170639 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtga 189 |||||||||||||||||||||| Sbjct: 104414 atatatatgtatgtatgtgtga 104435
>emb|BX511201.3|RN177J12 Rattus norvegicus chromosome 1 BAC RP32-177J12, complete sequence Length = 138052 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 30348 catatatatgtatgtatgtgtg 30327
>gb|AC091973.4| Homo sapiens chromosome 5 clone RP11-51B6, complete sequence Length = 156257 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||||||||||| |||||||| Sbjct: 92027 tattcatatatatgtatatatgtgtg 92002
>gb|AF461688.1| Drosophila virilis even-skipped 5' cis-regulatory region sequence Length = 13238 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgtgtg 188 |||| ||||||||||||||||||||| Sbjct: 8307 tatttatatatatgtatgtatgtgtg 8332
>gb|AC084768.4| Homo sapiens chromosome 8, clone RP11-281H11, complete sequence Length = 173677 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 38634 catatatatgtatgtatgtgtg 38655
>ref|NM_176778.1| Drosophila melanogaster lethal (1) G0196 CG14616-RD, transcript variant D (l(1)G0196), mRNA Length = 4724 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 160 atttattcatatatatgtatgtatgt 185 |||||| ||||||||||||||||||| Sbjct: 4616 atttatgcatatatatgtatgtatgt 4641
>gb|AC107022.4| Homo sapiens 3 BAC RP11-417H23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 116557 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 30378 catatatatgtatgtatgtgtg 30357
>gb|AC100768.2| Homo sapiens chromosome 11, clone RP11-945A11, complete sequence Length = 190183 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 114690 catatatatgtatgtatgtgtg 114711
>gb|AF449447.1| Mus musculus C3H chromosome 3 hyplip1 region Length = 176641 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 90088 catatatatgtatgtatgtgtg 90109
>gb|AC063944.25| Homo sapiens 3 BAC RP11-446H18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 180389 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 30492 catatatatgtatgtatgtgtg 30471
>gb|AC023886.7| Homo sapiens BAC clone RP11-402J6 from 4, complete sequence Length = 179697 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 157923 catatatatgtatgtatgtgtg 157902
>gb|AC007425.16| Homo sapiens 12q24.1-120.5-B PAC RPCI5-1048I22 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 139971 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 124555 catatatatgtatgtatgtgtg 124534
>gb|AC092694.6| Homo sapiens 3q BAC RP11-172A10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 151549 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 132135 catatatatgtatgtatgtgtg 132156
>gb|AC073878.7| Homo sapiens BAC clone RP11-744I24 from 7, complete sequence Length = 111375 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 1306 catatatatgtatgtatgtgtg 1327
>gb|AC097379.2| Homo sapiens BAC clone RP11-277G18 from 4, complete sequence Length = 96080 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 36129 catatatatgtatgtatgtgtg 36150
>gb|AC099542.2| Homo sapiens chromosome 3 clone RP11-520D19, complete sequence Length = 178351 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 70304 catatatatgtatgtatgtgtg 70283
>gb|AC109466.2| Homo sapiens chromosome 5 clone RP11-308N24, complete sequence Length = 153815 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||||||||||| |||||||| Sbjct: 130419 tattcatatatatgtatatatgtgtg 130444 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 40738 atatatatgtatgtatgtgtg 40718
>dbj|AK141195.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230098G24 product:hypothetical protein, full insert sequence Length = 2397 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 127 catatatatgtatgtatgtgtg 148
>gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B-20C, BAC clone BACR27K09, complete sequence Length = 179386 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 160 atttattcatatatatgtatgtatgt 185 |||||| ||||||||||||||||||| Sbjct: 109854 atttatgcatatatatgtatgtatgt 109829
>gb|AC010471.4| Homo sapiens chromosome 5 clone CTD-2300P22, complete sequence Length = 112587 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 159 catttattcatatatatgtatgtatgtgtg 188 |||| |||||||||||||||||||| |||| Sbjct: 81088 cattcattcatatatatgtatgtatatgtg 81059
>gb|AC022313.5| Homo sapiens BAC clone RP11-437G1 from 4, complete sequence Length = 183516 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 114741 catatatatgtatgtatgtgtg 114762
>gb|AC153134.5| Mus musculus BAC clone RP24-202N2 from chromosome 13, complete sequence Length = 177669 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 172678 catatatatgtatgtatgtgtg 172657
>gb|AC162182.2| Mus musculus BAC clone RP23-73B23 from chromosome 17, complete sequence Length = 205221 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 112268 catatatatgtatgtatgtgtg 112247
>gb|AC146740.3| Callithrix jacchus clone CH259-204H2, complete sequence Length = 224361 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 182234 catatatatgtatgtatgtgtg 182255
>gb|AC007145.10| Drosophila melanogaster, chromosome 2L, region 37D, BAC clone BACR10I09, complete sequence Length = 169289 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 163 tattcatatatatgtatgtatgtgtg 188 ||||||||||||||||||||| |||| Sbjct: 5892 tattcatatatatgtatgtatatgtg 5867
>gb|AC020937.6| Homo sapiens chromosome 5 clone CTD-2299I21, complete sequence Length = 94161 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 91309 attcatatatatgtatgtatgt 91288
>emb|CR405841.1| Gallus gallus finished cDNA, clone ChEST885e19 Length = 1184 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 740 catatatatgtatgtatgtgtg 761
>dbj|AK032932.1| Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720474J12 product:unclassifiable, full insert sequence Length = 2814 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 2630 attcatatatatgtatgtatgt 2609
>gb|AC159809.2| Mus musculus BAC clone RP24-216P6 from chromosome 9, complete sequence Length = 160712 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 83021 catatatatgtatgtatgtgtg 83042
>gb|AC008502.8| Homo sapiens chromosome 5 clone CTC-442G11, complete sequence Length = 123495 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 21611 attcatatatatgtatgtatgt 21590
>gb|AC008680.5|AC008680 Homo sapiens chromosome 5 clone CTB-53I9, complete sequence Length = 229045 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 63056 catatatatgtatgtatgtgtg 63035
>dbj|AK048247.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130043D08 product:unclassifiable, full insert sequence Length = 2077 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtga 189 |||||||||||||||||||||| Sbjct: 491 atatatatgtatgtatgtgtga 470
>ref|NG_004818.1| Gallus gallus cadherin-related neuronal receptor 10 pseudogene (CNRV10) Length = 98944 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 72707 catatatatgtatgtatgtgtg 72728
>dbj|AK085615.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched library, clone:D630047J16 product:unclassifiable, full insert sequence Length = 2297 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 683 catatatatgtatgtatgtgtg 662
>gb|AC018694.4|AC018694 Homo sapiens BAC clone RP11-563P16 from 11, complete sequence Length = 196832 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 16979 catatatatgtatgtatgtgtg 17000
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 164 attcatatatatgtatgtatgt 185 |||||||||||||||||||||| Sbjct: 11599914 attcatatatatgtatgtatgt 11599893 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgt 187 |||||||||||||||||||| Sbjct: 17161797 atatatatgtatgtatgtgt 17161816 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 atttattcatatatatgtat 179 |||||||||||||||||||| Sbjct: 11135084 atttattcatatatatgtat 11135103 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgt 187 |||||||||||||||||||| Sbjct: 9547342 atatatatgtatgtatgtgt 9547361
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 10023416 catatatatgtatgtatgtgtg 10023437 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgt 187 |||||||||||||||||||| Sbjct: 15014823 atatatatgtatgtatgtgt 15014842 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgt 187 |||||||||||||||||||| Sbjct: 11795059 atatatatgtatgtatgtgt 11795040
>gb|AC106895.5| Homo sapiens BAC clone RP11-161D15 from 4, complete sequence Length = 135450 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 29358 catatatatgtatgtatgtgtg 29379 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 75932 atatatatgtatgtatgtgtg 75912
>gb|AC007709.4|AC007709 Drosophila melanogaster, chromosome 3R, region 86E-86E, BAC clone BACR13P08, complete sequence Length = 169707 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 90871 catatatatgtatgtatgtgtg 90850
>gb|AC010744.7| Homo sapiens BAC clone RP11-548D17 from 2, complete sequence Length = 186687 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 167 catatatatgtatgtatgtgtg 188 |||||||||||||||||||||| Sbjct: 85893 catatatatgtatgtatgtgtg 85872 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 168 atatatatgtatgtatgtgtg 188 ||||||||||||||||||||| Sbjct: 134261 atatatatgtatgtatgtgtg 134281 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,700,368 Number of Sequences: 3902068 Number of extensions: 4700368 Number of successful extensions: 255338 Number of sequences better than 10.0: 1986 Number of HSP's better than 10.0 without gapping: 2003 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 239976 Number of HSP's gapped (non-prelim): 15115 length of query: 566 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 543 effective length of database: 17,143,297,704 effective search space: 9308810653272 effective search space used: 9308810653272 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
