ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags37h21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 815 0.0
2gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 803 0.0
3gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 801 0.0
4gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 799 0.0
5dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
6dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
7dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
8dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
9dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
10dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 618 e-174
11dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 611 e-171
12dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 599 e-168
13dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
14dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
15dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
16gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 280 6e-72
17gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 260 5e-66
18gb|AY105015.1| Zea mays PCO137646 mRNA sequence 260 5e-66
19gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 230 5e-57
20ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 226 8e-56
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 226 8e-56
22dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 226 8e-56
23dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 226 8e-56
24dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 226 8e-56
25dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 226 8e-56
26emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 226 8e-56
27gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 222 1e-54
28gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 222 1e-54
29gb|AY106931.1| Zea mays PCO140073 mRNA sequence 222 1e-54
30emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 194 3e-46
31gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 184 3e-43
32emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 178 2e-41
33ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 170 4e-39
34gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 170 4e-39
35gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 170 4e-39
36dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 170 4e-39
37dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 170 4e-39
38dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
39dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
40dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
41dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
42dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 4e-39
43ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 167 6e-38
44emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 167 6e-38
45dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 167 6e-38
46gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 145 2e-31
47ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 141 3e-30
48dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
49dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 141 3e-30
50dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 3e-30
51dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 3e-30
52dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 141 3e-30
53emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 139 1e-29
54gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 123 8e-25
55gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 119 1e-23
56gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 119 1e-23
57ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A... 115 2e-22
58ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron... 115 2e-22
59gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 115 2e-22
60gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 115 2e-22
61gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 115 2e-22
62emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
63emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
64emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
65gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s... 115 2e-22
66dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 115 2e-22
67gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 115 2e-22
68gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr... 115 2e-22
69gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 107 5e-20
70gb|AY104464.1| Zea mays PCO114899 mRNA sequence 107 5e-20
71dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 100 1e-17
72gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 98 5e-17
73gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr... 98 5e-17
74gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 92 3e-15
75dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 1e-14
76emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 88 4e-14
77emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 86 2e-13
78emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 86 2e-13
79gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 86 2e-13
80emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 84 7e-13
81gb|AC183494.1| Brassica oleracea Contig C, complete sequence 84 7e-13
82emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Co... 82 3e-12
83gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 82 3e-12
84ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 80 1e-11
85ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 80 1e-11
86gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 80 1e-11
87gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 80 1e-11
88gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 80 1e-11
89gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 80 1e-11
90gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 80 1e-11
91gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 80 1e-11
92emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
93emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
94emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
95emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
96emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
97emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
98emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
99dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 80 1e-11
100dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 80 1e-11
101gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 80 1e-11
102dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 80 1e-11
103emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 72 3e-09
104emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 72 3e-09
105dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds 72 3e-09
106emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
107emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
108emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 66 2e-07
109gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds 66 2e-07
110ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 64 6e-07
111emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 64 6e-07
112dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 6e-07
113gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intr... 64 6e-07
114gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 62 3e-06
115ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 60 1e-05
116emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 60 1e-05
117emb|AJ843991.1| Plantago major partial mRNA for aquaporin 1 (aqp... 60 1e-05
118gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2... 60 1e-05
119dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 60 1e-05
120dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 1e-05
121gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water chann... 58 4e-05
122dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 58 4e-05
123ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 56 2e-04
124gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 56 2e-04
125emb|Z48232.1|PCRB7PRJ P.crispum mRNA for membrane intrinsic protein 56 2e-04
126gb|DQ442393.1| Striga asiatica clone St461 aquaporin mRNA, parti... 56 2e-04
127gb|AC183495.1| Brassica oleracea Contig A, complete sequence 56 2e-04
128gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 56 2e-04
129gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 56 2e-04
130emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Co... 56 2e-04
131dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
132dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
133gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 56 2e-04
134gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 56 2e-04
135dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 56 2e-04
136dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 56 2e-04
137ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 54 6e-04
138ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 6e-04
139ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 54 6e-04
140ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 54 6e-04
141gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 54 6e-04
142gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 54 6e-04
143gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 54 6e-04
144dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
145gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 54 6e-04
146gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 54 6e-04
147dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 54 6e-04
148dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 54 6e-04
149dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
150dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 54 6e-04
151dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
152dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
153dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
154dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
155dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 6e-04
156gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 54 6e-04
157gb|AY109332.1| Zea mays CL502_5 mRNA sequence 54 6e-04
158gb|AF133533.1|AF133533 Mesembryanthemum crystallinum water chann... 54 6e-04
159emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 54 6e-04
160dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 54 6e-04
161ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water c... 52 0.002
162emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ... 52 0.002
163emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
164gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, comp... 52 0.002
165gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mR... 52 0.002
166emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 52 0.002
167emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Co... 52 0.002
168emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
169dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsi... 52 0.002
170gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete s... 52 0.002
171emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonopl... 50 0.010
172emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 48 0.038
173emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 48 0.038
174gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 48 0.038
175gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.038
176gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 48 0.038
177dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 48 0.038
178gb|AY107675.1| Zea mays PCO112712 mRNA sequence 48 0.038
179dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 48 0.038
180gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.038
181ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.15
182gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 46 0.15
183gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome... 46 0.15
184emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 46 0.15
185emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,... 46 0.15
186emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 46 0.15
187gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.15
188gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 46 0.15
189gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 46 0.15
190dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.15
191gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 46 0.15
192gb|AY902360.1| Triticum aestivum water channel protein PIP4 (AQP... 46 0.15
193ref|NM_187411.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.60
194ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 44 0.60
195ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 44 0.60
196dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
197dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 44 0.60
198dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 44 0.60
199ref|NM_188789.1| Oryza sativa (japonica cultivar-group), predic... 42 2.4
200ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 42 2.4
201gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 42 2.4
202ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), ... 42 2.4
203ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA 42 2.4
204ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori... 42 2.4
205gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 42 2.4
206gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, ... 42 2.4
207gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major in... 42 2.4
208gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like pr... 42 2.4
209emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like pr... 42 2.4
210emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segmen... 42 2.4
211dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 2.4
212dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
213dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
214gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 42 2.4
215emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquapor... 42 2.4
216dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
217dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 42 2.4
218dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
219gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRN... 42 2.4
220gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
221gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple... 42 2.4
222ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA 42 2.4
223ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 9.3
224gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome... 40 9.3
225ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 40 9.3
226gb|DQ164589.1| Hepatitis C virus isolate BE00-17-3630 polyprotei... 40 9.3
227gb|DQ164581.1| Hepatitis C virus isolate BE01-17-3630 polyprotei... 40 9.3
228gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.3
229gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 9.3
230ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.3
231gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete se... 40 9.3
232gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 9.3
233gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 9.3
234emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 9.3
235gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 9.3
236gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 9.3
237emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene 40 9.3
238emb|BX640419.1| Bordetella pertussis strain Tohama I, complete g... 40 9.3
239emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genom... 40 9.3
240emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 40 9.3
241gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 9.3
242gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 9.3
243gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 9.3
244gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 9.3
245gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 9.3
246dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
247dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
248dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
249emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 9.3
250emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 9.3
251emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 9.3
252emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 9.3
253emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 9.3
254emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 9.3
255emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 9.3
256emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 9.3
257emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 9.3
258gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 9.3
259gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 40 9.3
260dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
261dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 9.3
262dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
263dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 40 9.3
264dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
265dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
266dbj|AK101995.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
267gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 9.3
268emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 40 9.3
269dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
270dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
271gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 9.3
272emb|AL731883.4|CNS08C8N Oryza sativa chromosome 12, . BAC OSJNBa... 40 9.3
273emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 40 9.3
274gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 9.3

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  815 bits (411), Expect = 0.0
 Identities = 479/499 (95%), Gaps = 2/499 (0%)
 Strand = Plus / Minus

                                                                       
Query: 185 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 244
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 245 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 304
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                       
Query: 305 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 364
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622

                                                                       
Query: 365 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 424
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562

                                                                       
Query: 425 gccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaa 484
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 gccgagggaacccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaa 502

                                                                       
Query: 485 ggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgt 544
           ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 501 ggtgacgatgatctccatcacgacgccctcaaaggcgcccacgccggaaagcccgtgtgt 442

                                                                       
Query: 545 aggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggag 604
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 aggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggag 382

                                                                       
Query: 605 ctgcgcaacccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gc 663
           ||| |||||||| ||||||| ||||||||||||||||||| || |||||||| |||| ||
Sbjct: 381 ctgggcaacccaatagaagatgccggtgaggatggtgatc-tggccgccgagggcgaggc 323

                              
Query: 664 ccaaggtgacggcagggtt 682
           | |||||||||||||||||
Sbjct: 322 cgaaggtgacggcagggtt 304



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  803 bits (405), Expect = 0.0
 Identities = 479/501 (95%), Gaps = 2/501 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 242
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 243 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 302
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                       
Query: 303 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 362
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621

                                                                       
Query: 363 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 422
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561

                                                                       
Query: 423 gtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccg 482
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 gtgccgagggaccccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccg 501

                                                                       
Query: 483 aaggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgt 542
           ||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||
Sbjct: 500 aaggtgacgatgatctccatcacgacgccctcgaaggcgcccacgccggaaagcccgtgt 441

                                                                       
Query: 543 gtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgagg 602
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 440 gtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcgccgagg 381

                                                                       
Query: 603 agctgcgcaacccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga- 661
           ||||| |||||||||||||||| ||||||||||||||||||| || |||||||| |||| 
Sbjct: 380 agctgggcaacccagtagaagatgccggtgaggatggtgatc-tggccgccgagggcgag 322

                                
Query: 662 gcccaaggtgacggcagggtt 682
           ||| |||||||||||||||||
Sbjct: 321 gccgaaggtgacggcagggtt 301



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  801 bits (404), Expect = 0.0
 Identities = 581/637 (91%), Gaps = 20/637 (3%)
 Strand = Plus / Minus

                                                                       
Query: 55  gcttcgatctgaacnaa-caacatgacgttcttcacatcatcgagacattc-------tg 106
           |||||||||||||| || ||||| || ||||||||||||||||| ||||||       ||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                                       
Query: 107 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 166
            |||||||| ||||||||||| |||||||||||||||| |||||         |||||||
Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823

                                                                       
Query: 167 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 226
           || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||||
Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763

                                                                       
Query: 227 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703

                                                                       
Query: 287 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 346
            | ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643

                                                                       
Query: 347 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 406
           |||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583

                                                                       
Query: 407 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 466
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 523

                                                                       
Query: 467 ggtgtagacgagcccgaaggtgacgatgatctccatcaccacgccctcaaaagcgcccac 526
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 522 ggtgtagacgagcccgaaggtgacgatgatctccatcacgacgccctcaaaggcgcccac 463

                                                                       
Query: 527 gccggaaagcccgtgtgtaggggtcgccacgccggtgcagaactggacgaggaaggcgcc 586
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 462 gccggaaagcccgtgtgtaggggtggccacgccggtgcagaactggacgaggaaggcgcc 403

                                                                       
Query: 587 gacgatggcaccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctt 646
           ||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||| |
Sbjct: 402 gacgatggcgccgaggagctgggcaacccagtagaagatgccggtgaggatggtgatc-t 344

                                                
Query: 647 gaccgccgagcgcga-gcccaaggtgacggcagggtt 682
           | |||||||| |||| ||| |||||||||||||||||
Sbjct: 343 ggccgccgagggcgaggccgaaggtgacggcagggtt 307



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  799 bits (403), Expect = 0.0
 Identities = 480/503 (95%), Gaps = 2/503 (0%)
 Strand = Plus / Minus

                                                                       
Query: 181 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 240
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 241 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 300
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                       
Query: 301 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 360
           ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627

                                                                       
Query: 361 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 420
           ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567

                                                                       
Query: 421 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcc 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 566 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcc 507

                                                                       
Query: 481 cgaaggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgt 540
           ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 506 cgaaggtgacgatgatctccatcacgacgccctcaaaggcgcccacgccggaaagcccgt 447

                                                                       
Query: 541 gtgtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccga 600
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 446 gtgtaggggtggccacgccggtgcagaactggacgaggaaggcgccgacgatggcgccga 387

                                                                       
Query: 601 ggagctgcgcaacccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcg 660
           ||||||| |||||||||||||||| ||||||||||||||||||| || |||||||| |||
Sbjct: 386 ggagctgggcaacccagtagaagatgccggtgaggatggtgatc-tggccgccgagggcg 328

                                  
Query: 661 a-gcccaaggtgacggcagggtt 682
           | ||| |||||||||||||||||
Sbjct: 327 aggccgaaggtgacggcagggtt 305



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 585 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 526

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 525 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 466

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 465 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 406

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 405 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 347

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 346 gccgggtt 339



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 528

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 527 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 468

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 467 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 408

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 407 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 349

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 348 gccgggtt 341



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 529

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 528 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 469

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 468 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 409

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 408 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 350

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 349 gccgggtt 342



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 527

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 526 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 467

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 466 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 407

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 406 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 348

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 347 gccgggtt 340



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 529

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 528 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 469

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 468 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 409

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 408 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 350

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 349 gccgggtt 342



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  618 bits (312), Expect = e-174
 Identities = 446/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 527

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 526 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 467

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 466 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 407

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 406 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 348

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 347 gccgggtt 340



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  611 bits (308), Expect = e-171
 Identities = 445/488 (91%), Gaps = 2/488 (0%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 528

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 527 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 468

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 467 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 408

                                                                       
Query: 616 agtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtgacg 674
           ||||||||| ||||||||||||||||||| || |||||||| |||| ||| |||||||||
Sbjct: 407 agtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtgacg 349

                   
Query: 675 gcagggtt 682
           || |||||
Sbjct: 348 gccgggtt 341



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  599 bits (302), Expect = e-168
 Identities = 413/450 (91%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 256 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                                       
Query: 316 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466

                                                                       
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
           ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 465 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 406

                                                                       
Query: 496 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 555
           ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||||
Sbjct: 405 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 346

                                                                       
Query: 556 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 615
           |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | ||
Sbjct: 345 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 286

                                         
Query: 616 agtagaagaggccggtgaggatggtgatct 645
           ||||||||| ||||||||||||||||||||
Sbjct: 285 agtagaagacgccggtgaggatggtgatct 256



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  474 bits (239), Expect = e-130
 Identities = 329/359 (91%)
 Strand = Plus / Minus

                                                                            
Query: 196      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 256      ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
                |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                                            
Query: 316      caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
                | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946

                                                                            
Query: 376      cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
                ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886

                                                                            
Query: 436      ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
                ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 13250885 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 13250826

                                                                           
Query: 496      tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 554
                ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||
Sbjct: 13250825 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 13250767



 Score =  149 bits (75), Expect = 1e-32
 Identities = 119/131 (90%), Gaps = 2/131 (1%)
 Strand = Plus / Minus

                                                                            
Query: 553      ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 612
                ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || |
Sbjct: 13250666 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 13250607

                                                                            
Query: 613      cccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtg 671
                 ||||||||||| ||||||||||||||||||| || |||||||| |||| ||| ||||||
Sbjct: 13250606 tccagtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtg 13250548

                           
Query: 672      acggcagggtt 682
                ||||| |||||
Sbjct: 13250547 acggccgggtt 13250537



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  474 bits (239), Expect = e-130
 Identities = 329/359 (91%)
 Strand = Plus / Minus

                                                                         
Query: 196   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 256   ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
             |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                                         
Query: 316   caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
             | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756

                                                                         
Query: 376   cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
             ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696

                                                                         
Query: 436   ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
             ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 12695 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 12636

                                                                        
Query: 496   tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 554
             ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||
Sbjct: 12635 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 12577



 Score =  149 bits (75), Expect = 1e-32
 Identities = 119/131 (90%), Gaps = 2/131 (1%)
 Strand = Plus / Minus

                                                                         
Query: 553   ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 612
             ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || |
Sbjct: 12476 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 12417

                                                                         
Query: 613   cccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtg 671
              ||||||||||| ||||||||||||||||||| || |||||||| |||| ||| ||||||
Sbjct: 12416 tccagtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtg 12358

                        
Query: 672   acggcagggtt 682
             ||||| |||||
Sbjct: 12357 acggccgggtt 12347



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  474 bits (239), Expect = e-130
 Identities = 329/359 (91%)
 Strand = Plus / Minus

                                                                          
Query: 196    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 255
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 256    ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 315
              |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                                          
Query: 316    caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 375
              | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134

                                                                          
Query: 376    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
              ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074

                                                                          
Query: 436    ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
              ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 168073 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 168014

                                                                         
Query: 496    tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 554
              ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||
Sbjct: 168013 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 167955



 Score =  149 bits (75), Expect = 1e-32
 Identities = 119/131 (90%), Gaps = 2/131 (1%)
 Strand = Plus / Minus

                                                                          
Query: 553    ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 612
              ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || |
Sbjct: 167854 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 167795

                                                                          
Query: 613    cccagtagaagaggccggtgaggatggtgatcttgaccgccgagcgcga-gcccaaggtg 671
               ||||||||||| ||||||||||||||||||| || |||||||| |||| ||| ||||||
Sbjct: 167794 tccagtagaagacgccggtgaggatggtgatc-tggccgccgagggcgaggccgaaggtg 167736

                         
Query: 672    acggcagggtt 682
              ||||| |||||
Sbjct: 167735 acggccgggtt 167725



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  280 bits (141), Expect = 6e-72
 Identities = 245/277 (88%), Gaps = 2/277 (0%)
 Strand = Plus / Minus

                                                                       
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
           |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 299 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 357
           || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

                                                                       
Query: 358 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 417
           ||  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585

                                                                       
Query: 418 cgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 477
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cgatggtgccgagggagcccttcttggggtcggcggcggtggcgtacacggtgtagacga 525

                                                
Query: 478 gcccgaaggtgacgatgatctccatcaccacgccctc 514
           || ||||||||| || |||||| | ||| ||||||||
Sbjct: 524 gcgcgaaggtgatgacgatctcgaacacgacgccctc 488



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 603 agctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| || ||||||||||||||||||||||||| ||||||
Sbjct: 393 agctgggccacccagtagaagaggccggtgaggacggtgat 353



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  260 bits (131), Expect = 5e-66
 Identities = 221/251 (88%)
 Strand = Plus / Minus

                                                                       
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 299 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 358
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801

                                                                       
Query: 359 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 418
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741

                                                                       
Query: 419 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 478
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 681

                      
Query: 479 cccgaaggtga 489
           | |||||||||
Sbjct: 680 cgcgaaggtga 670



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 603 agctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| || ||||||||||||| ||| || |||||||||||
Sbjct: 553 agctgggccacccagtagaagacgcccgtcaggatggtgat 513



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  260 bits (131), Expect = 5e-66
 Identities = 221/251 (88%)
 Strand = Plus / Minus

                                                                       
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 299 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 358
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800

                                                                       
Query: 359 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 418
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740

                                                                       
Query: 419 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 478
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 739 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 680

                      
Query: 479 cccgaaggtga 489
           | |||||||||
Sbjct: 679 cgcgaaggtga 669



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 603 agctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| || ||||||||||||| ||| || |||||||||||
Sbjct: 552 agctgggccacccagtagaagacgcccgtcaggatggtgat 512



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  230 bits (116), Expect = 5e-57
 Identities = 224/260 (86%)
 Strand = Plus / Minus

                                                                       
Query: 255 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 314
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                                       
Query: 315 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 374
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620

                                                                       
Query: 375 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 434
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           |||||||| |||||||| |||||||||||||||||||| || ||| |||||||||  | |
Sbjct: 559 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 500

                               
Query: 495 atctccatcaccacgccctc 514
           ||||||||||||||||||||
Sbjct: 499 atctccatcaccacgccctc 480



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 597 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| ||||| ||||||||||||| || ||||||||||||||||||
Sbjct: 394 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgat 348



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                                       
Query: 309 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564

                                                                       
Query: 369 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504

                                                                       
Query: 429 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
           || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 503 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 444

                                     
Query: 489 acgatgatctccatcaccacgccctc 514
           | || |||||||||||| ||||||||
Sbjct: 443 atgacgatctccatcacgacgccctc 418



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 614 ccagtagaagaggccggtgaggatggtgat 643
           |||||||||||| |||||||||||||||||
Sbjct: 315 ccagtagaagagtccggtgaggatggtgat 286



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Plus

                                                                            
Query: 249      ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
                ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                            
Query: 309      ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
                |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302

                                                                            
Query: 369      ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
                |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362

                                                                            
Query: 429      agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
                || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 26627363 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 26627422

                                          
Query: 489      acgatgatctccatcaccacgccctc 514
                | || |||||||||||| ||||||||
Sbjct: 26627423 atgacgatctccatcacgacgccctc 26627448



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                    
Query: 465      acggtgtagacgagcccgaaggtgacgatgatctcc 500
                ||||||||||||||| |||||||| |||||||||||
Sbjct: 25182111 acggtgtagacgagcacgaaggtgccgatgatctcc 25182076



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 614      ccagtagaagaggccggtgaggatggtgat 643
                |||||||||||| |||||||||||||||||
Sbjct: 26627669 ccagtagaagagtccggtgaggatggtgat 26627698



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Plus

                                                                          
Query: 249    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                          
Query: 309    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683

                                                                          
Query: 369    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743

                                                                          
Query: 429    agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
              || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 169744 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 169803

                                        
Query: 489    acgatgatctccatcaccacgccctc 514
              | || |||||||||||| ||||||||
Sbjct: 169804 atgacgatctccatcacgacgccctc 169829



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 614    ccagtagaagaggccggtgaggatggtgat 643
              |||||||||||| |||||||||||||||||
Sbjct: 170050 ccagtagaagagtccggtgaggatggtgat 170079



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Plus

                                                                         
Query: 249   ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
             ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                                         
Query: 309   ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
             |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463

                                                                         
Query: 369   ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
             |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523

                                                                         
Query: 429   agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
             || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 61524 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 61583

                                       
Query: 489   acgatgatctccatcaccacgccctc 514
             | || |||||||||||| ||||||||
Sbjct: 61584 atgacgatctccatcacgacgccctc 61609



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 614   ccagtagaagaggccggtgaggatggtgat 643
             |||||||||||| |||||||||||||||||
Sbjct: 61830 ccagtagaagagtccggtgaggatggtgat 61859



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                                       
Query: 309 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637

                                                                       
Query: 369 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577

                                                                       
Query: 429 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
           || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 576 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 517

                                     
Query: 489 acgatgatctccatcaccacgccctc 514
           | || |||||||||||| ||||||||
Sbjct: 516 atgacgatctccatcacgacgccctc 491



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 614 ccagtagaagaggccggtgaggatggtgat 643
           |||||||||||| |||||||||||||||||
Sbjct: 388 ccagtagaagagtccggtgaggatggtgat 359



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Minus

                                                                       
Query: 249 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                                       
Query: 309 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439

                                                                       
Query: 369 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379

                                                                       
Query: 429 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
           || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 378 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 319

                                     
Query: 489 acgatgatctccatcaccacgccctc 514
           | || |||||||||||| ||||||||
Sbjct: 318 atgacgatctccatcacgacgccctc 293



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 614 ccagtagaagaggccggtgaggatggtgat 643
           |||||||||||| |||||||||||||||||
Sbjct: 190 ccagtagaagagtccggtgaggatggtgat 161



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  226 bits (114), Expect = 8e-56
 Identities = 228/266 (85%)
 Strand = Plus / Minus

                                                                          
Query: 249    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 308
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                          
Query: 309    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 368
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532

                                                                          
Query: 369    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 428
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472

                                                                          
Query: 429    agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 488
              || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| |||
Sbjct: 250471 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 250412

                                        
Query: 489    acgatgatctccatcaccacgccctc 514
              | || |||||||||||| ||||||||
Sbjct: 250411 atgacgatctccatcacgacgccctc 250386



 Score =  159 bits (80), Expect = 1e-35
 Identities = 146/168 (86%)
 Strand = Plus / Plus

                                                                          
Query: 347    catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 406
              |||||| ||||||  ||| ||||||||  ||||||||||||| |||||||||||||||||
Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154

                                                                          
Query: 407    ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 466
               |||||||| |||||||||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtccgccgccgtggcgtacac 332214

                                                              
Query: 467    ggtgtagacgagcccgaaggtgacgatgatctccatcaccacgccctc 514
               ||||| || ||| |||| |||| || |||||||||||| ||||||||
Sbjct: 332215 cgtgtacaccagcgcgaacgtgatgacgatctccatcacgacgccctc 332262



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 614    ccagtagaagaggccggtgaggatggtgat 643
              |||||||||||| |||||||||||||||||
Sbjct: 332483 ccagtagaagagtccggtgaggatggtgat 332512



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 614    ccagtagaagaggccggtgaggatggtgat 643
              |||||||||||| |||||||||||||||||
Sbjct: 250165 ccagtagaagagtccggtgaggatggtgat 250136



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  222 bits (112), Expect = 1e-54
 Identities = 223/260 (85%)
 Strand = Plus / Minus

                                                                       
Query: 255 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 314
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                                       
Query: 315 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 374
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561

                                                                       
Query: 375 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 434
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           |||||||| |||||||| |||||||||||||||||||| || ||| |||||||||  | |
Sbjct: 500 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 441

                               
Query: 495 atctccatcaccacgccctc 514
           ||||||||||||||||||||
Sbjct: 440 atctccatcaccacgccctc 421



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 597 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| ||||| ||||||||||||| || ||||||||||||||||||
Sbjct: 335 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgat 289



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  222 bits (112), Expect = 1e-54
 Identities = 223/260 (85%)
 Strand = Plus / Minus

                                                                       
Query: 255 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 314
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                                       
Query: 315 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 374
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629

                                                                       
Query: 375 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 434
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           |||||||| |||||||| |||||||||||||||||||| || ||| |||||||||  | |
Sbjct: 568 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 509

                               
Query: 495 atctccatcaccacgccctc 514
           ||||||||||||||||||||
Sbjct: 508 atctccatcaccacgccctc 489



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 597 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| ||||| ||||||||||||| || ||||||||||||||||||
Sbjct: 403 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgat 357



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  222 bits (112), Expect = 1e-54
 Identities = 223/260 (85%)
 Strand = Plus / Minus

                                                                       
Query: 255 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 314
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                                       
Query: 315 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 374
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638

                                                                       
Query: 375 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 434
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           |||||||| |||||||| |||||||||||||||||||| || ||  |||||||||  | |
Sbjct: 577 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacg 518

                               
Query: 495 atctccatcaccacgccctc 514
           ||||||||||||||||||||
Sbjct: 517 atctccatcaccacgccctc 498



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 597 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| ||||| ||||||||||||| || ||||||||||||||||||
Sbjct: 412 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgat 366



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  194 bits (98), Expect = 3e-46
 Identities = 233/278 (83%)
 Strand = Plus / Minus

                                                                       
Query: 237 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 296
           ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 297 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 356
           | ||||||||| |||||  |||| || ||| |||| ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

                                                                       
Query: 357 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 416
           || ||||||||||| ||  | | ||||||||| || ||||||||||| || || ||||| 
Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596

                                                                       
Query: 417 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 476
           ||||||||||| |||   |||||||| |||||||| ||||||||||| |||||||||| |
Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcggctgcggtggcgtagacggtgtagatg 536

                                                 
Query: 477 agcccgaaggtgacgatgatctccatcaccacgccctc 514
           ||| |||| ||||  | |||||||||||||||||||||
Sbjct: 535 agcgcgaatgtgataacgatctccatcaccacgccctc 498



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  184 bits (93), Expect = 3e-43
 Identities = 171/197 (86%)
 Strand = Plus / Minus

                                                                         
Query: 318   acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
             ||||| || ||||| ||||| || ||||||||||| ||||||  |||||| |||||  ||
Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784

                                                                         
Query: 378   aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
             ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724

                                                                         
Query: 438   ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
             |||||||||||||| || || |||||||| ||||| || ||| |||||||||  | ||||
Sbjct: 44723 ttcttggggtcggccgccgtcgcgtacaccgtgtacaccagcgcgaaggtgatcacgatc 44664

                              
Query: 498   tccatcaccacgccctc 514
             |||||||||||||||||
Sbjct: 44663 tccatcaccacgccctc 44647



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                           
Query: 597   ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtga 642
             ||||| ||||| || |||||||||||||| ||||||||||||||||
Sbjct: 44437 ccgagcagctgggcgacccagtagaagagcccggtgaggatggtga 44392



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 301   tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 352
             |||||||||||||| |||| || || ||||| || || || |||||||||||
Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154



to top

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  178 bits (90), Expect = 2e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 320 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 379
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | |||||
Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| |||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562

                                                                       
Query: 440 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 499
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 561 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 502

             
Query: 500 ca 501
           ||
Sbjct: 501 ca 500



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 477

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 476 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 431



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Plus

                                                                           
Query: 342     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945

                                                                           
Query: 402     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
               ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545005

                                                             
Query: 462     tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
               ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 2545006 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 2545051



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 239     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 292      agatgttggtgaagtcgccgctg 314
                |||||||||||||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                          
Query: 342    gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
              |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149

                                                                          
Query: 402    ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
              ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 125089

                                                            
Query: 462    tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
              ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 125088 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 125043



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 239    gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
              ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Plus

                                                                           
Query: 342     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055

                                                                           
Query: 402     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
               ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545115

                                                             
Query: 462     tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
               ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 2545116 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 2545161



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 239     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 292      agatgttggtgaagtcgccgctg 314
                |||||||||||||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 555

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 554 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 509



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Plus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 414

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 415 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 460



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 564

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 563 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 518



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 566

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 565 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 520



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 90

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 89  tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 44



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  170 bits (86), Expect = 4e-39
 Identities = 146/166 (87%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||||||||||||||||||||||||||||   ||||||||||||||  |||||||||||
Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 562

                                                         
Query: 462 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 507
           ||||||||||||||||| |||||||| | || |||||||| |||||
Sbjct: 561 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 516



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  167 bits (84), Expect = 6e-38
 Identities = 228/276 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
           ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                       
Query: 299 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 358
           || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577

                                                                       
Query: 359 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 418
           |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517

                                                                       
Query: 419 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 478
           || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || ||
Sbjct: 516 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 457

                                               
Query: 479 cccgaaggtgacgatgatctccatcaccacgccctc 514
           | |||| ||||  |  ||||||||||||| ||||||
Sbjct: 456 cgcgaacgtgatcacaatctccatcaccatgccctc 421



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 597 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           ||||| ||||| || ||||||||||||| ||||||||||||||||||
Sbjct: 332 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgat 286



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  167 bits (84), Expect = 6e-38
 Identities = 228/276 (82%)
 Strand = Plus / Plus

                                                                         
Query: 239   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
             ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                         
Query: 299   ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 358
             || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602

                                                                         
Query: 359   ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 418
             |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662

                                                                         
Query: 419   gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 478
             || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || ||
Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 92722

                                                 
Query: 479   cccgaaggtgacgatgatctccatcaccacgccctc 514
             | |||| ||||  |  ||||||||||||| ||||||
Sbjct: 92723 cgcgaacgtgatcacaatctccatcaccatgccctc 92758



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 597   ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
             ||||| ||||| || ||||||||||||| ||||||||||||||||||
Sbjct: 92924 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgat 92970



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  167 bits (84), Expect = 6e-38
 Identities = 228/276 (82%)
 Strand = Plus / Plus

                                                                            
Query: 239      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 298
                ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                            
Query: 299      ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 358
                || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626

                                                                            
Query: 359      ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 418
                |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686

                                                                            
Query: 419      gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 478
                || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || ||
Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 27568746

                                                    
Query: 479      cccgaaggtgacgatgatctccatcaccacgccctc 514
                | |||| ||||  |  ||||||||||||| ||||||
Sbjct: 27568747 cgcgaacgtgatcacaatctccatcaccatgccctc 27568782



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                        
Query: 445      ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 484
                ||||| |||||||||||||||||||||| |||||||||||
Sbjct: 26354650 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 26354611



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                               
Query: 597      ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
                ||||| ||||| || ||||||||||||| ||||||||||||||||||
Sbjct: 27568948 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgat 27568994



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 465      acggtgtagacgagcccgaaggtgacgatgatctc 499
                ||||||||||||||| |||||||| ||||||||||
Sbjct: 26073342 acggtgtagacgagcacgaaggtgccgatgatctc 26073308



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 292      agatgttggtgaagtcgccgctg 314
                |||||||||||||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 465     acggtgtagacgagcccgaaggtgacgatgat 496
               ||||||||||||||  |||||||| |||||||
Sbjct: 8907189 acggtgtagacgaggacgaaggtgccgatgat 8907220



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  145 bits (73), Expect = 2e-31
 Identities = 160/189 (84%)
 Strand = Plus / Minus

                                                                       
Query: 320 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 379
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | || ||
Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| || ||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593

                                                                       
Query: 440 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 499
           |||||||||  |||| ||||||||||| ||||| || ||||||||||| |  | ||||||
Sbjct: 592 cttggggtccacggccgtggcgtacaccgtgtacaccagcccgaaggtcatcacgatctc 533

                    
Query: 500 catcaccac 508
           || ||||||
Sbjct: 532 cagcaccac 524



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Minus

                                                                       
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 504

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 503 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 444

                      
Query: 498 tccatcaccac 508
           || | ||||||
Sbjct: 443 tcgaacaccac 433



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Plus

                                                                            
Query: 318      acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
                |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863

                                                                            
Query: 378      aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
                ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 43108923

                                                                            
Query: 438      ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
                |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 43108924 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 43108983

                           
Query: 498      tccatcaccac 508
                || | ||||||
Sbjct: 43108984 tcgaacaccac 43108994



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                           
Query: 324     gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
               |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                                     
Query: 384     ttggccccgacgatgaagccga 405
               ||||| ||||||| || |||||
Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 446     gtcggcggcggtggcgtacacggtg 470
               ||||||||||| |||||||||||||
Sbjct: 8192882 gtcggcggcggcggcgtacacggtg 8192858



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Plus

                                                                          
Query: 318    acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
              |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892

                                                                          
Query: 378    aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
              ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 105952

                                                                          
Query: 438    ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
              |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 105953 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 106012

                         
Query: 498    tccatcaccac 508
              || | ||||||
Sbjct: 106013 tcgaacaccac 106023



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Minus

                                                                       
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 528

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 527 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 468

                      
Query: 498 tccatcaccac 508
           || | ||||||
Sbjct: 467 tcgaacaccac 457



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Minus

                                                                       
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 577

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 576 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 517

                      
Query: 498 tccatcaccac 508
           || | ||||||
Sbjct: 516 tcgaacaccac 506



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  141 bits (71), Expect = 3e-30
 Identities = 161/191 (84%)
 Strand = Plus / Minus

                                                                       
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 377
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||||||||||   ||||||   |||
Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 514

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||| ||  | |||||||||||||||||||||||||| |||||||| | || ||||
Sbjct: 513 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 454

                      
Query: 498 tccatcaccac 508
           || | ||||||
Sbjct: 453 tcgaacaccac 443



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  139 bits (70), Expect = 1e-29
 Identities = 127/146 (86%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||||| |||| | |||||||||||||| || |||||||||
Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           |||||||||||||||||||||||||| |||   ||||||||||||||| | |||||||||
Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgaccgcggtggcg 556

                                     
Query: 462 tacacggtgtagacgagcccgaaggt 487
           ||||| ||||| || || ||||||||
Sbjct: 555 tacacagtgtacaccagaccgaaggt 530



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  123 bits (62), Expect = 8e-25
 Identities = 125/146 (85%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           |||||||||||||||||||||||||| |||   |||||||| |||||  | || ||||||
Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 478

                                     
Query: 462 tacacggtgtagacgagcccgaaggt 487
           ||||| ||||| || |||||||||||
Sbjct: 477 tacaccgtgtacaccagcccgaaggt 452



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  119 bits (60), Expect = 1e-23
 Identities = 114/132 (86%)
 Strand = Plus / Minus

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||||||  |||| ||||||||||| ||||| ||||| |||||||| | ||  |||
Sbjct: 517 ttcttggggtccacggccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatc 458

                       
Query: 498 tccatcaccacg 509
           |||| |||||||
Sbjct: 457 tccagcaccacg 446



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  119 bits (60), Expect = 1e-23
 Identities = 114/132 (86%)
 Strand = Plus / Plus

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493

                                                                       
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 497
           |||||||||||  |||| ||||||||||| ||||| ||||| |||||||| | ||  |||
Sbjct: 494 ttcttggggtccacggccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatc 553

                       
Query: 498 tccatcaccacg 509
           |||| |||||||
Sbjct: 554 tccagcaccacg 565



to top

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 590

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 589 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 540



to top

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Plus

                                                                        
Query: 336  cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
            ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225

                                                                        
Query: 396  atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
            || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 1285

                                                              
Query: 456  gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
            |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 1286 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 1335



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                       
Query: 378 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 437
           |||||||||||||| |||||||||||||| |||||||| ||||| || || |||   |||
Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggctcccc 497

                                                             
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           ||||| |||||   ||||||||||||||||||||||||||||||||||||
Sbjct: 496 ttcttcgggtcaatggcggtggcgtacacggtgtagacgagcccgaaggt 447



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 600 aggagctgcgcaacccagtagaagaggccg 629
           ||||||||||| |||||||||| |||||||
Sbjct: 334 aggagctgcgccacccagtagaggaggccg 305



to top

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 480

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 479 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 430



to top

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 551

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 550 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 501



to top

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 528

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 527 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 478



to top

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 533

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 532 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 483



to top

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 530

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 529 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 480



to top

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 552

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 551 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 502



to top

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                         
Query: 336   cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
             ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439

                                                                         
Query: 396   atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
             || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 19379

                                                               
Query: 456   gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
             |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 19378 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 19329



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  115 bits (58), Expect = 2e-22
 Identities = 124/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           |||||||| ||||||||||||||||| |||   |||||||| |||||  | || ||||||
Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 570

                                     
Query: 462 tacacggtgtagacgagcccgaaggt 487
           ||||| ||||| || |||||||||||
Sbjct: 569 tacaccgtgtacaccagcccgaaggt 544



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745



to top

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score =  115 bits (58), Expect = 2e-22
 Identities = 142/170 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           || |  || |||||||  || |||||||| ||||| || ||||||||||| || ||||||
Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 497

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||||||| || |||||||| |   ||||||||| |||||||||||||||
Sbjct: 496 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 447



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  107 bits (54), Expect = 5e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||||| |||| | || ||||||||||| || |||||||||
Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           |||||||||||||||||||||||||| |||   |||||||| |||||  | || || |||
Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtcgcg 574

                                     
Query: 462 tacacggtgtagacgagcccgaaggt 487
           ||||| ||||| || |||||||||||
Sbjct: 573 tacaccgtgtacaccagcccgaaggt 548



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  107 bits (54), Expect = 5e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           |||||||| ||||||||||||||||| |||   |||||||| |||||  | || || |||
Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtcgcg 573

                                     
Query: 462 tacacggtgtagacgagcccgaaggt 487
           ||||| ||||| || |||||||||||
Sbjct: 572 tacaccgtgtacaccagcccgaaggt 547



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 239 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 286
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 395
           ||||| ||||||||||| || || ||||| || |||||  | ||||||||||| ||||||
Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           ||||  || ||||||| ||| |||||||| ||||| || ||||| ||||| || ||||||
Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttgggatcagcggcg 521

                                                             
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 505
           |||| ||| ||||||||||| |    ||| |||| |||||||||||||||
Sbjct: 520 gtggggtagacggtgtagactaaagagaaagtgatgatgatctccatcac 471



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 184/229 (80%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           ||||||||||||| |||  | |||||||||| || || || || || ||||| ||||| |
Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633

                                                                       
Query: 340 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 399
           | ||||||||||| || || ||||| || || ||  | | ||||||||| || || ||||
Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573

                                                                       
Query: 400 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 459
           |||||||||| ||||| || ||||| ||||| ||||||||||| ||||| || ||||| |
Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtcagctgcggttg 513

                                                            
Query: 460 cgtacacggtgtagacgagcccgaaggtgacgatgatctccatcaccac 508
           | ||||| ||||| || |   | || |||| ||||||||||||||||||
Sbjct: 512 catacactgtgtaaaccaatgcaaatgtgatgatgatctccatcaccac 464



to top

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 124/149 (83%)
 Strand = Plus / Minus

                                                                        
Query: 357  ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 416
            |||||||| || |||||  ||||||||||||| || ||||| |  || |||||||  || 
Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169

                                                                        
Query: 417  gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 476
            |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| 
Sbjct: 2168 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagacc 2109

                                         
Query: 477  agcccgaaggtgacgatgatctccatcac 505
            |   ||||||||| |||||||||||||||
Sbjct: 2108 aaagcgaaggtgatgatgatctccatcac 2080



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638

                                                         
Query: 340 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 385
           | |||||||| || || |||||||| ||||||||| | ||||||||
Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 66/73 (90%)
 Strand = Plus / Minus

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           ||||||||||||||  |||||||||||||||||||||||||||| |||||||| | || |
Sbjct: 588 cccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacg 529

                        
Query: 495 atctccatcacca 507
           ||||||| |||||
Sbjct: 528 atctccagcacca 516



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 239 gtagacgatgccggcgaggccaccgccgatg 269
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || ||||| |  |
Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 388 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 337



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 401 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 460
           ||||||||||| ||| ||||| ||||||| || ||| ||||||||||||  |||||||||
Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 557

                                      
Query: 461 gtacacggtgtagacgagcccgaaggt 487
           ||| ||||||||||| || ||||||||
Sbjct: 556 gtagacggtgtagactagtccgaaggt 530



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 238 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||||||||||| | |  | ||||  || |||||| ||||||||||||||
Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 401 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 460
           ||||||||||| ||| ||||| ||||||| || ||| ||||||||||||  |||||||||
Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 245

                                      
Query: 461 gtacacggtgtagacgagcccgaaggt 487
           ||| ||||||||||| || ||||||||
Sbjct: 244 gtagacggtgtagactagtccgaaggt 218



to top

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 321 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 380
           ||||| ||||||||||| || ||||||||||| || || ||||| ||||||||  | | |
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637

                                                                       
Query: 381 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 440
           |||||||| || || ||||| || || || |||||||| |||||||| |  || ||| ||
Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577

                                              
Query: 441 ttggggtcggcggcggtggcgtacacggtgtagac 475
           ||||||||  | ||||||||||| |||||||||||
Sbjct: 576 ttggggtcaactgcggtggcgtagacggtgtagac 542



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596

                                                         
Query: 340 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 385
           | |||||||| || || |||||||| ||||| ||| | ||||||||
Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                          
Query: 376    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
              ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| ||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684

                                                                          
Query: 436    ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 495
              | ||||| || || || || |||||||| ||||||||||| |   | ||||| |||||||
Sbjct: 123683 ctttctttggatcagcagctgtggcgtaaacggtgtagaccaaagcaaaggtcacgatga 123624

                        
Query: 496    tctccatcac 505
              ||||||||||
Sbjct: 123623 tctccatcac 123614



to top

>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 417 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 476
           |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| 
Sbjct: 573 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagacc 514

                                        
Query: 477 agcccgaaggtgacgatgatctccatcac 505
           |   ||||||||| |||||||||||||||
Sbjct: 513 aaagcgaaggtgatgatgatctccatcac 485



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| || || |||||||||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230

                                                                       
Query: 440 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 499
           ||| ||||| || ||||| || ||||| ||||| || |   | || |||| |||||||||
Sbjct: 229 ctttgggtcagctgcggttgcatacactgtgtaaaccaatgcaaatgtgatgatgatctc 170

                    
Query: 500 catcaccac 508
           |||||||||
Sbjct: 169 catcaccac 161



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538

                                                   
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagac 475
           | ||||| || || || || |||||||| |||||||||||
Sbjct: 537 ctttctttggatcagctgctgtggcgtaaacggtgtagac 498



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 680 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 621

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 620 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 569



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500

                                                   
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagac 475
           | ||||| || || || || |||||||| |||||||||||
Sbjct: 499 ctttctttggatcagctgctgtggcgtaaacggtgtagac 460



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528

                                                   
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagac 475
           | ||||| || || || || |||||||| |||||||||||
Sbjct: 527 ctttctttggatcagctgctgtggcgtaaacggtgtagac 488



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 568 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 509

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 508 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 457



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 630 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 571

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 570 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 519



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 635 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 576

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 575 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 524



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 642 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 583

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 582 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 531



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 618 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 559

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 558 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 507



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 607 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 548

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 547 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 496



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 625 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 566

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 565 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 514



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 439 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 380

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 379 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 328



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Plus

                                                                         
Query: 376   cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
             |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 15558 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 15617

                                                                 
Query: 436   ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
             | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 15618 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 15669



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                        
Query: 376  cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
            ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706

                                                    
Query: 436  ccttcttggggtcggcggcggtggcgtacacggtgtagac 475
            | ||||| || || || || |||||||| |||||||||||
Sbjct: 8707 ctttctttggatcagctgctgtggcgtaaacggtgtagac 8746



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 577 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 518

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 517 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 466



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || ||||| || || ||||| || |||||    |
Sbjct: 638 cgaggatgttagctccaacgatgaaacctatggcaattggtgcgattgttccgagactac 579

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||| |||| |||||||| |||||||||||||||||||||||
Sbjct: 578 cgttcttggggtcgacggctgtggcgtaaacggtgtagacgagcccgaaggt 527



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 93/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||  |||||||| |||||||||||||||||||||||
Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggt 71



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 93/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| |  |||||||| || |||||  |||||||    |
Sbjct: 604 cgaggatgttcgctccaacgatgaaacttatggcgattggtgcgattttgccgagaatac 545

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 544 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 493



to top

>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds
          Length = 992

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 324 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
           ||||||||||| || || |||||||| || || |||  ||| ||||| ||| | |  |||
Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580

                                                                       
Query: 384 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 443
           ||||| || |||||||| || ||||| ||||| || |||||||| || || ||||| |||
Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520

                                           
Query: 444 gggtcggcggcggtggcgtacacggtgtagac 475
           || || ||||| |||||||| |||||||||||
Sbjct: 519 ggatccgcggctgtggcgtaaacggtgtagac 488



to top

>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1014

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 546 ttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 497



to top

>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 921

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 438 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           |||||||||||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 554 ttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 90/109 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 ggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccct 438
           ||||||| || || |||||||| || |||||||| || ||||| || |||||    || |
Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554

                                                            
Query: 439 tcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           ||||||||||  |||| |||||||| |||||| ||||||||||||||||
Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggt 505



to top

>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds
          Length = 1049

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 180/229 (78%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           |||||||||||||| ||| |  |||||| |||||  | || || || ||||| ||||| |
Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677

                                                                       
Query: 340 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 399
           | |||| |||||| || || ||||| ||||| ||| | |  |||||||| || || ||||
Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617

                                                                       
Query: 400 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 459
           | || ||||| ||||| || |||||||| || ||||| ||||||||||| || ||||| |
Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtcagctgcggttg 557

                                                            
Query: 460 cgtacacggtgtagacgagcccgaaggtgacgatgatctccatcaccac 508
           | || || |||||||| |   | || |||| |||||||||||| |||||
Sbjct: 556 catatactgtgtagaccaaagcaaatgtgatgatgatctccataaccac 508



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 445 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 484
           ||||| |||||||||||||||||||||| |||||||||||
Sbjct: 517 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 478



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                      
Query: 445    ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 484
              ||||| |||||||||||||||||||||| |||||||||||
Sbjct: 131227 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 131188



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 445 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 484
           ||||| |||||||||||||||||||||| |||||||||||
Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 544



to top

>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2)
           mRNA, complete cds
          Length = 1035

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 92/112 (82%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||     
Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562

                                                               
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           | |||||||| ||  |||| |||||||| |||||||||||||||||||||||
Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacgagcccgaaggt 510



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                       
Query: 261 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 320
           |||||||  |||||||||  |||||||| ||||  ||| ||  |||| ||| |||| | |
Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766

                                                                       
Query: 321 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 380
           || |||||||| |||||||| |||||||||||  |||||| ||||  |||| |  |||||
Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706

                              
Query: 381 atgttggccccgacgatga 399
            ||||||| ||||||||||
Sbjct: 705 ctgttggcgccgacgatga 687



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 324 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                                 
Query: 384 ttggccccgacgatgaagccga 405
           ||||| ||||||| || |||||
Sbjct: 548 ttggcgccgacgacgaggccga 527



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 440
           |||||||| ||||||||||| ||||| || ||||| |||||||| || |     ||||||
Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggttccaatatcccccttc 521

                                                     
Query: 441 ttggggtcggcggcggtggcgtacacggtgtagacgagcccg 482
           ||||| ||| | || || |||||||| |||||||||||||||
Sbjct: 520 ttgggatcgacagcagtagcgtacacagtgtagacgagcccg 479



to top

>emb|AJ843991.1| Plantago major partial mRNA for aquaporin 1 (aqp1 gene)
          Length = 871

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 144/182 (79%)
 Strand = Plus / Minus

                                                                       
Query: 324 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
           ||||||||||| || || ||||||||||| || ||   ||| ||||||||| | |  |||
Sbjct: 565 gggccgaatgatcgggctgggttcatggatccaccactgaatgggccggcagccaaaatg 506

                                                                       
Query: 384 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 443
           ||||| || || ||||| || || || || ||||| || || || || || |||||||||
Sbjct: 505 ttggctccaacaatgaatccaattgccattggggcaattgttccaagtgaacccttcttg 446

                                                                       
Query: 444 gggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatc 503
           ||||| || || ||||| ||||| |||||||| ||  | ||||||| |||||| ||||||
Sbjct: 445 gggtcagctgctgtggcatacacagtgtagactagggcaaaggtgatgatgatttccatc 386

             
Query: 504 ac 505
           ||
Sbjct: 385 ac 384



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 609 gcaacccagtagaagaggccggtgaggatggtgat 643
           |||| ||||||||||||||| |||| |||||||||
Sbjct: 274 gcaatccagtagaagaggccagtgatgatggtgat 240



to top

>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds
          Length = 1072

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 276 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 335
           ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| 
Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660

                                                 
Query: 336 cgtgcagggttcatggaaccgccggagaaggggccggc 373
           || || || ||||| || || |||||||| ||||||||
Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 324   gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
             |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                                   
Query: 384   ttggccccgacgatgaagccga 405
             ||||| ||||||| || |||||
Sbjct: 98841 ttggcgccgacgacgaggccga 98820



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 324 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 383
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                                 
Query: 384 ttggccccgacgatgaagccga 405
           ||||| ||||||| || |||||
Sbjct: 551 ttggcgccgacgacgaggccga 530



to top

>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI)
           mRNA, complete cds
          Length = 1035

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           ||||||||||||||  | || |||||||| ||||||||||| |||||||||||
Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggt 524



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| |||||||| |||||||||||||| || || || ||||| |  |  |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                                            
Query: 440 cttggggtcggcggcggtggcgtacacggtgta 472
           |||||||||    ||||||||||| ||||||||
Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgta 229



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| |||||||||||
Sbjct: 633 acggtgtagacgagcacgaaggtgccgatgatctcc 598



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| |||||||||||
Sbjct: 557 acggtgtagacgagcacgaaggtgccgatgatctcc 522



to top

>emb|Z48232.1|PCRB7PRJ P.crispum mRNA for membrane intrinsic protein
          Length = 954

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 396 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 455
           |||||||| || || ||||| || ||||| || || || |||||||||||||| || || 
Sbjct: 586 atgaagccaattgcaatgggtgcaatggttccaagtgagcccttcttggggtctgcagca 527

                                                       
Query: 456 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 499
           |||||||| | ||||||||| ||  | ||||||| |||||||||
Sbjct: 526 gtggcgtagaaggtgtagaccagagcaaaggtgatgatgatctc 483



to top

>gb|DQ442393.1| Striga asiatica clone St461 aquaporin mRNA, partial cds
          Length = 493

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 84/100 (84%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 584 gccgacgatggcaccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 643
           |||||||| ||| || || ||||| |||| ||||||||| |  |||||||||||||||||
Sbjct: 366 gccgacgacggcgcccagaagctgggcaatccagtagaatattccggtgaggatggtgat 307

                                                   
Query: 644 cttgaccgccgagcgcgagccc-aaggtgacggcagggtt 682
            ||| ||||| | ||| ||||| ||||||||||| |||||
Sbjct: 306 -ttggccgcccaccgccagcccaaaggtgacggccgggtt 268



to top

>gb|AC183495.1| Brassica oleracea Contig A, complete sequence
          Length = 356505

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 82/100 (82%)
 Strand = Plus / Minus

                                                                          
Query: 376    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
              ||||||| ||||| || |||||||| || || ||||| || || ||||| ||||| ||||
Sbjct: 101446 cgaggatattggcaccaacgatgaaaccaatagcgatcggagcaatggttccgagcgatc 101387

                                                      
Query: 436    ccttcttggggtcggcggcggtggcgtacacggtgtagac 475
              |||| || || || || ||||||||||| ||||| |||||
Sbjct: 101386 ccttttttggatcagcagcggtggcgtaaacggtatagac 101347



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 321 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 380
           ||||||||||| ||||| || |||||||||||  ||||||||||||| ||| |  |||| 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 381 atgttggccccgacga 396
           | |||||| |||||||
Sbjct: 648 acgttggcgccgacga 633



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| |||||||||||
Sbjct: 612 acggtgtagacgagcacgaaggtgccgatgatctcc 577



to top

>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS51ZB01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 676

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || | |||||| || ||||| || |||||    |
Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178

                                                           
Query: 436 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccga 483
           | |||||||||||  |||| |||||||  |||||||||||||||||||
Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccga 130



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 465   acggtgtagacgagcccgaaggtgacgatgatctcc 500
             ||||||||||||||| |||||||| |||||||||||
Sbjct: 82504 acggtgtagacgagcacgaaggtgccgatgatctcc 82469



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| |||||||||||
Sbjct: 633 acggtgtagacgagcacgaaggtgccgatgatctcc 598



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| || |||||||| || ||||| || ||||| ||| | ||||||   ||  |
Sbjct: 612 gatgttggctccaacgatgaaaccaatggcaattggggcaatgattccgaggttgcctct 553

                                                           
Query: 440 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           |||| |||||  ||| |||||||||||||||||||| || ||||||||
Sbjct: 552 cttgtggtcgatggccgtggcgtacacggtgtagaccaggccgaaggt 505



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           ||||| |||||||| |||||||||||||||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 380 gatgttggccccgacgatgaagccgatggcgatggg 415
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 384 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 443
           ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || 
Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258

                                           
Query: 444 gggtcggcggcggtggcgtacacggtgtagac 475
           ||||| || || || ||||| || ||||||||
Sbjct: 257 gggtcagctgcagtcgcgtaaactgtgtagac 226



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 678 acggtgtagacgagcacgaaggtgccgatgatctc 644



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 679 acggtgtagacgagcacgaaggtgccgatgatctc 645



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 569 acggtgtagacgagcacgaaggtgccgatgatctc 535



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 622 acggtgtagacgagcacgaaggtgccgatgatctc 588



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 570 acggtgtagacgagcacgaaggtgccgatgatctc 536



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 221 acggtgtagacgagcacgaaggtgccgatgatctc 187



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 465      acggtgtagacgagcccgaaggtgacgatgatctc 499
                ||||||||||||||| |||||||| ||||||||||
Sbjct: 15353540 acggtgtagacgagcacgaaggtgccgatgatctc 15353506



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 622      agaggccggtgaggatggtgat 643
                ||||||||||||||||||||||
Sbjct: 19919781 agaggccggtgaggatggtgat 19919802



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 643 acggtgtagacgagcacgaaggtgccgatgatctc 609



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 641 acggtgtagacgagcacgaaggtgccgatgatctc 607



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 639 acggtgtagacgagcacgaaggtgccgatgatctc 605



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 242 acggtgtagacgagcacgaaggtgccgatgatctc 208



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 465   acggtgtagacgagcccgaaggtgacgatgatctc 499
             ||||||||||||||| |||||||| ||||||||||
Sbjct: 60539 acggtgtagacgagcacgaaggtgccgatgatctc 60505



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 465    acggtgtagacgagcccgaaggtgacgatgatctc 499
              ||||||||||||||| |||||||| ||||||||||
Sbjct: 139553 acggtgtagacgagcacgaaggtgccgatgatctc 139519



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 270 acggtgtagacgagcacgaaggtgccgatgatctc 236



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 678 acggtgtagacgagcacgaaggtgccgatgatctc 644



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 679 acggtgtagacgagcacgaaggtgccgatgatctc 645



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 666 acggtgtagacgagcacgaaggtgccgatgatctc 632



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||| ||||||||||
Sbjct: 71  acggtgtagacgagcacgaaggtgccgatgatctc 37



to top

>gb|AF133533.1|AF133533 Mesembryanthemum crystallinum water channel protein MipL (MipL)
           mRNA, partial cds
          Length = 768

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 435 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 494
           |||||||| ||||| || |||||||| || ||||||||||| ||  | ||||||| || |
Sbjct: 368 cccttctttgggtcagctgcggtggcatagacggtgtagacaagtgcaaaggtgatgacg 309

                      
Query: 495 atctccatcac 505
           |||||||||||
Sbjct: 308 atctccatcac 298



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 609 gcaacccagtagaagaggccggtgaggatggtgat 643
           ||||||||||||| |||||| ||||||| ||||||
Sbjct: 188 gcaacccagtagatgaggccagtgaggacggtgat 154



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 465    acggtgtagacgagcccgaaggtgacgatgatctc 499
              ||||||||||||||| |||||||| ||||||||||
Sbjct: 107669 acggtgtagacgagcacgaaggtgccgatgatctc 107635



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 390 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 448
           ||||||||||||||||||||||  || || ||||| ||||  || ||||||||||||||
Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253



to top

>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340
           (DELTA-TIP2/TIP2;2) mRNA, complete cds
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 598 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 539

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 538 tagactgtgtagac 525



to top

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                         
Query: 342   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802

                                                                         
Query: 402   ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
             ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 64801 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 64742

                           
Query: 462   tacacggtgtagac 475
             || || ||||||||
Sbjct: 64741 tagactgtgtagac 64728



to top

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                         
Query: 342   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167

                                                                         
Query: 402   ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
             ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 54166 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 54107

                           
Query: 462   tacacggtgtagac 475
             || || ||||||||
Sbjct: 54106 tagactgtgtagac 54093



to top

>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 533 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 474

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 473 tagactgtgtagac 460



to top

>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 595 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 536

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 535 tagactgtgtagac 522



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 94/114 (82%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 376 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 435
           |||||||||| || || |||||||| || |||||||| || ||||| || |||||    |
Sbjct: 143 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 84

                                                                 
Query: 436 ccttcttggggtcggcgg-cggtggcgtacacgg-tgtagacgagcccgaaggt 487
           | |||||||||||  ||| | |||||||| |||| |||||||||||||||||||
Sbjct: 83  cgttcttggggtcaacgggctgtggcgtagacgggtgtagacgagcccgaaggt 30



to top

>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 954

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 581 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 522

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 521 tagactgtgtagac 508



to top

>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 556 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 497

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 496 tagactgtgtagac 483



to top

>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1,
           complete cds
          Length = 1001

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 158/202 (78%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           ||||||||||||||  |||||||||||| |||    |  |||| ||||||||||| || |
Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648

                                                                       
Query: 340 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 399
           | |||||||| ||||||||    || ||||||||| | | ||||||||| || || ||||
Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588

                                                                       
Query: 400 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 459
           |||| || || ||||| || ||  |||| |  |||||||| |||||||| || || ||||
Sbjct: 587 agcctattgcaatgggtgcaataatgcccaatgatccctttttggggtcagcagctgtgg 528

                                 
Query: 460 cgtacacggtgtagacgagccc 481
           | || || ||||| || |||||
Sbjct: 527 cataaacagtgtatacaagccc 506



to top

>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence
          Length = 969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                       
Query: 342 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 401
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600

                                                                       
Query: 402 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 461
           ||||| || || || || ||||| ||||| || || ||||| || || || || ||||||
Sbjct: 599 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 540

                         
Query: 462 tacacggtgtagac 475
           || || ||||||||
Sbjct: 539 tagactgtgtagac 526



to top

>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip
           gene)
          Length = 1101

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 51/57 (89%), Gaps = 2/57 (3%)
 Strand = Plus / Minus

                                                                    
Query: 627 ccggtgaggatggtgatcttgaccgccgagcg-cgagcccaaggtgacggcagggtt 682
           ||||||||||||||||| |||||||||||| | | |||| ||||||||||| |||||
Sbjct: 404 ccggtgaggatggtgat-ttgaccgccgagggccaagccgaaggtgacggcggggtt 349



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 324 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 373
           ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| ||| |||||||
Sbjct: 662 acggtgtagacgagcacgaaggtgccgacgatctcc 627



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           ||||| ||||| || |||||||||||||||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 87/108 (80%)
 Strand = Plus / Minus

                                                                       
Query: 380 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 439
           ||||||||| || || ||||| ||||| |||||||| || || || || ||   ||| ||
Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538

                                                           
Query: 440 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 487
           |||||| ||  ||||||||||||| || ||||| || |||||||||||
Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggt 490



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 301 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 352
           |||||| ||||||| | ||||| |||||||| ||||| || |||||||||||
Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| ||| |||||||
Sbjct: 653 acggtgtagacgagcacgaaggtgccgacgatctcc 618



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 468 gtgtagacgagcccgaaggtgacgatgatctc 499
           |||||||||||| |||||||| ||||||||||
Sbjct: 692 gtgtagacgagcacgaaggtgccgatgatctc 661



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctcc 500
           ||||||||||||||| |||||||| ||| |||||||
Sbjct: 86  acggtgtagacgagcacgaaggtgccgacgatctcc 51



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 468 gtgtagacgagcccgaaggtgacgatgatctc 499
           |||||||||||| |||||||| ||||||||||
Sbjct: 612 gtgtagacgagcacgaaggtgccgatgatctc 581



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 385     tggccccgacgatgaagccgatggcgatgggggcga 420
               |||| ||||||||||||||| || ||||||||||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 644     cttgaccgccgagcgcgagc 663
               ||||||||||||||||||||
Sbjct: 2919155 cttgaccgccgagcgcgagc 2919136



to top

>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 292 agatgttggtgaagtcgccgctg 314
           |||||||||||||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||| ||| ||||||||||
Sbjct: 661 acggtgtagacgagcacgaacgtgccgatgatctc 627



to top

>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 292   agatgttggtgaagtcgccgctg 314
             |||||||||||||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||  |||||||| ||||||||||
Sbjct: 651 acggtgtagacgaggacgaaggtgccgatgatctc 617



to top

>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 292    agatgttggtgaagtcgccgctg 314
              |||||||||||||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||  |||||||| ||||||||||
Sbjct: 368 acggtgtagacgaggacgaaggtgccgatgatctc 334



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 248    gccggcgaggccaccgccgatga 270
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 248     gccggcgaggccaccgccga 267
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 638     ggtgatcttgaccgccgagcgcga 661
               |||||||| |||||||||||||||
Sbjct: 1044064 ggtgatctggaccgccgagcgcga 1044087



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||||||  ||||||||||
Sbjct: 653 acggtgtagacgagcacgaaggtaccgatgatctc 619



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||| |||| ||| ||||||||||
Sbjct: 653 acggtgtagacgagcacgaacgtgccgatgatctc 619



to top

>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 292 agatgttggtgaagtcgccgctg 314
           |||||||||||||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||  |||||||| ||||||||||
Sbjct: 663 acggtgtagacgaggacgaaggtgccgatgatctc 629



to top

>gb|AY902360.1| Triticum aestivum water channel protein PIP4 (AQP) gene, partial
           sequence
          Length = 645

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 465 acggtgtagacgagcccgaaggtgacgatgatctc 499
           ||||||||||||||  |||||||| ||||||||||
Sbjct: 233 acggtgtagacgaggacgaaggtgccgatgatctc 267



to top

>ref|NM_187411.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 921

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 622 agaggccggtgaggatggtgat 643
           ||||||||||||||||||||||
Sbjct: 457 agaggccggtgaggatggtgat 436



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 320 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 365
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 320 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 365
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528



to top

>dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0036M16
          Length = 158880

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 622   agaggccggtgaggatggtgat 643
             ||||||||||||||||||||||
Sbjct: 84431 agaggccggtgaggatggtgat 84452



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 380 gatgttggccccgacgatgaagccgatggc 409
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 380 gatgttggccccgacgatgaagccgatggc 409
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>ref|NM_188789.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 639

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 446 gtcggcggcggtggcgtacacggtg 470
           ||||||||||| |||||||||||||
Sbjct: 342 gtcggcggcggcggcgtacacggtg 318



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 586 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
           |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 512 cgacgacggcgccgaggagctgggcgagccagtagaagagg 472



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 249 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||  |||||||||| ||| || ||||||||||||| ||||
Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661



to top

>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaac 354
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577



to top

>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaac 354
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577



to top

>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 321 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 365
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 586   cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
             |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 26536 cgacgacggcgccgaggagctgggcgagccagtagaagagg 26576



to top

>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence
          Length = 182756

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 446    gtcggcggcggtggcgtacacggtg 470
              ||||||||||| |||||||||||||
Sbjct: 157003 gtcggcggcggcggcgtacacggtg 156979



to top

>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein
           mRNA, partial cds
          Length = 770

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425

                                    
Query: 340 cagggttcatggaaccgccggagaa 364
           |||||||||| || ||||| |||||
Sbjct: 424 cagggttcattgagccgccagagaa 400



to top

>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA,
           partial cds
          Length = 684

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 280 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 339
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338

                                    
Query: 340 cagggttcatggaaccgccggagaa 364
           |||||||||| || ||||| |||||
Sbjct: 337 cagggttcattgagccgccagagaa 313



to top

>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein
          Length = 991

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 273 gggccggcccagtagatccag 293
           |||||||||||||||||||||
Sbjct: 655 gggccggcccagtagatccag 635



to top

>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7
          Length = 349213

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 436    ccttcttggggtcggcggcgg 456
              |||||||||||||||||||||
Sbjct: 320884 ccttcttggggtcggcggcgg 320864



to top

>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230090D02 product:aquaporin 6,
           full insert sequence
          Length = 2066

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaac 354
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                         
Query: 586      cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
                |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 18186592 cgacgacggcgccgaggagctgggcgagccagtagaagagg 18186552



to top

>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0034C11
          Length = 139399

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 446    gtcggcggcggtggcgtacacggtg 470
              ||||||||||| |||||||||||||
Sbjct: 110600 gtcggcggcggcggcgtacacggtg 110576



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 465 acggtgtagacgagcccgaaggtg-acgatgatctcc 500
           ||||||||||||||| ||||||||  |||||||||||
Sbjct: 643 acggtgtagacgagcacgaaggtgcccgatgatctcc 607



to top

>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene)
          Length = 535

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 321 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 365
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 586 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
           |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 521 cgacgacggcgccgaggagctgggcgagccagtagaagagg 481



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 586 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
           |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 504 cgacgacggcgccgaggagctgggcgagccagtagaagagg 464



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 586 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
           |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 567 cgacgacggcgccgaggagctgggcgagccagtagaagagg 607



to top

>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence
          Length = 2291

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 321  gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 365
            ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                         
Query: 586      cgacgatggcaccgaggagctgcgcaacccagtagaagagg 626
                |||||| ||| ||||||||||| || | |||||||||||||
Sbjct: 18195845 cgacgacggcgccgaggagctgggcgagccagtagaagagg 18195805



to top

>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 318   acggcggggccgaatgagcgtgcagggttcatggaac 354
             ||||| |||||||| ||||| || |||||||||||||
Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581



to top

>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 2066

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 318 acggcggggccgaatgagcgtgcagggttcatggaac 354
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578



to top

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712



to top

>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07,
             complete sequence
          Length = 146712

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 443   ggggtcggcggcggtggcgt 462
             ||||||||||||||||||||
Sbjct: 72271 ggggtcggcggcggtggcgt 72290



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 465 acggtgtagacgagcccgaaggtgacgatgat 496
           ||||||||||||||  |||||||| |||||||
Sbjct: 539 acggtgtagacgaggacgaaggtgccgatgat 508



to top

>gb|DQ164589.1| Hepatitis C virus isolate BE00-17-3630 polyprotein gene, partial
           cds
          Length = 543

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 619 agaagaggccggtgaggatg 638
           ||||||||||||||||||||
Sbjct: 479 agaagaggccggtgaggatg 460



to top

>gb|DQ164581.1| Hepatitis C virus isolate BE01-17-3630 polyprotein gene, partial
           cds
          Length = 543

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 619 agaagaggccggtgaggatg 638
           ||||||||||||||||||||
Sbjct: 479 agaagaggccggtgaggatg 460



to top

>gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_B11,
              complete sequence
          Length = 162772

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 443    ggggtcggcggcggtggcgt 462
              ||||||||||||||||||||
Sbjct: 152085 ggggtcggcggcggtggcgt 152104



to top

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 140    ggcatcatggaaaccaaaca 159
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824



to top

>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507837.100) partial mRNA
          Length = 4953

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 401  gccgatggcgatgggggcgatggt 424
            ||||||| ||||||||||||||||
Sbjct: 4372 gccgatgacgatgggggcgatggt 4395



to top

>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence
          Length = 138303

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 324   gggccgaatgagcgtgcagggttcatggaacc 355
             |||||||||||||| || |||||||| |||||
Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 579     aaggcgccgacgatggcacc 598
               ||||||||||||||||||||
Sbjct: 3143181 aaggcgccgacgatggcacc 3143162



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 638     ggtgatcttgaccgccgagcgcga 661
               |||||||| |||||||||||||||
Sbjct: 1156502 ggtgatctggaccgccgagcgcga 1156525



to top

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 258  ccaccgccgatgagcgggccggcccagtagatccag 293
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097



to top

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648



to top

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706



to top

>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene
          Length = 993

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690



to top

>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12
          Length = 349672

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 444    gggtcggcggcggtggcgta 463
              ||||||||||||||||||||
Sbjct: 330461 gggtcggcggcggtggcgta 330480



to top

>emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genome; segment 16/16
          Length = 227214

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 638   ggtgatcttgaccgccgagcgcga 661
             |||||||| |||||||||||||||
Sbjct: 38898 ggtgatctggaccgccgagcgcga 38875



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 465   acggtgtagacgagcccgaaggtgacgatgat 496
             ||||||||||||||  |||||||| |||||||
Sbjct: 91498 acggtgtagacgaggacgaaggtgccgatgat 91529



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 646     tgaccgccgagcgcgagcccaagg 669
               |||||||||||| |||||||||||
Sbjct: 5031703 tgaccgccgagctcgagcccaagg 5031680



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 248     gccggcgaggccaccgccga 267
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040



to top

>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 258  ccaccgccgatgagcgggccggcccagtagatccag 293
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 250     cggcgaggccaccgccgatg 269
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 646    tgaccgccgagcgcgagccc 665
              ||||||||||||||||||||
Sbjct: 172699 tgaccgccgagcgcgagccc 172718



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 443      ggggtcggcggcggtggcgt 462
                ||||||||||||||||||||
Sbjct: 12938957 ggggtcggcggcggtggcgt 12938938



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 437      cttcttggggtcggcggcgg 456
                ||||||||||||||||||||
Sbjct: 10869674 cttcttggggtcggcggcgg 10869655



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 443      ggggtcggcggcggtggcgt 462
                ||||||||||||||||||||
Sbjct: 25209430 ggggtcggcggcggtggcgt 25209449



to top

>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 996

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687



to top

>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 258 ccaccgccgatgagcgggccggcccagtagatccag 293
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,389,979
Number of Sequences: 3902068
Number of extensions: 4389979
Number of successful extensions: 98519
Number of sequences better than 10.0: 274
Number of HSP's better than 10.0 without gapping: 278
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95319
Number of HSP's gapped (non-prelim): 3153
length of query: 682
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 659
effective length of database: 17,143,297,704
effective search space: 11297433186936
effective search space used: 11297433186936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top