ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaal1p13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 498 e-137
2gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 452 e-124
3gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 428 e-117
4gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 418 e-114
5dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 410 e-111
6dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 408 e-111
7dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 408 e-111
8gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 408 e-111
9ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 402 e-109
10emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 398 e-108
11ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 392 e-106
12gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 392 e-106
13dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
14dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
15ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 387 e-104
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 387 e-104
17dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 387 e-104
18dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 387 e-104
19gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 377 e-101
20emb|X00937.1|TAHI02 Wheat histone H3 gene 371 2e-99
21gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 369 6e-99
22emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 369 6e-99
23gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 365 1e-97
24ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 355 1e-94
25dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 355 1e-94
26emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 355 1e-94
27gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 355 1e-94
28gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 339 6e-90
29gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 339 6e-90
30emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 339 6e-90
31dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 339 6e-90
32gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 339 6e-90
33gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 339 6e-90
34ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 337 2e-89
35ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 337 2e-89
36emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 337 2e-89
37dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 337 2e-89
38dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 337 2e-89
39ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 331 1e-87
40gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 331 1e-87
41emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 331 1e-87
42ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 323 3e-85
43emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 323 3e-85
44gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 321 1e-84
45gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 321 1e-84
46gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 321 1e-84
47gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 321 1e-84
48ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 315 8e-83
49gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 315 8e-83
50gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 315 8e-83
51ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 307 2e-80
52ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 307 2e-80
53ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 307 2e-80
54ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 307 2e-80
55ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 307 2e-80
56ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 307 2e-80
57ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 307 2e-80
58ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 307 2e-80
59ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 307 2e-80
60emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 307 2e-80
61emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 307 2e-80
62emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 307 2e-80
63gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 307 2e-80
64emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 307 2e-80
65gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 307 2e-80
66gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 307 2e-80
67gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 307 2e-80
68ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA 299 5e-78
69ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 299 5e-78
70ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 299 5e-78
71ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 299 5e-78
72ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 299 5e-78
73ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 299 5e-78
74emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 299 5e-78
75emb|X80326.1|MPMPH312 M.pahari mpH312 gene 299 5e-78
76gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl... 299 5e-78
77emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 299 5e-78
78gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 299 5e-78
79gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 299 5e-78
80gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds 299 5e-78
81ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 293 3e-76
82ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a... 291 1e-75
83ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a... 291 1e-75
84ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 291 1e-75
85emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA 291 1e-75
86emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 291 1e-75
87dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 291 1e-75
88gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 291 1e-75
89gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 291 1e-75
90gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 291 1e-75
91gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 291 1e-75
92emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 289 5e-75
93emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 289 5e-75
94gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 289 5e-75
95gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 289 5e-75
96gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 285 7e-74
97ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 283 3e-73
98ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 283 3e-73
99ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 283 3e-73
100ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a... 283 3e-73
101ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 283 3e-73
102gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 283 3e-73
103gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 283 3e-73
104emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 283 3e-73
105emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 283 3e-73
106gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 283 3e-73
107gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 283 3e-73
108dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 283 3e-73
109gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 283 3e-73
110dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 283 3e-73
111gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 283 3e-73
112gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 283 3e-73
113gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 283 3e-73
114ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 281 1e-72
115gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 281 1e-72
116ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 281 1e-72
117dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 281 1e-72
118gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 281 1e-72
119ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 281 1e-72
120gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 281 1e-72
121gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 281 1e-72
122gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 281 1e-72
123gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 281 1e-72
124gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 281 1e-72
125gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 281 1e-72
126ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 281 1e-72
127gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 281 1e-72
128gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 278 2e-71
129gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 276 7e-71
130ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a... 276 7e-71
131ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a... 276 7e-71
132ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a... 276 7e-71
133ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 276 7e-71
134ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 276 7e-71
135ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 276 7e-71
136ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 276 7e-71
137emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 276 7e-71
138ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr... 276 7e-71
139ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 274 3e-70
140gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 274 3e-70
141gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 274 3e-70
142gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 274 3e-70
143emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 272 1e-69
144gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 270 4e-69
145emb|X80325.1|MPMPH315 M.pahari mpH315 gene 270 4e-69
146gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 268 2e-68
147dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 268 2e-68
148dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe... 268 2e-68
149gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 268 2e-68
150gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 268 2e-68
151ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 268 2e-68
152gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 260 4e-66
153gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 260 4e-66
154gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti... 260 4e-66
155gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds 258 2e-65
156gb|AY125229.1| Argia vivida histone 3 gene, partial cds 252 1e-63
157gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds 250 4e-63
158gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ... 250 4e-63
159gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par... 248 2e-62
160gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, ... 244 3e-61
161gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 244 3e-61
162gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti... 244 3e-61
163gb|AY655588.1| Menidia menidia histone H3a gene, partial cds 242 1e-60
164emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 242 1e-60
165gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds 242 1e-60
166gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds 240 4e-60
167gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds 238 2e-59
168gb|AY662887.1| Cymatogaster aggregata histone H3a gene, partial cds 238 2e-59
169gb|AY539178.1| Menidia menidia histone H3 gene, partial cds 238 2e-59
170gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, parti... 238 2e-59
171gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, par... 236 6e-59
172gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partia... 234 2e-58
173gb|DQ028079.1| Velifer hypselopterus histone H3 gene, partial cds 234 2e-58
174gb|AY539186.1| Sebastes matsubarae histone H3 gene, partial cds 234 2e-58
175gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds 232 1e-57
176gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 232 1e-57
177gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 232 1e-57
178gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 232 1e-57
179gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 232 1e-57
180gb|AY662881.1| Polycentropsis abbreviata histone H3a gene, parti... 232 1e-57
181gb|AY655591.1| Cololabis saira histone H3a gene, partial cds 230 4e-57
182gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 230 4e-57
183gb|AY662930.1| Crenicichla alta histone H3a gene, partial cds 230 4e-57
184gb|AY539263.1| Etheostoma blennioides histone H3 gene, partial cds 230 4e-57
185gb|AY520695.1| Semibalanus cariosus histone H3 gene, partial cds 228 2e-56
186gb|AY520703.1| Elminius modestus histone H3 gene, partial cds 226 6e-56
187gb|AY520694.1| Semibalanus balanoides histone H3 gene, partial cds 226 6e-56
188gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g... 226 6e-56
189gb|AY539273.1| Gymnodraco acuticeps histone H3 gene, partial cds 226 6e-56
190gb|AY655592.1| Fundulus heteroclitus histone H3a-like gene, part... 224 2e-55
191gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,... 224 2e-55
192gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 224 2e-55
193gb|DQ284349.1| Nyctibates corrugatus histone H3a gene, partial cds 222 9e-55
194gb|DQ284348.1| Cardioglossa leucomystax histone H3a gene, partia... 222 9e-55
195gb|DQ284213.1| Cardioglossa gratiosa histone H3a gene, partial cds 222 9e-55
196gb|DQ284132.1| Cardioglossa leucomystax histone H3a gene, partia... 222 9e-55
197gb|DQ284131.1| Schoutedenella sylvatica histone H3a gene, partia... 222 9e-55
198gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial... 222 9e-55
199gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds 222 9e-55
200gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p... 222 9e-55
201gb|AY539272.1| Harpagifer kerguelensis histone H3 gene, partial cds 222 9e-55
202gb|AY539253.1| Careproctus melanurus histone H3 gene, partial cds 222 9e-55
203gb|AY539248.1| Cottunculus thomsonii histone H3 gene, partial cds 222 9e-55
204gb|AY539247.1| Xeneretmus latifrons histone H3 gene, partial cds 222 9e-55
205gb|AY539244.1| Nautichthys pribilovius histone H3 gene, partial cds 222 9e-55
206gb|AY539215.1| Bembras japonica histone H3 gene, partial cds 222 9e-55
207gb|AY539176.1| Chilara taylori histone H3 gene, partial cds 222 9e-55
208gb|DQ028083.1| Lota lota histone H3 gene, partial cds 220 4e-54
209gb|AY520705.1| Tetraclitella divisa histone H3 gene, partial cds 220 4e-54
210gb|AF370818.1|AF370818 Balanus balanus histone H3 gene, partial cds 220 4e-54
211gb|AY662875.1| Badis badis histone H3a gene, partial cds 220 4e-54
212gb|AY539246.1| Sarritor frenatus histone H3 gene, partial cds 220 4e-54
213gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ... 220 4e-54
214gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 220 4e-54
215gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene... 218 1e-53
216gb|AY520720.1| Capitulum mitella histone H3 gene, partial cds 218 1e-53
217gb|AY520708.1| Tetraclita japonica histone H3 gene, partial cds 218 1e-53
218ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus simila... 218 1e-53
219ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila... 218 1e-53
220gb|DQ284378.1| Tylototriton shanjing histone H3a gene, partial cds 218 1e-53
221gb|DQ284325.1| Thorius sp. JAC 21291 histone H3a gene, partial cds 218 1e-53
222ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 218 1e-53
223gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, com... 218 1e-53
224gb|AY662931.1| Dicrossus sp. JSS-2004 histone H3a gene, partial cds 218 1e-53
225gb|AY539275.1| Trichodon trichodon histone H3 gene, partial cds 218 1e-53
226gb|AY539267.1| Kuhlia rupestris histone H3 gene, partial cds 218 1e-53
227gb|AY539249.1| Dasycottus setiger histone H3 gene, partial cds 218 1e-53
228gb|AY539243.1| Hemitripterus americanus histone H3 gene, partial... 218 1e-53
229gb|AY539232.1| Icelinus filamentosus histone H3 gene, partial cds 218 1e-53
230gb|AY539197.1| Taenianotus triacanthus histone H3-like gene, par... 218 1e-53
231gb|AY539194.1| Scorpaena plumieri histone H3 gene, partial cds 218 1e-53
232gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds 218 1e-53
233gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 218 1e-53
234emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant 216 6e-53
235gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds 216 6e-53
236gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA 216 6e-53
237ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA... 216 6e-53
238gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA 216 6e-53
239gb|AY539268.1| Cirrhitus rivulatus histone H3 gene, partial cds 216 6e-53
240gb|AY539245.1| Hypsagonus quadricornis histone H3 gene, partial cds 216 6e-53
241gb|DQ028156.1| Secutor sp. L26 histone H3 gene, partial cds 214 2e-52
242gb|DQ028122.1| Leiognathus equulus histone H3 gene, partial cds 214 2e-52
243gb|DQ028089.1| Gasterosteus aculeatus histone H3 gene, partial cds 214 2e-52
244gb|DQ284256.1| Leptopelis argenteus histone H3a gene, partial cds 214 2e-52
245gb|DQ284199.1| Leptopelis sp. AMNH A168408 histone H3a gene, par... 214 2e-52
246gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 214 2e-52
247gb|AY539266.1| Haemulon plumieri histone H3 gene, partial cds 214 2e-52
248gb|AY539264.1| Perca flavescens histone H3 gene, partial cds 214 2e-52
249gb|AY539240.1| Batrachocottus baicalensis histone H3 gene, parti... 214 2e-52
250gb|AY539235.1| Microcottus sellaris histone H3 gene, partial cds 214 2e-52
251gb|AY539234.1| Leptocottus armatus histone H3 gene, partial cds 214 2e-52
252gb|AY539231.1| Hemilepidotus zapus histone H3 gene, partial cds 214 2e-52
253gb|AY539198.1| Thysanichthys sp. WLS-2004 histone H3 gene, parti... 214 2e-52
254gb|AY749741.1| Rhoenanthus sp. EP143 histone H3 (H3) gene, parti... 214 2e-52
255gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, parti... 214 2e-52
256ref|XM_465456.1| Oryza sativa (japonica cultivar-group), mRNA 212 9e-52
257emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 212 9e-52
258gb|DQ284201.1| Bufo regularis histone H3a gene, partial cds 212 9e-52
259ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 212 9e-52
260gb|DQ028162.1| Secutor megalolepis histone H3 gene, partial cds 210 4e-51
261gb|DQ028130.1| Leiognathus robustus isolate LEQ1s histone H3 gen... 210 4e-51
262gb|DQ028128.1| Leiognathus fasciatus histone H3 gene, partial cds 210 4e-51
263gb|DQ028127.1| Leiognathus fasciatus histone H3 gene, partial cds 210 4e-51
264gb|DQ028125.1| Leiognathus fasciatus isolate L16 histone H3 gene... 210 4e-51
265gb|DQ028121.1| Leiognathus equulus histone H3 gene, partial cds 210 4e-51
266gb|DQ028113.1| Gazza squamiventralis isolate WLS52 histone H3 ge... 210 4e-51
267ref|XM_465459.1| Oryza sativa (japonica cultivar-group), mRNA 210 4e-51
268gb|DQ284353.1| Scotobleps gabonicus histone H3a gene, partial cds 210 4e-51
269gb|DQ284268.1| Leptopelis vermiculatus histone H3a gene, partial... 210 4e-51
270gb|AY869763.1| Graphocephala coccinea histone H3 gene, partial cds 210 4e-51
271gb|AY869753.1| Hylaius oregonensis histone H3 gene, partial cds 210 4e-51
272gb|AY662901.1| Paretroplus menarambo histone H3a gene, partial cds 210 4e-51
273gb|AY662879.1| Hermosilla azurea histone H3a gene, partial cds 210 4e-51
274gb|AY539230.1| Hemilepidotus jordani histone H3 gene, partial cds 210 4e-51
275gb|AY539180.1| Apeltes quadracus histone H3 gene, partial cds 210 4e-51
276gb|DQ028146.1| Leiognathus bindus histone H3 gene, partial cds 208 1e-50
277gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)... 208 1e-50
278gb|AY377778.1| Crepidula fornicata histone H3 gene, partial cds 208 1e-50
279gb|DQ284411.1| Dyscophus guineti histone H3a gene, partial cds 208 1e-50
280gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds 208 1e-50
281gb|AY662936.1| Teleocichla sp. JSS-2004 histone H3a gene, partia... 208 1e-50
282gb|AY662926.1| Astronotus ocellatus histone H3a gene, partial cds 208 1e-50
283gb|AY655580.1| Atherinomorus lacunosus histone H3a gene, partial... 206 6e-50
284gb|AY655563.1| Bedotia sp. 'Ivoloina' histone H3a gene, partial cds 206 6e-50
285gb|AY655562.1| Bedotia sp. 'Betampona' histone H3a gene, partial... 206 6e-50
286gb|AY655549.1| Bedotia longianalis isolate 2 histone H3a gene, p... 206 6e-50
287gb|AY655548.1| Bedotia longianalis isolate 1 histone H3a gene, p... 206 6e-50
288gb|DQ028139.1| Leiognathus nuchalis histone H3 gene, partial cds 206 6e-50
289gb|DQ028134.1| Leiognathus decorus histone H3 gene, partial cds 206 6e-50
290gb|DQ028131.1| Leiognathus sp. Philippines histone H3 gene, part... 206 6e-50
291gb|DQ028120.1| Leiognathus sp. L9 histone H3 gene, partial cds 206 6e-50
292gb|DQ028118.1| Leiognathus sp. Singapore histone H3 gene, partia... 206 6e-50
293gb|DQ028112.1| Gazza squamiventralis isolate WLS51 histone H3 ge... 206 6e-50
294gb|DQ284406.1| Callulina kisiwamsitu histone H3a gene, partial cds 206 6e-50
295gb|DQ284351.1| Leptodactylodon bicolor histone H3a gene, partial... 206 6e-50
296gb|DQ284340.1| Astylosternus schioetzi histone H3a gene, partial... 206 6e-50
297gb|DQ284336.1| Opisthothylax immaculatus histone H3a gene, parti... 206 6e-50
298gb|DQ284335.1| Trichobatrachus robustus histone H3a gene, partia... 206 6e-50
299gb|DQ284211.1| Opisthothylax immaculatus histone H3a gene, parti... 206 6e-50
300gb|DQ284133.1| Arthroleptis variabilis histone H3a gene, partial... 206 6e-50
301gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, pa... 206 6e-50
302gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge... 206 6e-50
303gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds 206 6e-50
304gb|AY539241.1| Comephorus baicalensis histone H3 gene, partial cds 206 6e-50
305gb|AY539225.1| Marukawichthys ambulator histone H3 gene, partial... 206 6e-50
306gb|DQ028119.1| Leiognathus sp. L2 histone H3 gene, partial cds 204 2e-49
307gb|AY520716.1| Catomerus polymerus histone H3 gene, partial cds 204 2e-49
308gb|AY520706.1| Tetraclitella purpurascens histone H3 gene, parti... 204 2e-49
309gb|DQ284417.1| Triturus cristatus histone H3a gene, partial cds 204 2e-49
310gb|DQ284169.1| Plethodon jordani histone H3a gene, partial cds 204 2e-49
311gb|AY923977.1| Gibbula zonata isolate T25 histone H3 (H3) gene, ... 204 2e-49
312gb|AY923975.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 204 2e-49
313gb|AY662925.1| Apistogramma sp. JSS-2004 histone H3a gene, parti... 204 2e-49
314gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 204 2e-49
315gb|AY655578.1| Pseudomugil signifer histone H3a gene, partial cds 202 9e-49
316gb|AY655569.1| Bedotia sp. 'Vevembe' histone H3a gene, partial cds 202 9e-49
317gb|AY655567.1| Bedotia sp. 'Ranomafana' histone H3a gene, partia... 202 9e-49
318gb|AY655566.1| Bedotia sp. 'Manombo' histone H3a gene, partial cds 202 9e-49
319gb|AY655558.1| Rheocles wrightae histone H3a gene, partial cds 202 9e-49
320gb|AY655553.1| Bedotia tricolor histone H3a gene, partial cds 202 9e-49
321gb|DQ028157.1| Secutor sp. L37 histone H3 gene, partial cds 202 9e-49
322gb|DQ028138.1| Leiognathus dussumieri isolate L30 histone H3 gen... 202 9e-49
323gb|DQ028124.1| Leiognathus equulus histone H3 gene, partial cds 202 9e-49
324gb|DQ028123.1| Leiognathus equulus histone H3 gene, partial cds 202 9e-49
325gb|DQ028117.1| Leiognathus sp. L41 histone H3 gene, partial cds 202 9e-49
326gb|DQ028116.1| Leiognathus sp. L39 histone H3 gene, partial cds 202 9e-49
327gb|DQ028115.1| Leiognathus sp. L25 histone H3 gene, partial cds 202 9e-49
328gb|DQ028103.1| Gazza sp. L22 histone H3 gene, partial cds 202 9e-49
329gb|DQ028100.1| Nematistius pectoralis histone H3 gene, partial cds 202 9e-49
330gb|DQ028094.1| Cepola macrophthalma histone H3 gene, partial cds 202 9e-49
331gb|AY520704.1| Elminius kingii histone H3 gene, partial cds 202 9e-49
332gb|AY520693.1| Balanus glandula histone H3 gene, partial cds 202 9e-49
333gb|AY520692.1| Balanus crenatus histone H3 gene, partial cds 202 9e-49
334gb|DQ284044.1| Aplastodiscus perviridis histone H3a gene, partia... 202 9e-49
335gb|AY662911.1| Paratilapia sp. 'East' histone H3a gene, partial cds 202 9e-49
336gb|AY662908.1| Paratilapia cf. bleekeri JSS-2004 histone H3a gen... 202 9e-49
337gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partia... 202 9e-49
338gb|AY662900.1| Paretroplus maromandia histone H3a-like gene, par... 202 9e-49
339gb|AY662894.1| Paretroplus damii histone H3a gene, partial cds 202 9e-49
340gb|DQ028164.1| Secutor cf. ruconius JS-2005 histone H3 gene, par... 200 3e-48
341gb|DQ028086.1| Zeus faber histone H3 gene, partial cds 200 3e-48
342gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
343gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
344gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
345ref|NG_001335.1| Homo sapiens genomic large histone family clust... 200 3e-48
346ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA 200 3e-48
347gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete... 200 3e-48
348emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 200 3e-48
349gb|DQ284226.1| Crinia signifera histone H3a gene, partial cds 200 3e-48
350gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 200 3e-48
351emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ... 200 3e-48
352gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
353gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
354gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 200 3e-48
355gb|AY662899.1| Paretroplus maculatus histone H3a gene, partial cds 200 3e-48
356gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p... 200 3e-48
357gb|AY326299.1| Phascolosoma nigrescens MCZ DNA100621 histone H3 ... 200 3e-48
358gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds 200 3e-48
359gb|AY655586.1| Atherinops affinis histone H3a gene, partial cds 198 1e-47
360gb|AY655583.1| Teramulus waterloti histone H3a gene, partial cds 198 1e-47
361gb|AY655547.1| Bedotia geayi histone H3a gene, partial cds 198 1e-47
362gb|DQ028161.1| Secutor cf. insidiator JS-2005 histone H3 gene, p... 198 1e-47
363gb|DQ028160.1| Secutor indicius histone H3 gene, partial cds 198 1e-47
364gb|DQ028159.1| Secutor indicius histone H3 gene, partial cds 198 1e-47
365gb|DQ028153.1| Leiognathus lineolatus histone H3 gene, partial cds 198 1e-47
366gb|DQ028152.1| Leiognathus leuciscus histone H3 gene, partial cds 198 1e-47
367gb|DQ028150.1| Leiognathus leuciscus histone H3 gene, partial cds 198 1e-47
368gb|DQ028148.1| Photoplagios sp. Madagascar histone H3 gene, part... 198 1e-47
369gb|DQ028110.1| Gazza minuta isolate L4 histone H3 gene, partial cds 198 1e-47
370gb|DQ028106.1| Gazza sp. WLS56 histone H3 gene, partial cds 198 1e-47
371gb|DQ028105.1| Gazza sp. WLS54 histone H3 gene, partial cds 198 1e-47
372gb|DQ028102.1| Gazza sp. Fiji histone H3 gene, partial cds 198 1e-47
373gb|DQ028095.1| Cepola pauciradiata histone H3 gene, partial cds 198 1e-47
374gb|AY923982.1| Homalopoma maculosa isolate TU6 histone H3 (H3) g... 198 1e-47
375gb|AY555569.1| Choroterpes sp. GG-2004 histone H3 gene, partial cds 198 1e-47
376gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial... 198 1e-47
377gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge... 198 1e-47
378gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds 198 1e-47
379gb|AY662883.1| Cetoscarus bicolor histone H3a gene, partial cds 198 1e-47
380gb|AY655596.1| Atherinomorus sp. Karianga histone H3a gene, part... 196 5e-47
381gb|DQ028108.1| Gazza achlamys histone H3 gene, partial cds 196 5e-47
382gb|DQ028107.1| Gazza achlamys histone H3 gene, partial cds 196 5e-47
383gb|DQ079690.1| Nematoscelis sp. KCnesp histone H3 (H3) gene, par... 196 5e-47
384gb|DQ079672.1| Cryphiops caementarius voucher JC1219 histone H3 ... 196 5e-47
385gb|AY870291.1| Ameletus costalis histone H3 gene, partial cds 196 5e-47
386gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 196 5e-47
387gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 196 5e-47
388gb|AY923981.1| Turbo setosus isolate TU5 histone H3 (H3) gene, p... 196 5e-47
389gb|AY539183.1| Dactylopterus volitans histone H3 gene, partial cds 196 5e-47
390gb|AY655568.1| Bedotia sp. 'Sambava' histone H3a gene, partial cds 194 2e-46
391gb|AY655565.1| Bedotia sp. Makira histone H3a gene, partial cds 194 2e-46
392gb|AY655564.1| Bedotia sp. 'Mahanara' histone H3a gene, partial cds 194 2e-46
393gb|AY655561.1| Bedotia sp. Bemarivo histone H3a gene, partial cds 194 2e-46
394gb|AY655559.1| Bedotia sp. 'Antalaha' histone H3a gene, partial cds 194 2e-46
395gb|AY655552.1| Bedotia masoala histone H3a gene, partial cds 194 2e-46
396gb|AY655551.1| Bedotia marojejy histone H3a gene, partial cds 194 2e-46
397gb|DQ028155.1| Leiognathus stercorarius histone H3 gene, partial... 194 2e-46
398gb|DQ028151.1| Leiognathus leuciscus histone H3 gene, partial cds 194 2e-46
399gb|DQ028144.1| Photopectoralis sp. Taiwan histone H3 gene, parti... 194 2e-46
400gb|DQ028129.1| Leiognathus robustus isolate L35 histone H3 gene,... 194 2e-46
401gb|DQ028114.1| Leiognathus sp. Fiji histone H3 gene, partial cds 194 2e-46
402gb|DQ028111.1| Gazza minuta isolate L29 histone H3 gene, partial... 194 2e-46
403gb|DQ028109.1| Gazza minuta isolate GM1 histone H3 gene, partial... 194 2e-46
404gb|AY520707.1| Tetraclita squamosa histone H3 gene, partial cds 194 2e-46
405gb|AY520697.1| Balanus perforatus histone H3 gene, partial cds 194 2e-46
406gb|AY520696.1| Balanus balanus histone H3 gene, partial cds 194 2e-46
407gb|AF519313.1| Aspidosiphon laevis isolate DNA100467 histone H3 ... 194 2e-46
408gb|AY662910.1| Paratilapia polleni 'Ravelobe' histone H3a gene, ... 194 2e-46
409gb|AY539257.1| Diplectrum formosum histone H3 gene, partial cds 194 2e-46
410gb|AY338629.1| Heptagenia sp. EP018 histone 3 gene, partial cds 194 2e-46
411gb|AY655557.1| Rheocles vatosoa histone H3a gene, partial cds 192 8e-46
412dbj|AB195651.1| Lilium longiflorum soH3-1 gene for histone soH3-... 192 8e-46
413dbj|AB195650.1| Lilium longiflorum soH3-1 mRNA for histone soH3-... 192 8e-46
414gb|AF109910.1|AF109910 Porteresia coarctata histone H3 mRNA, com... 192 8e-46
415gb|AY662927.1| Chaetobranchopsis orbicularis histone H3a gene, p... 192 8e-46
416gb|AY662893.1| Paretroplus dambabe histone H3a gene, partial cds 192 8e-46
417emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a 192 8e-46
418gb|AY655560.1| Bedotia sp. 'Beforana' histone H3a gene, partial cds 190 3e-45
419gb|AY655550.1| Bedotia madagascariensis histone H3a gene, partia... 190 3e-45
420gb|DQ028154.1| Leiognathus rivulatus histone H3 gene, partial cds 190 3e-45
421gb|DQ028104.1| Gazza sp. T240 histone H3 gene, partial cds 190 3e-45
422gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds 190 3e-45
423dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 190 3e-45
424dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 190 3e-45
425gb|AY923958.1| Haliotis varia isolate H37 histone H3 (H3) gene, ... 190 3e-45
426gb|DQ275313.1| Acilius athabascae voucher BYU KBMAcat158 histone... 190 3e-45
427gb|AY662904.1| Paretroplus tsimoly histone H3a gene, partial cds 190 3e-45
428gb|AY662902.1| Paretroplus nourissati histone H3a gene, partial cds 190 3e-45
429gb|AY662891.1| Etroplus suratensis histone H3a gene, partial cds 190 3e-45
430gb|AY655584.1| Iso rhothophilus histone H3a gene, partial cds 188 1e-44
431gb|AY655582.1| Craterocephalus honoriae histone H3a gene, partia... 188 1e-44
432gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3... 188 1e-44
433gb|AY923980.1| Astraea undosa isolate T6 histone H3 (H3) gene, p... 188 1e-44
434gb|AY923962.1| Cyathermia naticoides isolate N1 histone H3 (H3) ... 188 1e-44
435gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 188 1e-44
436gb|AY539228.1| Cottus carolinae histone H3 gene, partial cds 188 1e-44
437gb|AY428836.1| Pycnophyes greenlandicus histone H3 gene, partial... 186 5e-44
438gb|AY655585.1| Atherinella panamensis histone H3a gene, partial cds 186 5e-44
439gb|DQ028163.1| Secutor megalolepis histone H3 gene, partial cds 186 5e-44
440gb|DQ028149.1| Leiognathus elongatus histone H3 gene, partial cds 186 5e-44
441dbj|AB195653.1| Lilium longiflorum soH3-2 gene for histone soH3-... 186 5e-44
442dbj|AB195652.1| Lilium longiflorum soH3-2 mRNA for histone soH3-... 186 5e-44
443dbj|AB195974.1| Lilium longiflorum MPH3 mRNA for histone H3, com... 186 5e-44
444gb|AY923976.1| Trochus niloticus isolate T12 histone H3 (H3) gen... 186 5e-44
445gb|AY539222.1| Zaniolepis frenatus histone H3 gene, partial cds 186 5e-44
446gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds 186 5e-44
447gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 186 5e-44
448gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds 186 5e-44
449gb|AY655576.1| Marosatherina ladigesi histone H3a gene, partial cds 184 2e-43
450gb|DQ079688.1| Munida subrugosa voucher KCmusu histone H3 (H3) g... 184 2e-43
451ref|XM_470806.1| Oryza sativa (japonica cultivar-group), mRNA 184 2e-43
452gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds 184 2e-43
453gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds 184 2e-43
454gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds 184 2e-43
455gb|DQ284112.1| Lithodytes lineatus histone H3a gene, partial cds 184 2e-43
456gb|AY923978.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 184 2e-43
457dbj|AK104901.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
458dbj|AK063199.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
459gb|AY338621.1| Metretopus borealis histone 3 gene, partial cds 184 2e-43
460gb|DQ028090.1| Brama japonica histone H3 gene, partial cds 182 8e-43
461gb|AY525328.1| Oryza sativa (japonica cultivar-group) putative h... 182 8e-43
462gb|DQ284267.1| Rana grahami histone H3a gene, partial cds 182 8e-43
463gb|DQ284262.1| Schoutedenella taeniata histone H3a gene, partial... 182 8e-43
464gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, parti... 182 8e-43
465gb|AY923952.1| Haliotis jacnensis isolate H1 histone H3 (H3) gen... 182 8e-43
466dbj|AK100960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 8e-43
467gb|DQ275315.1| Acilius confusus voucher BYU KBMAcco157 histone 3... 182 8e-43
468gb|DQ079703.1| Uroptychus parvulus voucher KCurpa histone H3 (H3... 180 3e-42
469gb|DQ079679.1| Lithodes santolla voucher KClisa histone H3 (H3) ... 180 3e-42
470gb|AY230984.1| Nesticus sp. X132 histone H3A (H3A) gene, partial... 180 3e-42
471gb|AY788897.1| Mnais nawai histone 3 gene, partial cds 180 3e-42
472gb|AY745675.1| Agabus disintegratus histone H3 (his3) gene, part... 180 3e-42
473gb|DQ284257.1| Hydromantes platycephalus histone H3a gene, parti... 180 3e-42
474gb|DQ284177.1| Rana japonica histone H3a gene, partial cds 180 3e-42
475gb|AF467728.1| Oryza sativa disease-resistent-related protein (R... 180 3e-42
476gb|AY923971.1| Anatoma euglypta isolate S34 histone H3 (H3) gene... 180 3e-42
477gb|AY749717.1| Siphlonella sp. EP083 histone H3 (H3) gene, parti... 180 3e-42
478ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H... 178 1e-41
479gb|DQ284300.1| Assa darlingtoni histone H3a gene, partial cds 178 1e-41
480gb|AY923956.1| Haliotis kamtschatkana isolate H22 histone H3 (H3... 178 1e-41
481emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 178 1e-41
482gb|AY070160.1| Abra prismatica histone H3 gene, partial cds 176 5e-41
483gb|DQ284309.1| Rana maculata histone H3a gene, partial cds 176 5e-41
484gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds 176 5e-41
485gb|AY869772.1| Acrogonia virescens histone H3 gene, partial cds 176 5e-41
486gb|AY869766.1| Homalodisca coagulata histone H3 gene, partial cds 176 5e-41
487gb|DQ284292.1| Rana yavapaiensis histone H3a gene, partial cds 174 2e-40
488gb|DQ284241.1| Genyophryne thomsoni histone H3a gene, partial cds 174 2e-40
489gb|DQ284240.1| Copiula sp. AMS R124417 histone H3a gene, partial... 174 2e-40
490gb|AY829961.1| Xerophrynus machadoi isolate AMCC 124710 histone ... 174 2e-40
491gb|AY923953.1| Haliotis asinina isolate H11 histone H3 (H3) gene... 174 2e-40
492gb|AY923948.1| Montfortula rugosa isolate F22 histone H3 (H3) ge... 174 2e-40
493dbj|AK120807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
494emb|AJ848933.1| Copelatus sp. MB085 partial his3 gene for histon... 174 2e-40
495gb|AF185242.1| Pista australis histone H3 (H3) gene, partial cds 174 2e-40
496gb|DQ275324.1| Acilius sulcatus voucher BYU KBMAcsu49 histone 3 ... 174 2e-40
497gb|DQ275321.1| Acilius kishii voucher BYU KBMAcki83 histone 3 (H... 174 2e-40
498gb|DQ275320.1| Acilius japonicus voucher BYU KBMAcja163 histone ... 174 2e-40
499gb|AY539252.1| Cyclopterus lumpus histone H3 gene, partial cds 174 2e-40
500gb|AF342701.1| Rhinothelepus lobatus histone H3 gene, partial cds 172 8e-40

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  498 bits (251), Expect = e-137
 Identities = 268/274 (97%)
 Strand = Plus / Minus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||||||||||  |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 374 gactggaacctgaggtcggtcttgaagtcctgagcgatctccctcaccaggcgctggaac 315

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 314 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 255

                                             
Query: 509 acggtcccgggcctgtancggtgaggcttcttca 542
           ||||||||||||||||| |||||| |||||||||
Sbjct: 254 acggtcccgggcctgtagcggtgaagcttcttca 221



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  452 bits (228), Expect = e-124
 Identities = 263/275 (95%)
 Strand = Plus / Minus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 359 gactggaagcggaggtccgtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 300

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||
Sbjct: 299 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcgggtctcccggagcgcc 240

                                              
Query: 509 acggtcccgggcctgtancggtgaggcttcttcac 543
           ||||| ||||||||||| ||||| |||||||||||
Sbjct: 239 acggtaccgggcctgtagcggtggggcttcttcac 205



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  428 bits (216), Expect = e-117
 Identities = 297/323 (91%), Gaps = 1/323 (0%)
 Strand = Plus / Plus

                                                                       
Query: 225 cggagaggatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgg 284
           |||||| ||||||| |||| | ||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cggagatgatggct-acgcgcgctcgccacggatgcggcgggcgagctggatgtccttgg 179

                                                                       
Query: 285 gcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccga 344
           ||||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||||
Sbjct: 180 gcatgatggtgacgcgcttagcgtggatggcgcagaggttggtgtcctcgaagagaccga 239

                                                                       
Query: 345 caaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggt 404
           | ||||| |||||||| ||||||||||| |||||||||||||||  |||||| | |||||
Sbjct: 240 cgaggtaggcctcggcggcctcctggagcgccagcacggcgtggctctggaatcggaggt 299

                                                                       
Query: 405 cggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatca 464
           | ||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||
Sbjct: 300 ctgtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatca 359

                                                                       
Query: 465 gcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgt 524
           ||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 360 gcagctccgtgctcttctggtacttgcggatctcgcgcagcgccacggttccgggcctgt 419

                                  
Query: 525 ancggtgaggcttcttcacgccg 547
           | | ||| |||||||||||||||
Sbjct: 420 acctgtggggcttcttcacgccg 442



to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  418 bits (211), Expect = e-114
 Identities = 223/227 (98%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 168

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 167 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctggagg 108

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 48

                                                          
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           ||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 47  accaggcgctggaacgggagcttgcggatcagcagctcggtgctctt 1



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  410 bits (207), Expect = e-111
 Identities = 272/294 (92%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 500

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| ||||||||||||||||| || ||||| ||||| |||||||| ||||||||||| 
Sbjct: 499 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggccgcctcctggagc 440

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           |||||||||||||||  ||||||||  ||||| ||||||||||||||||||||||| |  
Sbjct: 439 gccagcacggcgtggctctggaaccgcaggtccgtcttgaagtcctgcgcgatctcgcgg 380

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 379 accaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 320

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||||||||| |||||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 319 atctcgcggagcgccacggttccgggcctgtagcggtggggcttcttcacgccg 266



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  408 bits (206), Expect = e-111
 Identities = 286/313 (91%)
 Strand = Plus / Plus

                                                                           
Query: 235     ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 294
               ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644693 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 1644752

                                                                           
Query: 295     gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 354
               |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 1644753 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 1644812

                                                                           
Query: 355     ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 414
               |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 1644813 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 1644872

                                                                           
Query: 415     gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgt 474
               ||||||||||||||| |  || ||||||||||| || |||||||||||||| ||||||||
Sbjct: 1644873 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgt 1644932

                                                                           
Query: 475     gctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgagg 534
               |||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||| ||
Sbjct: 1644933 gctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtgggg 1644992

                            
Query: 535     cttcttcacgccg 547
               |||||||||||||
Sbjct: 1644993 cttcttcacgccg 1645005



 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                           
Query: 247     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3055564 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3055505

                                                                           
Query: 307     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
               ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 3055504 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 3055445

                                                                           
Query: 367     ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
               ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 3055444 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 3055385

                                                                           
Query: 427     ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
               ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 3055384 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 3055325

                                                                           
Query: 487     cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
               |||||||||||| ||||| || ||||| || |||||| | ||||| ||||||||||||||
Sbjct: 3055324 cttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgcc 3055265

                
Query: 547     g 547
               |
Sbjct: 3055264 g 3055264



 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Plus

                                                                           
Query: 247     ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
               |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 3039536 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 3039595

                                                                           
Query: 307     gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
               ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 3039596 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 3039655

                                                                           
Query: 367     ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
               ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 3039656 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 3039715

                                                                           
Query: 427     ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
               ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 3039716 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 3039775

                                                                           
Query: 487     cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
               |||||||||||| ||||| || ||||| ||||||||| | ||||| ||||||||||||||
Sbjct: 3039776 cttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgcc 3039835

                
Query: 547     g 547
               |
Sbjct: 3039836 g 3039836



 Score =  331 bits (167), Expect = 1e-87
 Identities = 262/294 (89%)
 Strand = Plus / Plus

                                                                           
Query: 254     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
               ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3045573 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3045632

                                                                           
Query: 314     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
               |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 3045633 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 3045692

                                                                           
Query: 374     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
               ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 3045693 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 3045752

                                                                           
Query: 434     accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
               || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 3045753 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 3045812

                                                                     
Query: 494     atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
               ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 3045813 atctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccg 3045866



 Score =  323 bits (163), Expect = 3e-85
 Identities = 261/294 (88%)
 Strand = Plus / Plus

                                                                           
Query: 254     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054220 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3054279

                                                                           
Query: 314     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
               ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 3054280 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 3054339

                                                                           
Query: 374     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
               ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 3054340 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 3054399

                                                                           
Query: 434     accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
               || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 3054400 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 3054459

                                                                     
Query: 494     atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
               ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 3054460 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 3054513



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 24627908 atatttaggaacggagggagta 24627929



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 23571628 atatttaggaacggagggagta 23571607



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 22      tatatttaggaacggagggagtagtt 47
               ||||||| ||||||||||||||||||
Sbjct: 2716003 tatattttggaacggagggagtagtt 2715978



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 22      tatatttaggaacggagggagtagt 46
               |||||||||| ||||||||||||||
Sbjct: 7234439 tatatttagggacggagggagtagt 7234463



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 22      tatatttaggaacggagggagtagt 46
               |||||||||| ||||||||||||||
Sbjct: 1215107 tatatttagggacggagggagtagt 1215083



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 349      gtacgcctcggcagcctcct 368
                ||||||||||||||||||||
Sbjct: 26644722 gtacgcctcggcagcctcct 26644703



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                |||||||||| |||||||||||||
Sbjct: 17397949 tatatttagggacggagggagtag 17397972



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 17378016 tatattttggaacggagggagtag 17378039



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 14348600 tatattttggaacggagggagtag 14348623



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 22      tatatttaggaacggagggagtag 45
               ||||||| ||||||||||||||||
Sbjct: 9196390 tatattttggaacggagggagtag 9196367



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 23      atatttaggaacggagggagtagt 46
               |||||||| |||||||||||||||
Sbjct: 1117586 atatttagaaacggagggagtagt 1117563



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 22     tatatttaggaacggagggagtag 45
              ||||||| ||||||||||||||||
Sbjct: 177105 tatattttggaacggagggagtag 177082



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  408 bits (206), Expect = e-111
 Identities = 286/313 (91%)
 Strand = Plus / Plus

                                                                         
Query: 235   ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 294
             ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 47864 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 47923

                                                                         
Query: 295   gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 354
             |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 47924 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 47983

                                                                         
Query: 355   ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 414
             |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 47984 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 48043

                                                                         
Query: 415   gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgt 474
             ||||||||||||||| |  || ||||||||||| || |||||||||||||| ||||||||
Sbjct: 48044 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgt 48103

                                                                         
Query: 475   gctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgagg 534
             |||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||| ||
Sbjct: 48104 gctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtgggg 48163

                          
Query: 535   cttcttcacgccg 547
             |||||||||||||
Sbjct: 48164 cttcttcacgccg 48176



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  408 bits (206), Expect = e-111
 Identities = 286/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 235 ggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 294
           ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 ggcttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 443

                                                                       
Query: 295 gacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgc 354
           |||||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||
Sbjct: 442 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggc 383

                                                                       
Query: 355 ctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaa 414
           |||||| |||||||||||||| ||||| ||||||  |||||| | |||||||||||||||
Sbjct: 382 ctcggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaa 323

                                                                       
Query: 415 gtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgt 474
           ||||||||||||||| |  || ||||||||||| || |||||||||||||| ||||||||
Sbjct: 322 gtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgt 263

                                                                       
Query: 475 gctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgagg 534
           |||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||| ||
Sbjct: 262 gctcttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtgggg 203

                        
Query: 535 cttcttcacgccg 547
           |||||||||||||
Sbjct: 202 cttcttcacgccg 190



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  402 bits (203), Expect = e-109
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ttacgcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           ||| |||||||||||||| ||||| ||||||  |||||| | ||||||||||||||||||
Sbjct: 291 ggcggcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| |  || ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 231 ctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgtgct 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           ||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||| |||||
Sbjct: 171 cttctggtacttgcggatctcgcggagcgccaccgtccccggcctgtagcggtggggctt 112

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 111 cttcacgccg 102



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  398 bits (201), Expect = e-108
 Identities = 287/316 (90%)
 Strand = Plus / Minus

                                                                       
Query: 232 gatggcttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgat 291
           ||||||||| || | ||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 468 gatggcttaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgat 409

                                                                       
Query: 292 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggta 351
           ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 408 ggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggta 349

                                                                       
Query: 352 cgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtctt 411
            |||||||| ||||||||||| |||||||||||||||  ||||||||  ||||| || ||
Sbjct: 348 ggcctcggccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgtttt 289

                                                                       
Query: 412 gaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctc 471
           |||||||||||||||||| |  || ||||||||||| || ||||||||||| ||||||||
Sbjct: 288 gaagtcctgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctc 229

                                                                       
Query: 472 cgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtg 531
           |||||||||||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 228 cgtgctcttctggtacttgcggatctcgcgcagcgcgacggtgccgggcctgtagcggtg 169

                           
Query: 532 aggcttcttcacgccg 547
            |||||||||||||||
Sbjct: 168 gggcttcttcacgccg 153



to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  392 bits (198), Expect = e-106
 Identities = 281/309 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 298
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 410 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 350 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 291

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
           || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 290 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 231

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 230 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagctccgtgctc 171

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           |||||||||||||||||||| ||||| || ||||| || |||||| | ||||| ||||||
Sbjct: 170 ttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggcttc 111

                    
Query: 539 ttcacgccg 547
           |||||||||
Sbjct: 110 ttcacgccg 102



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  392 bits (198), Expect = e-106
 Identities = 281/309 (90%)
 Strand = Plus / Plus

                                                                         
Query: 239   tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 298
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72762 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 72821

                                                                         
Query: 299   cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
             |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 72822 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 72881

                                                                         
Query: 359   gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
             || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 72882 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 72941

                                                                         
Query: 419   tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
             ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 72942 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagctccgtgctc 73001

                                                                         
Query: 479   ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
             |||||||||||||||||||| ||||| || ||||| || |||||| | ||||| ||||||
Sbjct: 73002 ttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggcttc 73061

                      
Query: 539   ttcacgccg 547
             |||||||||
Sbjct: 73062 ttcacgccg 73070



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  392 bits (198), Expect = e-106
 Identities = 281/309 (90%)
 Strand = Plus / Plus

                                                                            
Query: 239      tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 298
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355440 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 21355499

                                                                            
Query: 299      cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
                |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 21355500 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 21355559

                                                                            
Query: 359      gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
                || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 21355560 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 21355619

                                                                            
Query: 419      tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
                ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 21355620 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagctccgtgctc 21355679

                                                                            
Query: 479      ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
                |||||||||||||||||||| ||||| || ||||| || |||||| | ||||| ||||||
Sbjct: 21355680 ttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggcttc 21355739

                         
Query: 539      ttcacgccg 547
                |||||||||
Sbjct: 21355740 ttcacgccg 21355748



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 22       tatatttaggaacggagggagta 44
                |||||||||||||||||||||||
Sbjct: 23958336 tatatttaggaacggagggagta 23958314



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 22       tatatttaggaacggagggagtagtt 47
                |||||||||| |||||||||||||||
Sbjct: 28730458 tatatttagggacggagggagtagtt 28730483



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 17287467 atatttaggaacggagggagta 17287446



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 22       tatatttaggaacggagggagtagtt 47
                ||||||| ||||||||||||||||||
Sbjct: 14654316 tatattttggaacggagggagtagtt 14654291



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 23      atatttaggaacggagggagta 44
               ||||||||||||||||||||||
Sbjct: 3054101 atatttaggaacggagggagta 3054080



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 24       tatttaggaacggagggagta 44
                |||||||||||||||||||||
Sbjct: 24760882 tatttaggaacggagggagta 24760862



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 23      atatttaggaacggagggagtagtt 47
               ||||||||||| |||||||||||||
Sbjct: 5062685 atatttaggaatggagggagtagtt 5062709



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 28546571 tatattttggaacggagggagtag 28546548



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 23       atatttaggaacggagggagtagt 46
                ||||||||||| ||||||||||||
Sbjct: 18038823 atatttaggaaaggagggagtagt 18038800



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                |||||||||| |||||||||||||
Sbjct: 17904685 tatatttagggacggagggagtag 17904662



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 15645827 tatattttggaacggagggagtag 15645804



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 21       atatatttaggaacggagggagta 44
                ||||||||||| ||||||||||||
Sbjct: 15443885 atatatttagggacggagggagta 15443862



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 22      tatatttaggaacggagggagtag 45
               |||||||||| |||||||||||||
Sbjct: 7434907 tatatttagggacggagggagtag 7434884



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  392 bits (198), Expect = e-106
 Identities = 281/309 (90%)
 Strand = Plus / Minus

                                                                       
Query: 239 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 298
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 tacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 436

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           |||||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||
Sbjct: 435 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcg 376

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
           || |||||||| || ||    ||||||  |  |||||| | |||||||||||||||||||
Sbjct: 375 gcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcc 316

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           ||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 315 tgcgcgatctcccgcaccagccgctggaacggcagcttgcggatgagcagctccgtgctc 256

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           |||||||||||||||||||| ||||| || ||||| || |||||| | ||||| ||||||
Sbjct: 255 ttctggtacttgcggatctcccggagcgcgacggttcccggcctgaagcggtggggcttc 196

                    
Query: 539 ttcacgccg 547
           |||||||||
Sbjct: 195 ttcacgccg 187



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  387 bits (195), Expect = e-104
 Identities = 278/306 (90%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 227 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgctcttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||| ||||| || ||||| ||||| | | | ||||| |||||||||
Sbjct: 167 tggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttcttc 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  387 bits (195), Expect = e-104
 Identities = 278/306 (90%)
 Strand = Plus / Minus

                                                                            
Query: 242      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507562 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 37507503

                                                                            
Query: 302      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
                ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 37507502 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 37507443

                                                                            
Query: 362      gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
                |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 37507442 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 37507383

                                                                            
Query: 422      gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
                |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 37507382 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgctcttc 37507323

                                                                            
Query: 482      tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
                ||||||||||||||||| ||||| || ||||| ||||| | | | ||||| |||||||||
Sbjct: 37507322 tggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttcttc 37507263

                      
Query: 542      acgccg 547
                ||||||
Sbjct: 37507262 acgccg 37507257



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 22       tatatttaggaacggagggagta 44
                |||||||||||||||||||||||
Sbjct: 21121708 tatatttaggaacggagggagta 21121686



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 22       tatatttaggaacggagggagt 43
                ||||||||||||||||||||||
Sbjct: 42091221 tatatttaggaacggagggagt 42091242



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 22       tatatttaggaacggagggagtagtt 47
                |||||||||||||||||| |||||||
Sbjct: 13969007 tatatttaggaacggaggaagtagtt 13968982



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 22       tatatttaggaacggagggagt 43
                ||||||||||||||||||||||
Sbjct: 11591968 tatatttaggaacggagggagt 11591989



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 22       tatatttaggaacggagggagtagt 46
                ||||||| |||||||||||||||||
Sbjct: 32064753 tatattttggaacggagggagtagt 32064777



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 22       tatatttaggaacggagggagtagt 46
                ||||||| |||||||||||||||||
Sbjct: 31349342 tatattttggaacggagggagtagt 31349366



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 24       tatttaggaacggagggagtagtt 47
                |||| |||||||||||||||||||
Sbjct: 37273993 tattaaggaacggagggagtagtt 37273970



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 22       tatatttaggaacggaggga 41
                ||||||||||||||||||||
Sbjct: 29946842 tatatttaggaacggaggga 29946823



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 23       atatttaggaacggagggagtagt 46
                |||||| |||||||||||||||||
Sbjct: 22003863 atattttggaacggagggagtagt 22003886



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 23       atatttaggaacggagggagtagt 46
                |||||||| |||||||||||||||
Sbjct: 11456949 atatttagaaacggagggagtagt 11456972



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  387 bits (195), Expect = e-104
 Identities = 278/306 (90%)
 Strand = Plus / Minus

                                                                          
Query: 242    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102099 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 102040

                                                                          
Query: 302    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
              ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 102039 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 101980

                                                                          
Query: 362    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
              |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 101979 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 101920

                                                                          
Query: 422    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
              |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 101919 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgctcttc 101860

                                                                          
Query: 482    tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
              ||||||||||||||||| ||||| || ||||| ||||| | | | ||||| |||||||||
Sbjct: 101859 tggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttcttc 101800

                    
Query: 542    acgccg 547
              ||||||
Sbjct: 101799 acgccg 101794



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  387 bits (195), Expect = e-104
 Identities = 278/306 (90%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 485 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 426

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 425 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcc 366

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    ||||||  |  |||||| | ||||||||||||||||||||||
Sbjct: 365 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 306

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 305 gcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgctcttc 246

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||| ||||| || ||||| ||||| | | | ||||| |||||||||
Sbjct: 245 tggtacttgcggatctcccggagcgcgacggtgccggggcggaagcggtggggcttcttc 186

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 185 acgccg 180



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  377 bits (190), Expect = e-101
 Identities = 273/301 (90%)
 Strand = Plus / Minus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 401 ctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggc 342

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           |||||||||||| |||||||||||||||||||| ||||| ||||| |||||||| || ||
Sbjct: 341 gtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcttc 282

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           |||||||||||| |||||||||  ||||||||  || || |||||||||||||| |||||
Sbjct: 281 ctggagggccaggacggcgtggctctggaaccgcagatccgtcttgaagtcctgagcgat 222

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  |||||||||||||| |||| ||| |||||||||||||||||||||||||||||
Sbjct: 221 ctcacggaccaggcgctggaagggcaacttccggatcagcagctccgtgctcttctggta 162

                                                                       
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
           ||||||||||||||| || ||||| |||||||||||||| | ||| ||||||||||||||
Sbjct: 161 cttgcggatctcgcgcagagccaccgtcccgggcctgtacctgtggggcttcttcacgcc 102

            
Query: 547 g 547
           |
Sbjct: 101 g 101



to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  371 bits (187), Expect = 2e-99
 Identities = 276/306 (90%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 654 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 595

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 594 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 535

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||    ||||||  ||||||||| | ||||||||||||||||||||| 
Sbjct: 534 gcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgg 475

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||| ||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 474 gcgatctcgcgcactaggcgctggaaggggagcttgcggatgagcagctccgtgctcttc 415

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||||||||| |||||||| ||||| | | | ||||| |||||||||
Sbjct: 414 tggtacttgcggatctcgcggagcgccacggtgccggggcggaagcggtggggcttcttc 355

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 354 acgccg 349



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  369 bits (186), Expect = 6e-99
 Identities = 275/305 (90%)
 Strand = Plus / Plus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 285

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 286 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 345

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||   |||||||  ||||||||||| |||||| |||||||||||||||
Sbjct: 346 gcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgc 405

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 406 gcgatctcccgcaccagccgctggaacggcagcttccggatcagcagctccgtgctcttc 465

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||| || || |||||||| || || | | | ||||| |||||||||
Sbjct: 466 tggtacttgcggatctcccgcagcgccacggtgcccgggcggaagcggtgcggcttcttc 525

                
Query: 542 acgcc 546
           |||||
Sbjct: 526 acgcc 530



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  369 bits (186), Expect = 6e-99
 Identities = 275/305 (90%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 gccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 732

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 731 ttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcg 672

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||   |||||||  ||||||||||| |||||| |||||||||||||||
Sbjct: 671 gcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgc 612

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 611 gcgatctcccgcaccagccgctggaacggcagcttccggatcagcagctccgtgctcttc 552

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||| || || |||||||| || || | | | ||||| |||||||||
Sbjct: 551 tggtacttgcggatctcccgcagcgccacggtgcccgggcggaagcggtgcggcttcttc 492

                
Query: 542 acgcc 546
           |||||
Sbjct: 491 acgcc 487



to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  365 bits (184), Expect = 1e-97
 Identities = 252/275 (91%)
 Strand = Plus / Minus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggccagcacggcgtgg 367

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  || || |||||||||||||| |||||||||| || |||||||||||||
Sbjct: 366 ctctggaagcgcagatccgtcttgaagtcctgggcgatctcccgcagcaggcgctggaac 307

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           |||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 306 ggcagcttgcggatgagcagatccgtgctcttctggtacttgcggatctcccggagggcc 247

                                              
Query: 509 acggtcccgggcctgtancggtgaggcttcttcac 543
           ||||| || |||||||| ||||| |||||||||||
Sbjct: 246 acggtgcccggcctgtagcggtggggcttcttcac 212



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  355 bits (179), Expect = 1e-94
 Identities = 274/306 (89%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||| |||||| ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 227 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagctccgtgctcttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||| ||||| ||||| || || |||| | | ||||| |||||||||
Sbjct: 167 tggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttcttc 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  355 bits (179), Expect = 1e-94
 Identities = 274/306 (89%)
 Strand = Plus / Minus

                                                                            
Query: 242      gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
                ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                            
Query: 302      ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
                ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 20748940

                                                                            
Query: 362      gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
                |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 20748939 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 20748880

                                                                            
Query: 422      gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
                |||||||||| |||||| ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 20748879 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagctccgtgctcttc 20748820

                                                                            
Query: 482      tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
                ||||||||||||||||| ||||| ||||| || || |||| | | ||||| |||||||||
Sbjct: 20748819 tggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttcttc 20748760

                      
Query: 542      acgccg 547
                ||||||
Sbjct: 20748759 acgccg 20748754



 Score =  137 bits (69), Expect = 4e-29
 Identities = 102/113 (90%)
 Strand = Plus / Minus

                                                                            
Query: 269      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
                ||||| |||||||||||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                                     
Query: 329      tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcac 381
                |||||||| || || || ||||||||||||||||| ||||| ||||| |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctgaagggcaagcac 22438249



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 23412323 atatttaggaacggagggagta 23412302



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 21272203 atatttaggaacggagggagta 21272224



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 23       atatttaggaacggagggagtagttc 48
                ||||||||| ||||||||||||||||
Sbjct: 16940990 atatttagggacggagggagtagttc 16941015



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 23     atatttaggaacggagggagta 44
              ||||||||||||||||||||||
Sbjct: 541864 atatttaggaacggagggagta 541843



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 22       tatatttaggaacggagggagtagt 46
                |||||| ||||||||||||||||||
Sbjct: 28654384 tatattaaggaacggagggagtagt 28654360



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 22       tatatttaggaacggagggagtagt 46
                |||||| ||||||||||||||||||
Sbjct: 27340326 tatattaaggaacggagggagtagt 27340302



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                                 
Query: 464      agcagctccgtgct-cttctggtacttgcggat 495
                |||||||| ||||| ||||||||||||||||||
Sbjct: 22438070 agcagctcagtgcttcttctggtacttgcggat 22438038



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 22       tatatttaggaacggagggagtagt 46
                ||||||||| |||||||||||||||
Sbjct: 20310836 tatatttagtaacggagggagtagt 20310812



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 23       atatttaggaacggagggagtagtt 47
                |||||||| ||||||||||||||||
Sbjct: 13174529 atatttagaaacggagggagtagtt 13174505



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 21       atatatttaggaacggagggagta 44
                ||||||||||||| ||||||||||
Sbjct: 32287906 atatatttaggaatggagggagta 32287883



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 27501954 tatattttggaacggagggagtag 27501977



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 23      atatttaggaacggagggagtagttccg 50
               ||||||||| |||||||||||| |||||
Sbjct: 4695084 atatttagggacggagggagtacttccg 4695111



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  355 bits (179), Expect = 1e-94
 Identities = 274/306 (89%)
 Strand = Plus / Minus

                                                                         
Query: 242   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
             ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                         
Query: 302   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
             ||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||||| 
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 95091

                                                                         
Query: 362   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
             |||||||| || ||    ||||||   |||||||||| |||||| |||||||||||||||
Sbjct: 95090 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 95031

                                                                         
Query: 422   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
             |||||||||| |||||| ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 95030 gcgatctcccgcaccagccgctggaacgggagcttccggatcagcagctccgtgctcttc 94971

                                                                         
Query: 482   tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
             ||||||||||||||||| ||||| ||||| || || |||| | | ||||| |||||||||
Sbjct: 94970 tggtacttgcggatctcccggagtgccaccgtgcccggccggaagcggtgcggcttcttc 94911

                   
Query: 542   acgccg 547
             ||||||
Sbjct: 94910 acgccg 94905



to top

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  355 bits (179), Expect = 1e-94
 Identities = 265/294 (90%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 881

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| |||||||||||||||||||| ||||| ||||| |||||||| |||||||| || 
Sbjct: 880 gcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcctcctgcagc 821

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  ||||||||| | |||||||||||||||||||||||||||||| |  
Sbjct: 820 gcggcgacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcgcgg 761

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 760 accaggcgctggaagggcagcttgcggatgagcagctccgtgctcttctggtacttgcgg 701

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || |||||||| || || | | | ||||| |||||||||||||||
Sbjct: 700 atctcgcgcagcgccacggtgcccgggcggaagcggtgcggcttcttcacgccg 647



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Minus

                                                                          
Query: 254    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118162 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 118103

                                                                          
Query: 314    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
              ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 118102 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 118043

                                                                          
Query: 374    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
              ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 118042 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 117983

                                                                          
Query: 434    accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
              || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117982 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 117923

                                                                    
Query: 494    atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
              ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 117922 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 117869



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Minus

                                                                         
Query: 254   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13768 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 13709

                                                                         
Query: 314   gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
             ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 13708 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 13649

                                                                         
Query: 374   gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
             ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 13648 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 13589

                                                                         
Query: 434   accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
             || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13588 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 13529

                                                                   
Query: 494   atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 13528 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 13475



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 736

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 735 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 676

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 675 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 616

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 615 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 556

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 555 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 502



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Plus

                                                                           
Query: 254     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608636 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2608695

                                                                           
Query: 314     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
               ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 2608696 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2608755

                                                                           
Query: 374     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
               ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 2608756 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 2608815

                                                                           
Query: 434     accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
               || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608816 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 2608875

                                                                     
Query: 494     atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
               ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 2608876 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 2608929



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 22       tatatttaggaacggagggagtagtt 47
                |||||||||| |||||||||||||||
Sbjct: 27544678 tatatttagggacggagggagtagtt 27544653



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 23765962 atatttaggaacggagggagta 23765983



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 18941148 atatttaggaacggagggagta 18941127



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 23       atatttaggaacggagggagtagtt 47
                ||||||||| |||||||||||||||
Sbjct: 18324120 atatttagggacggagggagtagtt 18324096



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 23      atatttaggaacggagggagtagtt 47
               ||||||||| |||||||||||||||
Sbjct: 7251256 atatttagggacggagggagtagtt 7251232



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 25       atttaggaacggagggagta 44
                ||||||||||||||||||||
Sbjct: 27742525 atttaggaacggagggagta 27742506



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 23245046 tatattttggaacggagggagtag 23245069



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 21645464 tatattttggaacggagggagtag 21645441



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 25       atttaggaacggagggagta 44
                ||||||||||||||||||||
Sbjct: 19335031 atttaggaacggagggagta 19335050



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 27       ttaggaacggagggagtagt 46
                ||||||||||||||||||||
Sbjct: 18066515 ttaggaacggagggagtagt 18066496



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                |||||||||| |||||||||||||
Sbjct: 10597611 tatatttagggacggagggagtag 10597588



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 23      atatttaggaacggagggagtagt 46
               |||||||| |||||||||||||||
Sbjct: 4211513 atatttagaaacggagggagtagt 4211536



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Plus

                                                                           
Query: 254     cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617667 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2617726

                                                                           
Query: 314     gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
               ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 2617727 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 2617786

                                                                           
Query: 374     gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
               ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 2617787 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 2617846

                                                                           
Query: 434     accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
               || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617847 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 2617906

                                                                     
Query: 494     atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
               ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 2617907 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 2617960



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 22       tatatttaggaacggagggagtagtt 47
                |||||||||| |||||||||||||||
Sbjct: 27568666 tatatttagggacggagggagtagtt 27568641



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 24076553 atatttaggaacggagggagta 24076574



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 23       atatttaggaacggagggagta 44
                ||||||||||||||||||||||
Sbjct: 19099797 atatttaggaacggagggagta 19099776



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 23       atatttaggaacggagggagtagtt 47
                ||||||||| |||||||||||||||
Sbjct: 18483521 atatttagggacggagggagtagtt 18483497



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 23      atatttaggaacggagggagtagtt 47
               ||||||||| |||||||||||||||
Sbjct: 7321342 atatttagggacggagggagtagtt 7321318



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 25       atttaggaacggagggagta 44
                ||||||||||||||||||||
Sbjct: 27766513 atttaggaacggagggagta 27766494



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 23554956 tatattttggaacggagggagtag 23554979



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                ||||||| ||||||||||||||||
Sbjct: 21955663 tatattttggaacggagggagtag 21955640



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 25       atttaggaacggagggagta 44
                ||||||||||||||||||||
Sbjct: 19494580 atttaggaacggagggagta 19494599



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 27       ttaggaacggagggagtagt 46
                ||||||||||||||||||||
Sbjct: 18156930 ttaggaacggagggagtagt 18156911



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 22       tatatttaggaacggagggagtag 45
                |||||||||| |||||||||||||
Sbjct: 10669155 tatatttagggacggagggagtag 10669132



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 23      atatttaggaacggagggagtagt 46
               |||||||| |||||||||||||||
Sbjct: 4220207 atatttagaaacggagggagtagt 4220230



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  339 bits (171), Expect = 6e-90
 Identities = 263/294 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 466 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 407

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| ||||||||||||||||| |||||||| ||||| |||||||| ||||||||||| 
Sbjct: 406 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctggagc 347

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  |  |||||||| |||||| |||||||||||||||||||||||||  
Sbjct: 346 gcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcccgg 287

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || || |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 286 acgagccgctggaaggggagcttgcggatcagcagctccgtgctcttctggtacttgcgg 227

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||| | | ||||| |||||||||||||||
Sbjct: 226 atctcccggagcgcgacggtgcccggccggaaccggtgcggcttcttcacgccg 173



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 283

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 282 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 223

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 222 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 163

                                                                       
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
           |||||||||||| ||||| || ||||| ||||||||| | ||||| ||||||||||||||
Sbjct: 162 cttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgcc 103

            
Query: 547 g 547
           |
Sbjct: 102 g 102



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 283

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 282 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 223

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 222 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 163

                                                                       
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
           |||||||||||| ||||| || ||||| || |||||| | ||||| ||||||||||||||
Sbjct: 162 cttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgcc 103

            
Query: 547 g 547
           |
Sbjct: 102 g 102



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 743

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 742 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 683

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 682 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 623

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 622 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 563

                                                                       
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
           |||||||||||| ||||| || ||||| ||||||||| | ||||| ||||||||||||||
Sbjct: 562 cttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgcc 503

            
Query: 547 g 547
           |
Sbjct: 502 g 502



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                          
Query: 247    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 143513 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 143454

                                                                          
Query: 307    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
              ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 143453 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 143394

                                                                          
Query: 367    ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
              ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 143393 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 143334

                                                                          
Query: 427    ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
              ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 143333 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 143274

                                                                          
Query: 487    cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
              |||||||||||| ||||| || ||||| || |||||| | ||||| ||||||||||||||
Sbjct: 143273 cttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgcc 143214

               
Query: 547    g 547
              |
Sbjct: 143213 g 143213



 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Plus

                                                                          
Query: 247    ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
              |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 127485 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 127544

                                                                          
Query: 307    gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
              ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 127545 gtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 127604

                                                                          
Query: 367    ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
              ||| || ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 127605 ctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 127664

                                                                          
Query: 427    ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
              ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 127665 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 127724

                                                                          
Query: 487    cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
              |||||||||||| ||||| || ||||| ||||||||| | ||||| ||||||||||||||
Sbjct: 127725 cttgcggatctcacggagcgcgacggtgccgggcctgaagcggtggggcttcttcacgcc 127784

               
Query: 547    g 547
              |
Sbjct: 127785 g 127785



 Score =  331 bits (167), Expect = 1e-87
 Identities = 262/294 (89%)
 Strand = Plus / Plus

                                                                          
Query: 254    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
              ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133522 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 133581

                                                                          
Query: 314    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
              |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 133582 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 133641

                                                                          
Query: 374    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
              ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 133642 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 133701

                                                                          
Query: 434    accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
              || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 133702 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 133761

                                                                    
Query: 494    atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
              ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 133762 atctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccg 133815



 Score =  323 bits (163), Expect = 3e-85
 Identities = 261/294 (88%)
 Strand = Plus / Plus

                                                                          
Query: 254    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142169 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 142228

                                                                          
Query: 314    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
              ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 142229 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 142288

                                                                          
Query: 374    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
              ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 142289 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 142348

                                                                          
Query: 434    accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
              || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 142349 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 142408

                                                                    
Query: 494    atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
              ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 142409 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 142462



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  337 bits (170), Expect = 2e-89
 Identities = 268/301 (89%)
 Strand = Plus / Minus

                                                                        
Query: 247  ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
            |||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 9749 ctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggc 9690

                                                                        
Query: 307  gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
            ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||
Sbjct: 9689 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctc 9630

                                                                        
Query: 367  ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
            ||| |||||    ||||||  |  |||||| | ||||||||||||||||||||| |||||
Sbjct: 9629 ctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgat 9570

                                                                        
Query: 427  ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
            ||| |  || ||||||||||| || ||||||||||| |||||||||||||||||||||||
Sbjct: 9569 ctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggta 9510

                                                                        
Query: 487  cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
            |||||||||||| ||||| || ||||| || |||||| | ||||| ||||||||||||||
Sbjct: 9509 cttgcggatctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgcc 9450

             
Query: 547  g 547
            |
Sbjct: 9449 g 9449



 Score =  323 bits (163), Expect = 3e-85
 Identities = 261/294 (88%)
 Strand = Plus / Plus

                                                                        
Query: 254  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8405 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 8464

                                                                        
Query: 314  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
            ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 8465 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 8524

                                                                        
Query: 374  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
            ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 8525 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 8584

                                                                        
Query: 434  accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
            || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 8585 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 8644

                                                                  
Query: 494  atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 8645 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 8698



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 500 cggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 4   cggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccg 51



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  331 bits (167), Expect = 1e-87
 Identities = 262/294 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 357

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 356 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 297

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 296 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 237

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 236 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 177

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 176 atctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccg 123



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  331 bits (167), Expect = 1e-87
 Identities = 262/294 (89%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 337 cggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatg 278

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| ||||||||||||||||| || ||||| ||||| ||||| || |||||||| || 
Sbjct: 277 gcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctccgcggcctcctgcagc 218

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  ||||||||| | |||||||||||||||||||||||||||||| |  
Sbjct: 217 gcggcgacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcgcgg 158

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 157 accaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 98

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||||||||| |||||||| || || | | | ||||| |||||||||||||||
Sbjct: 97  atctcgcggagcgccacggtgcccgggcggaagcggtgcggcttcttcacgccg 44



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  331 bits (167), Expect = 1e-87
 Identities = 262/294 (89%)
 Strand = Plus / Minus

                                                                        
Query: 254  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
            ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1515 cggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1456

                                                                        
Query: 314  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
            |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 1455 gcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgcagc 1396

                                                                        
Query: 374  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
            ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 1395 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 1336

                                                                        
Query: 434  accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
            || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1335 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 1276

                                                                  
Query: 494  atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 1275 atctcacggagcgcgacggtgcctggcctgaagcggtgcggcttcttcacgccg 1222



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  323 bits (163), Expect = 3e-85
 Identities = 261/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||| ||||||||||| |||||||| ||||||||||| || |||||||| || 
Sbjct: 335 gcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgcagc 276

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||    ||||||  |  |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 216

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 215 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 156

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 155 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 102



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  323 bits (163), Expect = 3e-85
 Identities = 270/306 (88%)
 Strand = Plus / Plus

                                                                        
Query: 242  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                        
Query: 302  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 3467

                                                                        
Query: 362  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
            |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 3468 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 3527

                                                                        
Query: 422  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
            |||||||||| ||||||||||||||| |||||||||||||||||||||||||||  ||||
Sbjct: 3528 gcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggacttc 3587

                                                                        
Query: 482  tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
            |||||    ||||||||||| || ||||| || ||||||| ||| ||||| |||||||||
Sbjct: 3588 tggtagcgccggatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttc 3647

                  
Query: 542  acgccg 547
            ||||||
Sbjct: 3648 acgccg 3653



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  321 bits (162), Expect = 1e-84
 Identities = 269/305 (88%)
 Strand = Plus / Plus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||| || 
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcg 273

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || |||  ||| ||    ||||||||||  ||||| |||||||||||||||
Sbjct: 274 gcctcctgcagcgccgccaccgccgacgactggaaccgcaggtccgtcttgaagtcctgc 333

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| |  |||||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 334 gcgatctcgcgaaccaggcgctggaaggggagcttgcggatgagcagctccgtgctcttc 393

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||||||||||||||| || ||||| ||||| | | | ||||| |||||||||
Sbjct: 394 tggtacttgcggatctcgcggagcgcgacggtgccggggcggaagcggtgcggcttcttc 453

                
Query: 542 acgcc 546
           |||||
Sbjct: 454 acgcc 458



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  321 bits (162), Expect = 1e-84
 Identities = 266/301 (88%)
 Strand = Plus / Plus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 473 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 532

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           ||||||||||||||||||||||||||||||||| || || ||||| ||||| || |||||
Sbjct: 533 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 592

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||||||||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 593 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 652

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  ||||||||||||||||||||||||||||| |||||||| ||   |||||||||
Sbjct: 653 ctcacggaccaggcgctggaacggcagcttgcggatgagcagctcagtcgacttctggta 712

                                                                       
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgcc 546
           |||||||||||| || || |||||||| ||||| | ||| || |||||||||||||||||
Sbjct: 713 cttgcggatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcacgcc 772

            
Query: 547 g 547
           |
Sbjct: 773 g 773



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  321 bits (162), Expect = 1e-84
 Identities = 269/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||||| 
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    || |||  ||||||||| | ||||||||||||||| ||||||
Sbjct: 287 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| |  || ||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 227 gcgatctcacggacgaggcgctggaagggcagcttgcggatgagcagctccgtgctcttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||| ||||| ||||| || ||||| ||||| | | | |||||||||||||||
Sbjct: 167 tggtacttgcgaatctcccggagcgcgacggtgccggggcggaagcggtgaggcttcttc 108

                
Query: 542 acgcc 546
           |||||
Sbjct: 107 acgcc 103



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  321 bits (162), Expect = 1e-84
 Identities = 269/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||||| 
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 709

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    || |||  ||||||||| | ||||||||||||||| ||||||
Sbjct: 708 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 649

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| |  || ||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 648 gcgatctcacggacgaggcgctggaagggcagcttgcggatgagcagctccgtgctcttc 589

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||||||||||| ||||| ||||| || ||||| ||||| | | | |||||||||||||||
Sbjct: 588 tggtacttgcgaatctcccggagcgcgacggtgccggggcggaagcggtgaggcttcttc 529

                
Query: 542 acgcc 546
           |||||
Sbjct: 528 acgcc 524



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  315 bits (159), Expect = 8e-83
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                        
Query: 242  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                        
Query: 302  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
            ||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 2148

                                                                        
Query: 362  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
            |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 2147 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 2088

                                                                        
Query: 422  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
            |||||||| | ||||||||||||||| |||||||||||||||||||||||||||  ||||
Sbjct: 2087 gcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggacttc 2028

                                                                        
Query: 482  tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
            |||||    ||||||||||| || ||||| || ||||||| ||| ||||| |||||||||
Sbjct: 2027 tggtagcgccggatctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttc 1968

                  
Query: 542  acgccg 547
            ||||||
Sbjct: 1967 acgccg 1962



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  315 bits (159), Expect = 8e-83
 Identities = 260/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 625 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 566

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||| ||||||||||| |||||||| ||||||  ||| || |||||||| || 
Sbjct: 565 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 506

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||  | ||||||   | |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 505 gcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 446

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 445 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 386

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 385 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 332



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  315 bits (159), Expect = 8e-83
 Identities = 260/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 532 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 473

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||| ||||||||||| |||||||| ||||||  ||| || |||||||| || 
Sbjct: 472 gcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgcagc 413

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||  | ||||||   | |||||| | ||||||||||||||||||||| |||||||| |  
Sbjct: 412 gcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcgcgg 353

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           || ||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 352 acgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 293

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||| ||||| || ||||| || |||||| | ||||| |||||||||||||||
Sbjct: 292 atctcacggagcgcgacggtgcccggcctgaagcggtgcggcttcttcacgccg 239



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  307 bits (155), Expect = 2e-80
 Identities = 268/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 407 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 167 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 525

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 524 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 465

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 464 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 405

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 404 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 345

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 344 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 291



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 643

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 644 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 703

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 704 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 763

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 764 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 823

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 824 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 877



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 388

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 389 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 448

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 449 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 508

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 509 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 568

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 569 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 622



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  307 bits (155), Expect = 2e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 471 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 412

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 411 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 352

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 351 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 292

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 291 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtgga 232

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||
Sbjct: 231 cttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggctt 172

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 171 cttgacgccg 162



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  307 bits (155), Expect = 2e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtgga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||
Sbjct: 171 cttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggctt 112

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 111 cttgacgccg 102



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  307 bits (155), Expect = 2e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 459 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 400

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 399 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 340

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 339 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 280

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 279 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtgga 220

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||
Sbjct: 219 cttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggctt 160

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 159 cttgacgccg 150



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  307 bits (155), Expect = 2e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtgga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||
Sbjct: 171 cttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggctt 112

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 111 cttgacgccg 102



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  307 bits (155), Expect = 2e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           ||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtgga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||
Sbjct: 171 cttctggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggctt 112

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 111 cttgacgccg 102



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                        
Query: 254  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3230 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 3171

                                                                        
Query: 314  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
            ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 3170 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 3111

                                                                        
Query: 374  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
            |||| ||||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 3110 gccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 3051

                                                                        
Query: 434  accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
            ||||| |||||||| ||||||||||||||||||||||||||   |||||||||   ||||
Sbjct: 3050 accagccgctggaagggcagcttgcggatcagcagctccgtcgacttctggtagcggcgg 2991

                                                                  
Query: 494  atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 2990 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 2937



 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                        
Query: 254  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1491 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 1550

                                                                        
Query: 314  gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
            ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 1551 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 1610

                                                                        
Query: 374  gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
            |||| ||||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 1611 gccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 1670

                                                                        
Query: 434  accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
            ||||| |||||||| ||||||||||||||||||||||||||   |||||||||   ||||
Sbjct: 1671 accagccgctggaagggcagcttgcggatcagcagctccgtcgacttctggtagcggcgg 1730

                                                                  
Query: 494  atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 1731 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 1784



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  307 bits (155), Expect = 2e-80
 Identities = 268/306 (87%)
 Strand = Plus / Plus

                                                                          
Query: 242    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
              |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                          
Query: 302    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
              |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 135711

                                                                          
Query: 362    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
              |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 135712 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 135771

                                                                          
Query: 422    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
              |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 135772 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 135831

                                                                          
Query: 482    tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
              |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 135832 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 135891

                    
Query: 542    acgccg 547
              ||||||
Sbjct: 135892 acgccg 135897



 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                          
Query: 242    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
              |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                          
Query: 302    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
              |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 143168

                                                                          
Query: 362    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
              |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 143167 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 143108

                                                                          
Query: 422    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
              |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 143107 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 143048

                                                                          
Query: 482    tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
              |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 143047 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 142988

                    
Query: 542    acgccg 547
              ||||||
Sbjct: 142987 acgccg 142982



 Score =  291 bits (147), Expect = 1e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                          
Query: 238    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
              |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 126435 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 126376

                                                                          
Query: 298    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
               ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 126375 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 126316

                                                                          
Query: 358    ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
                  |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 126315 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 126256

                                                                          
Query: 418    ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
              |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 126255 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 126196

                                                                          
Query: 478    cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
              |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 126195 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 126136

                        
Query: 538    cttcacgccg 547
              ||||||||||
Sbjct: 126135 cttcacgccg 126126



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Plus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 148 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 207

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 208 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 267

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 268 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 327

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 328 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 387

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 388 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 441



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  307 bits (155), Expect = 2e-80
 Identities = 268/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 668

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 667 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 608

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 607 acgccg 602



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 750

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcacgc 630

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 629 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 570

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 569 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 516



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 807

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 806 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 747

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 746 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 687

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 686 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 627

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 626 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 573



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 679 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 620

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 619 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 560

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 559 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 500

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 499 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 440

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 439 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 386



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  307 bits (155), Expect = 2e-80
 Identities = 259/294 (88%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 689

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 688 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 629

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 628 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 569

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 568 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 509

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 508 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 455



to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 312

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 311 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 252

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 251 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 192

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 191 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 132

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 131 acgccg 126



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  299 bits (151), Expect = 5e-78
 Identities = 258/294 (87%)
 Strand = Plus / Plus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 392 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 451

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 452 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 511

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 512 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 571

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| ||||| |||||||||||||||||||||  |||||||||    |||
Sbjct: 572 accaggcgctggaagggcagtttgcggatcagcagctccgtggacttctggtagcgccgg 631

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 632 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 685



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||||| 
Sbjct: 167 tggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttg 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||||| 
Sbjct: 167 tggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttg 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||||| 
Sbjct: 167 tggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttg 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || ||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||||| 
Sbjct: 167 tggtagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttg 108

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 107 acgccg 102



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                        
Query: 242  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
            |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                        
Query: 302  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
            |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 2922

                                                                        
Query: 362  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
            |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 2921 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 2862

                                                                        
Query: 422  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
            |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 2861 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 2802

                                                                        
Query: 482  tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
            |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 2801 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 2742

                  
Query: 542  acgccg 547
            ||||||
Sbjct: 2741 acgccg 2736



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 452 gccctctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 393

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 392 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 333

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 332 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 273

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||| |||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 272 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctcggtcgacttc 213

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| ||||| |||||||||
Sbjct: 212 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtggggcttcttc 153

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 152 acgccg 147



to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 668

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 667 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 608

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 607 acgccg 602



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  299 bits (151), Expect = 5e-78
 Identities = 258/294 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 809 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcatggatg 750

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 749 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 690

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 689 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 630

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 629 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 570

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 569 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 516



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  299 bits (151), Expect = 5e-78
 Identities = 258/294 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 883 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 824

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 823 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 764

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||| ||||||||||||||||| | |
Sbjct: 763 gccatgacggccgagctctggaagcgcaggtcggtcttaaagtcctgcgcgatctcgcgc 704

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 703 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 644

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 643 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 590



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  299 bits (151), Expect = 5e-78
 Identities = 258/294 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 555 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgcatg 496

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 495 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 436

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 435 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 376

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           |||||||||||||| |||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 375 accaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 316

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||| || ||||||| ||| ||||| |||||||||||||||
Sbjct: 315 atctcgcgcagcgccaccgtgccgggccggtagcggtgcggcttcttcacgccg 262



to top

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  299 bits (151), Expect = 5e-78
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 557 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 498

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 497 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 438

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 437 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 378

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 377 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 318

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 317 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 258

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 257 acgccg 252



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  293 bits (148), Expect = 3e-76
 Identities = 264/303 (87%)
 Strand = Plus / Minus

                                                                       
Query: 245 ctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 304
           ||||| || ||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                       
Query: 305 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcc 364
           |||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   |||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcc 378

                                                                       
Query: 365 tcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcg 424
           ||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||||||
Sbjct: 377 tcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 318

                                                                       
Query: 425 atctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctgg 484
           ||||| | |||||||||||||||||||||||||||||||||||||||||||  |||||||
Sbjct: 317 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctgg 258

                                                                       
Query: 485 tacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacg 544
           ||    ||||||||||| |||||||| || ||||||| ||| ||||| |||||||| |||
Sbjct: 257 tagcgccggatctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttgacg 198

              
Query: 545 ccg 547
           |||
Sbjct: 197 ccg 195



to top

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  291 bits (147), Expect = 1e-75
 Identities = 267/306 (87%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 410 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 351

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||| ||||||||||||||||| || || || || ||||| ||||||   
Sbjct: 350 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 292

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 291 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 232

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 231 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttc 172

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||   |||||||||||| |||||||| || ||||| | ||| |||||||||||||||
Sbjct: 171 tggtagcggcggatctcgcgcagggccaccgtgccggggcggtagcggtgaggcttcttc 112

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 111 acgccg 106



to top

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  291 bits (147), Expect = 1e-75
 Identities = 267/306 (87%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 436 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 377

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||| ||||||||||||||||| || || || || ||||| ||||||   
Sbjct: 376 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 318

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 317 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 258

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 257 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttc 198

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||   |||||||||||| |||||||| || ||||| | ||| |||||||||||||||
Sbjct: 197 tggtagcggcggatctcgcgcagggccaccgtgccggggcggtagcggtgaggcttcttc 138

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 137 acgccg 132



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  291 bits (147), Expect = 1e-75
 Identities = 257/294 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||| ||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 335 gcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgcagc 276

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||||||||||||||||||||||||||| | |
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 216

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           ||||||||||||||||||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 215 accaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 156

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| |||||||| || ||||||| ||| ||||| |||||||| ||||||
Sbjct: 155 atctcgcgcagggccaccgtgccgggccggtagcggtgcggcttcttgacgccg 102



to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  291 bits (147), Expect = 1e-75
 Identities = 266/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || ||||||||||| || ||||||||||| ||||||||||||||||| | |
Sbjct: 644 gccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgaccctc 585

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||||||||| || || ||||| ||||||   
Sbjct: 584 ttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcgctc 525

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| ||||||| ||| ||   |  |||||| |  ||||| |||||||||||||||
Sbjct: 524 gcctcctgcagggccatcacagccgagctctggaagcgcaggtccgtcttgaagtcctgc 465

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||||||||||||||||||||| |||||||||||||| ||||||||||||  ||||
Sbjct: 464 gcgatctccctcaccaggcgctggaagggcagcttgcggatgagcagctccgtggacttc 405

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    |||||||| || |||||||| || ||||||| ||| |||||||||||||||
Sbjct: 404 tggtagcgccggatctcccgcagggccaccgtgccgggccggtagcggtgaggcttcttc 345

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 344 acgccg 339



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  291 bits (147), Expect = 1e-75
 Identities = 269/310 (86%)
 Strand = Plus / Plus

                                                                        
Query: 238  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
            |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 2126 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 2185

                                                                        
Query: 298  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
             ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 2186 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 2245

                                                                        
Query: 358  ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
                |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 2246 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 2305

                                                                        
Query: 418  ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
            |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 2306 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 2365

                                                                        
Query: 478  cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
            |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 2366 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 2425

                      
Query: 538  cttcacgccg 547
            ||||||||||
Sbjct: 2426 cttcacgccg 2435



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  291 bits (147), Expect = 1e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 424 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 365

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 364 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 305

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 304 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 245

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 244 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 185

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 184 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 125

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 124 cttcacgccg 115



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  291 bits (147), Expect = 1e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 762 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 703

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 702 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 643

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 642 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 583

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 582 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 523

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 522 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 463

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 462 cttcacgccg 453



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  291 bits (147), Expect = 1e-75
 Identities = 257/294 (87%)
 Strand = Plus / Plus

                                                                          
Query: 254    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
              |||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 102364 cggatgcggcgggccagctggatgtctttgggcatgatggtgacccgcttggcgtggatg 102423

                                                                          
Query: 314    gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
              |||||||||||||||||||||||||| || || ||||| ||||||   | |||||| |||
Sbjct: 102424 gcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcgctggactcctgcagg 102483

                                                                          
Query: 374    gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
              ||||  ||||||  |  |||||| |  ||||||||||||||||||||||||||||||| |
Sbjct: 102484 gccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcccgc 102543

                                                                          
Query: 434    accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
              || ||||||||||| ||||||||||||||||||||||| |||  |||||||||   ||||
Sbjct: 102544 acgaggcgctggaagggcagcttgcggatcagcagctcggtggacttctggtagcggcgg 102603

                                                                    
Query: 494    atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
              ||||| |  ||||||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 102604 atctccctcagggccacggtgccgggccggtaacggtgcggcttcttcacgccg 102657



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  291 bits (147), Expect = 1e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 911 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 852

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 851 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 792

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 791 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 732

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 731 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 672

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 671 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 612

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 611 cttcacgccg 602



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  291 bits (147), Expect = 1e-75
 Identities = 266/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 745 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 686

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||    
Sbjct: 685 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 626

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 625 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 566

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 565 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 506

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| ||||||||||| ||||| | ||| |||||||||||||||
Sbjct: 505 tggtagcgccggatctcgcgcagggccacggtgccgggacggtagcggtgaggcttcttc 446

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 445 acgccg 440



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  289 bits (146), Expect = 5e-75
 Identities = 259/297 (87%)
 Strand = Plus / Minus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2539 ccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 2480

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 2479 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2420

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 2419 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 2360

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 2359 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 2300

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            ||||||||||| || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 2299 cggatctcgcgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 2243



to top

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score =  289 bits (146), Expect = 5e-75
 Identities = 233/262 (88%)
 Strand = Plus / Minus

                                                                        
Query: 237  cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 296
            ||||||| | ||||||||||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 1162 cttacgcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtga 1103

                                                                        
Query: 297  cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 356
            |||||||||||||||||||||| ||||| |||||||||||||  || || ||||| ||||
Sbjct: 1102 cgcgcttggcgtggatggcgcaaaggttagtgtcctcgaacaagcccaccaggtaggcct 1043

                                                                        
Query: 357  cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 416
            | ||||||||||| || |||||||| || |||  |||||| |  || |||||||||||||
Sbjct: 1042 cagcagcctcctgcagcgccagcaccgcctggctctggaagcgcagatcggtcttgaagt 983

                                                                        
Query: 417  cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgc 476
            |||| |||||||| | |||||| |||||||| || ||||||||||| |||||||||||||
Sbjct: 982  cctgagcgatctcgcgcaccagccgctggaaggggagcttgcggatgagcagctccgtgc 923

                                  
Query: 477  tcttctggtacttgcggatctc 498
            ||||||||||||||||||||||
Sbjct: 922  tcttctggtacttgcggatctc 901



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  289 bits (146), Expect = 5e-75
 Identities = 259/297 (87%)
 Strand = Plus / Plus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 209 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 268

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           |||||||||||||||||| |||||||||||||| || || ||||| ||||| || |||||
Sbjct: 269 gtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctcagcggcctc 328

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||||||||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 329 ctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 388

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  ||||||||||||||||||||||||||||| |  ||||| ||   |||||||||
Sbjct: 389 ctcacggaccaggcgctggaacggcagcttgcggatgacgagctcagtcgacttctggta 448

                                                                    
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcac 543
           |||||||||||| || || |||||||| ||||| | ||| || ||||||||||||||
Sbjct: 449 cttgcggatctcacgcagcgccacggtaccggggcggtaccgatgaggcttcttcac 505



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  289 bits (146), Expect = 5e-75
 Identities = 259/297 (87%)
 Strand = Plus / Plus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           ||||||||||||||||||||| ||||||||||||||||||||||| || || ||||||||
Sbjct: 253 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggc 312

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           ||||||||||||||||||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 313 gtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctc 372

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||||||||||| |||   ||||| |  |||||||||||||||||||| || ||
Sbjct: 373 ctgtagcgccagcacggcctggctttggaaacgcaggtcggtcttgaagtcctgggcaat 432

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  ||||||||||||||||||||||||||||| |||||||| ||   |||||| ||
Sbjct: 433 ctcacggaccaggcgctggaacggcagcttgcggatgagcagctctgtcgacttctgata 492

                                                                    
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcac 543
            ||||||||||| || || |||||||| ||||| | ||| || ||||||||||||||
Sbjct: 493 tttgcggatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcac 549



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  285 bits (144), Expect = 7e-74
 Identities = 268/307 (87%), Gaps = 2/307 (0%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || | ||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 932 gccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgc 873

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||| ||||| |||||||| || ||||| |||||||| |||||||| 
Sbjct: 872 ttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctcggcg 813

                                                                       
Query: 362 gcctcctggagggccagc-acggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
           |||||||| || | |||| ||||||  ||||||||| | ||| |||||||||||||||||
Sbjct: 812 gcctcctgcagcg-cagcgacggcggaggactggaagcggagatcggtcttgaagtcctg 754

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           ||||||||| |  || ||||||||||| |||| ||||||||| |||||||||||||||||
Sbjct: 753 cgcgatctcacggacgaggcgctggaagggcaacttgcggatgagcagctccgtgctctt 694

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||||| || ||||| ||||| || ||||| ||||| | | | ||||| ||||||||
Sbjct: 693 ctggtacttacgaatctcccggagcgcgacggtgccggggcggaagcggtggggcttctt 634

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 633 cacgccg 627



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 808

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 807 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 748

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 747 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 688

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 687 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 628

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 627 acgccg 622



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| |  ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 325 acaggcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 266

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 265 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 206

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 205 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 146

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 145 cttcacgccg 136



to top

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 351 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 231 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 171 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 112

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 111 cttcacgccg 102



to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 710 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 651

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||| |||||||||||||||||||| || || || ||||| ||||||   
Sbjct: 650 ttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctcgcac 591

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 590 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 531

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 530 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttc 471

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||   |||||||||||| || || || || ||||| | ||| ||||| |||||||||
Sbjct: 470 tggtagcggcggatctcgcgcagagctaccgtgccggggcggtagcggtgcggcttcttc 411

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 410 acgccg 405



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 438 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 379

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||    
Sbjct: 378 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 319

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 318 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 259

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 258 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 199

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 198 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 139

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 138 acgccg 133



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 242   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 90487 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 90546

                                                                         
Query: 302   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
             |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 90547 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 90606

                                                                         
Query: 362   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
             |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 90607 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 90666

                                                                         
Query: 422   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
             |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 90667 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 90726

                                                                         
Query: 482   tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
             |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 90727 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 90786

                   
Query: 542   acgccg 547
             ||||||
Sbjct: 90787 acgccg 90792



 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Plus

                                                                         
Query: 238   ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
             |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 59166 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 59225

                                                                         
Query: 298   gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
              ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 59226 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 59285

                                                                         
Query: 358   ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
             |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 59286 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 59345

                                                                         
Query: 418   ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
             |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 59346 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 59405

                                                                         
Query: 478   cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
             |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 59406 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 59465

                       
Query: 538   cttcacgccg 547
             ||||||||||
Sbjct: 59466 cttcacgccg 59475



 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 242   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 73419 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 73360

                                                                         
Query: 302   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
             |||||||||||||||||||||||||||||||| ||||| || || ||||| ||||||   
Sbjct: 73359 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 73300

                                                                         
Query: 362   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
             |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 73299 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 73240

                                                                         
Query: 422   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
             |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 73239 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 73180

                                                                         
Query: 482   tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
             |||||    ||||| ||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 73179 tggtagcgccggatttcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 73120

                   
Query: 542   acgccg 547
             ||||||
Sbjct: 73119 acgccg 73114



 Score =  270 bits (136), Expect = 4e-69
 Identities = 267/311 (85%)
 Strand = Plus / Plus

                                                                         
Query: 237   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 296
             |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 99521 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 99580

                                                                         
Query: 297   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 356
             | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 99581 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 99640

                                                                         
Query: 357   cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 416
             |    |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||
Sbjct: 99641 cacaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagt 99700

                                                                         
Query: 417   cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgc 476
             ||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||  
Sbjct: 99701 cctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcg 99760

                                                                         
Query: 477   tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggct 536
              |||||||||    ||||||||||| || ||||| || ||||| | ||| ||||||||||
Sbjct: 99761 acttctggtagcgccggatctcgcgcagcgccacagtgccgggacggtagcggtgaggct 99820

                        
Query: 537   tcttcacgccg 547
             |||||||||||
Sbjct: 99821 tcttcacgccg 99831



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 840 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 781

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 780 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 721

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 720 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 661

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 660 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 601

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 600 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 541

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 540 acgccg 535



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                         
Query: 238   ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
             |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 56818 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 56759

                                                                         
Query: 298   gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
              ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 56758 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 56699

                                                                         
Query: 358   ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
             |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 56698 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 56639

                                                                         
Query: 418   ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
             |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 56638 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 56579

                                                                         
Query: 478   cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
             |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 56578 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 56519

                       
Query: 538   cttcacgccg 547
             ||||||||||
Sbjct: 56518 cttcacgccg 56509



 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                         
Query: 242   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 25493 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 25434

                                                                         
Query: 302   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
             |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 25433 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 25374

                                                                         
Query: 362   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
             |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 25373 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 25314

                                                                         
Query: 422   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
             |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 25313 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 25254

                                                                         
Query: 482   tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
             |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 25253 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 25194

                   
Query: 542   acgccg 547
             ||||||
Sbjct: 25193 acgccg 25188



 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Plus

                                                                         
Query: 242   gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
             |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 42565 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 42624

                                                                         
Query: 302   ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
             |||||||||||||||||||||||||||||||| ||||| || || ||||| ||||||   
Sbjct: 42625 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 42684

                                                                         
Query: 362   gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
             |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 42685 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 42744

                                                                         
Query: 422   gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
             |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 42745 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 42804

                                                                         
Query: 482   tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
             |||||    ||||| ||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 42805 tggtagcgccggatttcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 42864

                   
Query: 542   acgccg 547
             ||||||
Sbjct: 42865 acgccg 42870



 Score =  270 bits (136), Expect = 4e-69
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                         
Query: 237   cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 296
             |||| |||||||| || |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 16459 cttaagccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtga 16400

                                                                         
Query: 297   cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 356
             | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 16399 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 16340

                                                                         
Query: 357   cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 416
             |    |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||
Sbjct: 16339 cacaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagt 16280

                                                                         
Query: 417   cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgc 476
             ||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||  
Sbjct: 16279 cctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcg 16220

                                                                         
Query: 477   tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggct 536
              |||||||||    ||||||||||| || ||||| || ||||| | ||| ||||||||||
Sbjct: 16219 acttctggtagcgccggatctcgcgcagcgccacagtgccgggacggtagcggtgaggct 16160

                        
Query: 537   tcttcacgccg 547
             |||||||||||
Sbjct: 16159 tcttcacgccg 16149



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                          
Query: 242    gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
              |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 139055 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 138996

                                                                          
Query: 302    ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
              |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||    
Sbjct: 138995 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 138936

                                                                          
Query: 362    gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
              |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 138935 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 138876

                                                                          
Query: 422    gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
              |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 138875 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 138816

                                                                          
Query: 482    tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
              |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 138815 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 138756

                    
Query: 542    acgccg 547
              ||||||
Sbjct: 138755 acgccg 138750



 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Plus

                                                                          
Query: 238    ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
              |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 203950 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 204009

                                                                          
Query: 298    gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
               ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 204010 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 204069

                                                                          
Query: 358    ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
                  |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 204070 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 204129

                                                                          
Query: 418    ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
              |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 204130 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 204189

                                                                          
Query: 478    cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
              |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 204190 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 204249

                        
Query: 538    cttcacgccg 547
              ||||||||||
Sbjct: 204250 cttcacgccg 204259



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                        
Query: 238  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
            |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 2012 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 1953

                                                                        
Query: 298  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
             ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 1952 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 1893

                                                                        
Query: 358  ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
            |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 1892 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 1833

                                                                        
Query: 418  ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
            |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 1832 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 1773

                                                                        
Query: 478  cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
            |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 1772 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 1713

                      
Query: 538  cttcacgccg 547
            ||||||||||
Sbjct: 1712 cttcacgccg 1703



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                        
Query: 238  ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
            |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 2010 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 1951

                                                                        
Query: 298  gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
             ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 1950 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 1891

                                                                        
Query: 358  ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
            |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 1890 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 1831

                                                                        
Query: 418  ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
            |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 1830 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 1771

                                                                        
Query: 478  cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
            |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 1770 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 1711

                      
Query: 538  cttcacgccg 547
            ||||||||||
Sbjct: 1710 cttcacgccg 1701



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 429 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 370

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 369 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 310

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 309 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 250

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 249 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 190

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 189 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 130

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 129 acgccg 124



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F),
           histone H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Plus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 87  ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 146

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 147 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 206

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 207 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 266

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 267 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 326

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 327 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 386

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 387 cttcacgccg 396



to top

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 445 ttacgccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgac 386

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 385 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 326

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| |  ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 325 acaggcctcctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 266

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 265 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 206

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 205 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 146

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 145 cttcacgccg 136



to top

>gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, complete cds
          Length = 2249

 Score =  283 bits (143), Expect = 3e-73
 Identities = 268/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 950 ttacgccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgac 891

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 890 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 831

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 830 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 771

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 770 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 711

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 710 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 651

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 650 cttcacgccg 641



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 927 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 868

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || |||||||| ||||||   
Sbjct: 867 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 808

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 807 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 748

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 747 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 688

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||| ||||||
Sbjct: 687 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggtttcttc 628

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 627 acgccg 622



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  283 bits (143), Expect = 3e-73
 Identities = 265/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||||||||||||||| ||||| || || ||||| |||||    
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   ||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttc 668

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||||||
Sbjct: 667 tggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggcttcttc 608

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 607 acgccg 602



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 533 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 474

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 473 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 414

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 413 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 354

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 353 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 294

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 293 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 237



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1551

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 1550 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 1491

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 1490 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 1434



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1671

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1611

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1551

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 1550 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 1491

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 1490 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 1434



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Plus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1200 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1259

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1260 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 1319

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 1320 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 1379

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 1380 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 1439

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 1440 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 1496



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 2713 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 2654

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 2653 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 2594

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 2593 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 2534

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 2533 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 2474

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 2473 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 2417



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 659

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 658 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 602



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 599 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 540

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 539 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 480

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 479 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 420

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 419 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 360

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 359 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 303



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 659

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 658 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 602



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 898 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 839

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 778 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 719

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 659

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 658 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 602



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 1084 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 1025

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 1024 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 965

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 964  agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 905

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 904  cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 845

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 844  cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 788



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 251   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 93730 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 93671

                                                                         
Query: 311   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 93670 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 93611

                                                                         
Query: 371   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 93610 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 93551

                                                                         
Query: 431   ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
             | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 93550 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 93491

                                                                      
Query: 491   cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 93490 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 93434



 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 251   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 71922 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 71863

                                                                         
Query: 311   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 71862 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 71803

                                                                         
Query: 371   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 71802 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 71743

                                                                         
Query: 431   ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
             | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 71742 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 71683

                                                                      
Query: 491   cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 71682 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 71626



 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Plus

                                                                         
Query: 251   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 63183 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 63242

                                                                         
Query: 311   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 63243 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 63302

                                                                         
Query: 371   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 63303 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 63362

                                                                         
Query: 431   ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
             | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 63363 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 63422

                                                                      
Query: 491   cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 63423 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 63479



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 251   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 37510 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 37451

                                                                         
Query: 311   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 37450 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 37391

                                                                         
Query: 371   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 37390 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 37331

                                                                         
Query: 431   ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
             | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 37330 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 37271

                                                                      
Query: 491   cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 37270 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 37214



 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Plus

                                                                         
Query: 251   ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
             ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 28771 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 28830

                                                                         
Query: 311   atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
             |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 28831 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 28890

                                                                         
Query: 371   agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
             || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 28891 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 28950

                                                                         
Query: 431   ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
             | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 28951 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 29010

                                                                      
Query: 491   cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
             |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 29011 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 29067



 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Plus

                                                                        
Query: 251  ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
            ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 6963 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 7022

                                                                        
Query: 311  atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
            |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 7023 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 7082

                                                                        
Query: 371  agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
            || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 7083 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 7142

                                                                        
Query: 431  ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
            | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 7143 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 7202

                                                                     
Query: 491  cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
            |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 7203 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 7259



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 398 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 339

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 279

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 278 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 219

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 218 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 159

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 158 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 102



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  281 bits (142), Expect = 1e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 737 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 678

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 677 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 618

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 617 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 558

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||   |||||||||    
Sbjct: 557 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgacttctggtagcgc 498

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 497 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 441



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  278 bits (140), Expect = 2e-71
 Identities = 268/311 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 296
           |||| |||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||
Sbjct: 410 cttaagcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtga 351

                                                                       
Query: 297 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 356
           | ||||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||
Sbjct: 350 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcct 291

                                                                       
Query: 357 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 416
           |    |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||
Sbjct: 290 cacaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagt 231

                                                                       
Query: 417 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgc 476
           ||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||  
Sbjct: 230 cctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcg 171

                                                                       
Query: 477 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggct 536
            |||||||||    ||||||||||| || |||||||| ||||| | ||| ||||||||||
Sbjct: 170 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggct 111

                      
Query: 537 tcttcacgccg 547
           |||||||||||
Sbjct: 110 tcttcacgccg 100



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 467 gccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 408

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           ||||||||||||||||||||| | |||||||| || ||||| || ||||| |||||||| 
Sbjct: 407 ttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctcggcg 348

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || ||    ||||||  ||||||||| | ||| |||||||||||| |||||
Sbjct: 347 gcctcctgcagcgcagagacggcggaggactggaagcggagatcggtcttgaagccctgc 288

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| |  || ||||||||||| |||| ||||||||| ||||||||||||||||||
Sbjct: 287 gcgatctcacggacgaggcgctggaagggcaacttgcggatgagcagctccgtgctcttc 228

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           ||| |||| || ||||| ||||| |||||||| ||||| | | | ||||| |||||||||
Sbjct: 227 tgggacttacgaatctcccggagcgccacggtgccggggcggaagcggtggggcttcttc 168

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 167 acgccg 162



to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtgga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||   ||||||||| |  |||||||| || ||||| | ||| ||||| |||||
Sbjct: 171 cttctggtaacggcggatctctctcagggccaccgtgccggggcggtagcggtgcggctt 112

                 
Query: 538 cttcac 543
           ||||||
Sbjct: 111 cttcac 106



to top

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || ||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 411 ttacgccctctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||| |||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgcagagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           ||| |||||||| | |||||| ||||||||||| |||||||||||||||||||| ||   
Sbjct: 231 ctgtgcgatctcgcgcaccagccgctggaacggtagcttgcggatcagcagctctgtaga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||   |||||||||||| ||||||||||| || |||| ||| |||||||||||
Sbjct: 171 cttctggtagcggcggatctcgcgcagggccacggtgccaggccggtagcggtgaggctt 112

                 
Query: 538 cttcac 543
           ||||||
Sbjct: 111 cttcac 106



to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  276 bits (139), Expect = 7e-71
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 411 ttacgccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||| || ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||
Sbjct: 291 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 232

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtgga 172

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||   ||||||||| |  |||||||| || || || | ||| ||||| |||||
Sbjct: 171 cttctggtaacggcggatctctctcagggccaccgtgccagggcggtagcggtgcggctt 112

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 111 cttcacgccg 102



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  276 bits (139), Expect = 7e-71
 Identities = 261/302 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||| || ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| || |||| ||| ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           |||||||| | |||||| ||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttc 168

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||   ||||||||| |  |||||||| || ||||| | ||| ||||| |||||||||
Sbjct: 167 tggtaacggcggatctctctcagggccaccgtgccggggcggtagcggtgcggcttcttc 108

             
Query: 542 ac 543
           ||
Sbjct: 107 ac 106



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  276 bits (139), Expect = 7e-71
 Identities = 255/294 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 330

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           ||||| ||||||||||||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 329 accagccgctggaacggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 270

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| |||||||| || || |||| ||| ||||| |||||||| ||||||
Sbjct: 269 atctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccg 216



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  276 bits (139), Expect = 7e-71
 Identities = 255/294 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 450

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 449 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 390

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 389 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 330

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           ||||| ||||||||||||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 329 accagccgctggaacggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 270

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| |||||||| || || |||| ||| ||||| |||||||| ||||||
Sbjct: 269 atctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccg 216



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  276 bits (139), Expect = 7e-71
 Identities = 255/294 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 313
           ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 314 gcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagg 373
           ||||||||||||||||||||||| ||||| || ||||| ||||||   |||||||| || 
Sbjct: 335 gcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctcctgcagc 276

                                                                       
Query: 374 gccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctc 433
           ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| | |
Sbjct: 275 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 216

                                                                       
Query: 434 accaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcgg 493
           ||||| ||||||||||||||||||||||||||||||||||||  |||||||||    |||
Sbjct: 215 accagccgctggaacggcagcttgcggatcagcagctccgtggacttctggtagcgccgg 156

                                                                 
Query: 494 atctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| |||||||| || || |||| ||| ||||| |||||||| ||||||
Sbjct: 155 atctcgcgcagggccaccgtgcccggccggtagcggtgcggcttcttgacgccg 102



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  276 bits (139), Expect = 7e-71
 Identities = 267/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 851 ttacgccctctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgac 792

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || |||||||| |||||
Sbjct: 791 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctc 732

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 731 acaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 672

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           ||| |||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 671 ctgtgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 612

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| ||||| |||||
Sbjct: 611 cttctggtagcgtcggatctcgcgcagcgccacggtgccgggacggtagcggtggggctt 552

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 551 cttcacgccg 542



to top

>ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (predicted)
           (Hist1h4a_predicted), mRNA
          Length = 428

 Score =  276 bits (139), Expect = 7e-71
 Identities = 264/306 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 408 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 349

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||||||||||||||| ||||||||||| ||||| || |||||||| ||||||   
Sbjct: 348 ttggcgtggatggcgcacagattggtgtcctcaaacagacccacaaggtaggcctcgctg 289

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||||  || ||   |  |||||| |  |||||||||||||||||||||
Sbjct: 288 gcctcctgaagggccatgaccgccgagctctggaagcgaaggtcggtcttgaagtcctgc 229

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           ||||| || | ||||||||||||||||||||||||||||||||||||||| |||  ||||
Sbjct: 228 gcgatttcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtggacttc 169

                                                                       
Query: 482 tggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttc 541
           |||||    ||||||||||| || || ||||| ||||| | ||| ||||| |||||||||
Sbjct: 168 tggtagcgccggatctcgcgcagagcaacggtgccgggacggtagcggtggggcttcttc 109

                 
Query: 542 acgccg 547
           ||||||
Sbjct: 108 acgccg 103



to top

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  274 bits (138), Expect = 3e-70
 Identities = 242/277 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtc 330
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 331 ctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtggga 390
           |||||| ||||| || ||||| ||||||   |||||||| || ||||  |||||   |  
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                                                       
Query: 391 ctggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacgg 450
           |||||| |  ||||||||||||||||||||||||||||| | ||||||||||||||||||
Sbjct: 330 ctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaacgg 271

                                                                       
Query: 451 cagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccac 510
           |||||||||||||||||||||||||  |||||||||    ||||||||||| ||||||||
Sbjct: 270 cagcttgcggatcagcagctccgtggacttctggtagcgccggatctcgcgcagggccac 211

                                                
Query: 511 ggtcccgggcctgtancggtgaggcttcttcacgccg 547
            || ||||||| ||| ||||| |||||||| ||||||
Sbjct: 210 cgtgccgggccggtagcggtgcggcttcttgacgccg 174



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  274 bits (138), Expect = 3e-70
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 978 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 919

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 918 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 859

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 858 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 799

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||    ||||||||    
Sbjct: 798 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgatttctggtagcgc 739

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 738 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 682



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  274 bits (138), Expect = 3e-70
 Identities = 257/297 (86%)
 Strand = Plus / Plus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           ||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||
Sbjct: 523 ccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggcgtgg 582

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           |||||||||||||||||||||||||||||||| || ||||| ||||||   |||||||| 
Sbjct: 583 atggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgc 642

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  |||||   |  |||||| |  ||||| ||||||||||||||||||||||| 
Sbjct: 643 agcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcg 702

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           | ||||||||||||||||||||||||||||||||||||||| ||    ||||||||    
Sbjct: 703 cgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcgatttctggtagcgc 762

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||| ||||||| ||| ||||| |||||||||||||||
Sbjct: 763 cggatctcccgcagcgccacggtgccgggccggtagcggtgcggcttcttcacgccg 819



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  274 bits (138), Expect = 3e-70
 Identities = 257/297 (86%)
 Strand = Plus / Plus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           ||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 275 ctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggc 334

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           |  |||||||||||||||||||||||||||||| || || ||||| ||||| || |||||
Sbjct: 335 ggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcagcggcctc 394

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| || ||||  ||||| |||  |||||| |  |||||||||||||||||||| || ||
Sbjct: 395 ctgcagcgccacgacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaat 454

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
           ||| |  ||||||||||||||||||||||||||||| |||||||| ||   |||||||||
Sbjct: 455 ctcacggaccaggcgctggaacggcagcttgcggatgagcagctcagtcgacttctggta 514

                                                                    
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcac 543
           |||||| ||||| || || |||||||| ||||| | ||| || ||||||||||||||
Sbjct: 515 cttgcgaatctcacgcagcgccacggtaccggggcggtagcgatgaggcttcttcac 571



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  272 bits (137), Expect = 1e-69
 Identities = 236/269 (87%)
 Strand = Plus / Minus

                                                                        
Query: 242  gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
            |||| ||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 1510 gcccgctcgccacgaatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 1451

                                                                        
Query: 302  ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
            |||||||||||||||||||||||||| ||||||||||| || || ||||| |||||||||
Sbjct: 1450 ttggcgtggatggcgcacaggttggtatcctcgaacaggcccaccaggtaggcctcggca 1391

                                                                        
Query: 362  gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
            |||||||| || ||||||||||| |||  |||||| |  || || |||||||||||||| 
Sbjct: 1390 gcctcctgcagcgccagcacggcctggctctggaagcgcagatccgtcttgaagtcctgg 1331

                                                                        
Query: 422  gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
            || ||||| | |||||| |||||||| || |||||||| || |||||||| || ||||||
Sbjct: 1330 gcaatctcgcgcaccagccgctggaaaggaagcttgcgaataagcagctcagtactcttc 1271

                                         
Query: 482  tggtacttgcggatctcgcggagggccac 510
            |||||||| || ||||||||||| |||||
Sbjct: 1270 tggtacttacgaatctcgcggagagccac 1242



to top

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  270 bits (136), Expect = 4e-69
 Identities = 231/263 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||||||||| ||||||   |||||||| || ||||  ||||||  |  |||||||
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | |||||| ||||||||||||||||| ||||| | ||||||||||||||| |||||||||
Sbjct: 248 cggaggtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttg 189

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| |||||||||||||||||||||||    ||||||||||| ||||| ||||| |||
Sbjct: 188 cggatgagcagctccgtgctcttctggtagcgacggatctcgcgcagggcgacggtgccg 129

                                  
Query: 518 ggcctgtancggtgaggcttctt 540
           |||||||| ||||| || |||||
Sbjct: 128 ggcctgtagcggtggggtttctt 106



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  270 bits (136), Expect = 4e-69
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 237 cttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 296
           |||| |||||||| || |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 593 cttaagccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtga 534

                                                                       
Query: 297 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcct 356
           | ||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||
Sbjct: 533 cacgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcct 474

                                                                       
Query: 357 cggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagt 416
           |    |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||
Sbjct: 473 cacaggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagt 414

                                                                       
Query: 417 cctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgc 476
           ||||||||||||| | ||| || |||||||||||||||||||||||||||||||| ||  
Sbjct: 413 cctgcgcgatctcgcgcactagccgctggaacggcagcttgcggatcagcagctcggtcg 354

                                                                       
Query: 477 tcttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggct 536
            |||||||||    ||||||||||| || |||||||| ||||| | ||| ||||| ||||
Sbjct: 353 acttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtggggct 294

                      
Query: 537 tcttcacgccg 547
           |||||||||||
Sbjct: 293 tcttcacgccg 283



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 407 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 348

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 347 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 288

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 287 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 228

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 227 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 168

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 167 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 108

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 107 cttcacgccg 98



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 439 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 380

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 379 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 320

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 319 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 260

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 259 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 200

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 199 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 140

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 139 cttcacgccg 130



to top

>dbj|AK020421.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430017D03 product:histone 2, H3c2, full insert
           sequence
          Length = 1251

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 451 ttacgccctctccccccgaatgcgacgggccagctggatgtccttgggcataatggtgac 392

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||| ||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 391 acgcttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctc 332

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| || ||||  |||||   |  |||||| |  |||||||||||||||||
Sbjct: 331 gctcgcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtc 272

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 271 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 212

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 211 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 152

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 151 cttcacgccg 142



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 557 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 498

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 497 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 438

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 437 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 378

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 377 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 318

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 317 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 258

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 257 cttcacgccg 248



to top

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 911 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 852

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 851 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 792

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 791 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 732

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 731 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 672

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 671 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 612

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 611 cttcacgccg 602



to top

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  268 bits (135), Expect = 2e-68
 Identities = 266/310 (85%)
 Strand = Plus / Minus

                                                                       
Query: 238 ttacgccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 297
           |||||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 438 ttacgccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgac 379

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
            ||||||||||||||||||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 378 acgcttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctc 319

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
               |||||||| || ||||  || ||   |  |||||| |  |||||||||||||||||
Sbjct: 318 acaggcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtc 259

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           |||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||   
Sbjct: 258 ctgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctcggtcga 199

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    ||||||||||| || |||||||| ||||| | ||| |||||||||||
Sbjct: 198 cttctggtagcgccggatctcgcgcagcgccacggtgccgggacggtagcggtgaggctt 139

                     
Query: 538 cttcacgccg 547
           ||||||||||
Sbjct: 138 cttcacgccg 129



to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  260 bits (131), Expect = 4e-66
 Identities = 235/270 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| ||||||   |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  ||||||||||||||||||||||||||||| | ||| ||||||||||| |||||||||
Sbjct: 248 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcactaggcgctggaagggcagcttg 189

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| |||||||| ||||||||||||||   |||||| ||||||||||| || || |||
Sbjct: 188 cggatgagcagctcggtgctcttctggtagcggcggatttcgcggagggcgactgtgccg 129

                                         
Query: 518 ggcctgtancggtgaggcttcttcacgccg 547
           |||||||| ||||| |||||||| ||||||
Sbjct: 128 ggcctgtagcggtggggcttcttgacgccg 99



to top

>gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  260 bits (131), Expect = 4e-66
 Identities = 226/258 (87%)
 Strand = Plus / Minus

                                                                       
Query: 283 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 342
           |||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggcc 295

                                                                       
Query: 343 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 402
           ||||||||| ||||||   |||||||| || ||||  ||||||  |  |||||||| |||
Sbjct: 294 gacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaaccggag 235

                                                                       
Query: 403 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 462
           ||| ||||||||||||||||| ||||| | ||||||||||||||| ||||||||||||||
Sbjct: 234 gtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttgcggat 175

                                                                       
Query: 463 cagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcct 522
            |||||||||||||||||||||||    ||||||||||| ||||| ||||| ||||||||
Sbjct: 174 gagcagctccgtgctcttctggtagcgacggatctcgcgcagggcgacggtgccgggcct 115

                             
Query: 523 gtancggtgaggcttctt 540
           ||| ||||| || |||||
Sbjct: 114 gtagcggtggggtttctt 97



to top

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  260 bits (131), Expect = 4e-66
 Identities = 235/270 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| ||||||   ||||||||||||||||  || ||   |  |||||| 
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | ||||||||||||||||||||||||||| || | ||||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgcgcgatttcacgcaccaggcgctggaagggcagcttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| |||||||| ||||||||||||||    |||||||| || |||||||| || |||
Sbjct: 191 cggatgagcagctcagtgctcttctggtagcgacggatctcacgaagggccacagtgccg 132

                                         
Query: 518 ggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || ||||||||||||||||||
Sbjct: 131 ggcctgtaacgatgaggcttcttcacgccg 102



to top

>gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds
          Length = 345

 Score =  258 bits (130), Expect = 2e-65
 Identities = 231/265 (87%)
 Strand = Plus / Minus

                                                                       
Query: 283 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 342
           |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaacagacc 286

                                                                       
Query: 343 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 402
            || ||||| ||||||   | |||||| |||||||  ||||||  |  |||||| |  ||
Sbjct: 285 caccaggtaggcctcgctggactcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 403 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 462
           |||||||||||||||||| |||||||| |  |||||||||||||| ||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgggcgatctcgcgaaccaggcgctggaagggcagcttgcggat 166

                                                                       
Query: 463 cagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcct 522
           ||||||||||||||||||||||||    |||||||| || || |||||||| ||||||||
Sbjct: 165 cagcagctccgtgctcttctggtagcgacggatctctcgcagagccacggtgccgggcct 106

                                    
Query: 523 gtancggtgaggcttcttcacgccg 547
           ||| |||||||||||||||||||||
Sbjct: 105 gtagcggtgaggcttcttcacgccg 81



to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  252 bits (127), Expect = 1e-63
 Identities = 231/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| |||||||  |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | ||||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 248 cggaggtcggtcttgaagtcctgggcgatctcgcggaccaggcgctggaagggcagcttg 189

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||| ||||| ||||||||||||||  | | |||||| |||||||||||||| |||
Sbjct: 188 cggatcagaagctcggtgctcttctggtatctcctgatctcacggagggccacggtaccg 129

                                     
Query: 518 ggcctgtancggtgaggcttcttcac 543
           || |  || | ||| |||||||||||
Sbjct: 128 ggacgatacctgtggggcttcttcac 103



to top

>gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds
          Length = 327

 Score =  250 bits (126), Expect = 4e-63
 Identities = 216/247 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 324 cttggcgtggatggcgcacaggttggtgtcctcgaacagrccgaccaggtaagcctcgct 265

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 264 ggcctcctgaagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 205

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 204 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 145

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||| | |||||||| |  |||||||||| |||||||||||| || || ||||||||
Sbjct: 144 ctggtacctacggatctctctcagggccacggwcccgggcctgtaacgatggggcttctt 85

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 84  cacgccg 78



to top

>gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, partial cds
          Length = 355

 Score =  250 bits (126), Expect = 4e-63
 Identities = 233/269 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 351 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaac 292

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   |||||||| |||||||  ||||||  |  |||||| 
Sbjct: 291 agaccaaccaggtaggcctcgctggcctcctgcagggccatgacggcgctgctctggaaa 232

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| |||||||| | ||||||||||||||| |||||||||
Sbjct: 231 cgcaggtcggtcttgaagtcctgagcgatctcacgcaccaggcgctggaagggcagcttg 172

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| |||| ||| ||||||||||||||    |||||||| ||||||||||| || |||
Sbjct: 171 cggatgagcaactcagtgctcttctggtaacgacggatctcacggagggccactgtgccg 112

                                        
Query: 518 ggcctgtancggtgaggcttcttcacgcc 546
           |||||||| || || |||||||| |||||
Sbjct: 111 ggcctgtagcgatggggcttcttgacgcc 83



to top

>gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, partial cds
          Length = 357

 Score =  248 bits (125), Expect = 2e-62
 Identities = 230/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 353 tccttgggcatratggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaac 294

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   |||||||| |||||||  ||||||  |  |||||| 
Sbjct: 293 aggccaaccaggtaggcctcgctggcctcctgcagggccatgacggcggagctctggaaa 234

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||
Sbjct: 233 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 174

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||||||||| ||||||||||||||    |||||||| || |||||||| || |||
Sbjct: 173 cggatcagcagctcagtgctcttctggtagcgacggatctcacgcagggccactgtgccg 114

                                     
Query: 518 ggcctgtancggtgaggcttcttcac 543
           |||||||| || || |||||||||||
Sbjct: 113 ggcctgtagcgatggggcttcttcac 88



to top

>gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, partial cds
          Length = 401

 Score =  244 bits (123), Expect = 3e-61
 Identities = 242/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 gcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacag 321
           |||||| |||||||||||||| ||||||||||| || | ||| ||||||||||| |||| 
Sbjct: 331 gcgggccagctggatgtccttcggcatgatggtcaccctcttcgcgtggatggcacacaa 272

                                                                       
Query: 322 gttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcac 381
           |||||||||||||||||| || || ||||||||||| || |||||||| || ||||||||
Sbjct: 271 gttggtgtcctcgaacagacccaccaggtacgcctccgccgcctcctgcagcgccagcac 212

                                                                       
Query: 382 ggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcg 441
           |||||||  |||||| |  || ||||||||||||||||| |||||||| |  ||||| | 
Sbjct: 211 ggcgtggctctggaaacgcagatcggtcttgaagtcctgggcgatctcacgaaccagcct 152

                                                                       
Query: 442 ctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcg 501
           |||||| ||||||||||||||||||| ||| || ||||||||||||||||||||||| ||
Sbjct: 151 ctggaagggcagcttgcggatcagcaactcggtactcttctggtacttgcggatctcacg 92

                                                     
Query: 502 gagggccacggtcccgggcctgtancggtgaggcttcttcac 543
            || || ||||| || |||||||| || || |||||||||||
Sbjct: 91  aagagcgacggttcccggcctgtagcgatggggcttcttcac 50



to top

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  244 bits (123), Expect = 3e-61
 Identities = 233/270 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   |||||||| || |||| |||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | ||||||||||||||||||||| ||||| || | ||||||||| ||||| ||||| |||
Sbjct: 251 cggaggtcggtcttgaagtcctgtgcgatttcacgcaccaggcgttggaagggcagtttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||||||||| || |||||||||||    |||||||| || || |||||||| |||
Sbjct: 191 cggatcagcagctcggtactcttctggtagcgacggatctcacgcagagccacggtgccg 132

                                         
Query: 518 ggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||||||||||
Sbjct: 131 ggcctgtagcgatggggcttcttcacgccg 102



to top

>gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  244 bits (123), Expect = 3e-61
 Identities = 230/266 (86%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaagttggtgtcctcgaaa 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| ||||||   |||||||| ||||||| |||||||  |  |||||| 
Sbjct: 311 aggccgaccaggtaggcctcgctggcctcctgcagggccatcacggcggagctctggaaa 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||| ||||| ||||||||||||||    |||||||| || |||||||| || |||
Sbjct: 191 cggatcaggagctcggtgctcttctggtagcgacggatctcacgcagggccactgtgccg 132

                                     
Query: 518 ggcctgtancggtgaggcttcttcac 543
           |||||||| || || |||||||||||
Sbjct: 131 ggcctgtagcgatggggcttcttcac 106



to top

>gb|AY655588.1| Menidia menidia histone H3a gene, partial cds
          Length = 333

 Score =  242 bits (122), Expect = 1e-60
 Identities = 215/247 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           |||||||||||| |||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 cgcgatctccctgaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| || || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcggcggatctcccgcagagccacggttccgggcctgtaacggtggggcttctt 90

                  
Query: 541 cacgccg 547
            ||||||
Sbjct: 89  sacgccg 83



to top

>emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones
          Length = 4942

 Score =  242 bits (122), Expect = 1e-60
 Identities = 253/297 (85%)
 Strand = Plus / Minus

                                                                       
Query: 247 ctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 306
           |||||||||||| || | ||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 747 ctcgccacggatacgtctggccagctggatgtccttgggcatgatggtgacacgcttggc 688

                                                                       
Query: 307 gtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctc 366
           |||||||||||||||||||||||||||||| || ||||| | ||| ||||||  ||||||
Sbjct: 687 gtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcctcgctagcctc 628

                                                                       
Query: 367 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 426
           ||| |||||||  ||||||  |  |||||| |  |||||||| ||||||||||| |||||
Sbjct: 627 ctgaagggccatgacggcggagctctggaaacgcaggtcggttttgaagtcctgagcgat 568

                                                                       
Query: 427 ctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggta 486
            || |||||||| | |||||| ||||| |||||||| || ||||| ||||||||||||||
Sbjct: 567 ttctctcaccagcctctggaagggcagtttgcggatgaggagctcggtgctcttctggta 508

                                                                    
Query: 487 cttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcac 543
               |||||||| |||||||| || || ||||||||||| | ||| |||||||||||
Sbjct: 507 acgacggatctcacggagggcgacagttccgggcctgtatctgtggggcttcttcac 451



to top

>gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds
          Length = 327

 Score =  242 bits (122), Expect = 1e-60
 Identities = 214/245 (87%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           |||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||
Sbjct: 326 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccacgaggtaggcctcg 267

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
              |||||||| ||||||| ||||||   |  |||||| |  ||||||||||||||||||
Sbjct: 266 ctcgcctcctgcagggccatcacggcagagctctggaagcgcaggtcggtcttgaagtcc 207

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           ||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 206 tgcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtgctc 147

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||    |||||||| || |||||||| || ||||||||||| || || ||||||
Sbjct: 146 ttctggtagcgacggatctcccgcagggccaccgtgccgggcctgtagcgatgcggcttc 87

                
Query: 539 ttcac 543
           |||||
Sbjct: 86  ttcac 82



to top

>gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds
          Length = 328

 Score =  240 bits (121), Expect = 4e-60
 Identities = 210/240 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||| |||||||||||| || |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaagttggtgtcctcaaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           ||||||||||| ||||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 205 cgcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacggtcccgggcctgtagcggtgaggcttctt 86



to top

>gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds
          Length = 333

 Score =  238 bits (120), Expect = 2e-59
 Identities = 214/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcraacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagmgccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| || |||||||||||||| |||||||||||||||||||||||||||  |||
Sbjct: 209 agcgatctctctsaccaggcgctggaagggcagcttgcggatcagcagctccgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY662887.1| Cymatogaster aggregata histone H3a gene, partial cds
          Length = 333

 Score =  238 bits (120), Expect = 2e-59
 Identities = 215/247 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaarcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| ||||||||||||||||| |||||||||||||||||||||||||||  |||
Sbjct: 209 agcgatctctctcaccaggcgctggaagggcagcttgcggatcagcagctccgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY539178.1| Menidia menidia histone H3 gene, partial cds
          Length = 333

 Score =  238 bits (120), Expect = 2e-59
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           |||||||||||| |||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 cgcgatctccctsaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||| ||| ||||| ||||||||
Sbjct: 149 ctggtagcggcggatctccckcagagccacggtgccgggcckgtaacggtgrggcttctt 90

                  
Query: 541 cacgccg 547
            || |||
Sbjct: 89  sackccg 83



to top

>gb|AY749739.1| Stygifloris sp. EP141 histone H3 (H3) gene, partial cds
          Length = 376

 Score =  238 bits (120), Expect = 2e-59
 Identities = 232/270 (85%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           |||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatngcgcacaagttggtgtcctcgaac 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||  || |||||| |||||||  ||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctagactcctgcagggccatgacggcggagctctggaag 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgaaccaggcgctggaagggcagcttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| |||||||| ||||||||||||||    |||||||| || || |||||||| |||
Sbjct: 191 cggatgagcagctcggtgctcttctggtagcgacggatctcacgcagagccacggttccg 132

                                         
Query: 518 ggcctgtancggtgaggcttcttcacgccg 547
           |||||||| || || |||||||||||||||
Sbjct: 131 ggcctgtaacgatggggcttcttcacgccg 102



to top

>gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, partial cds
          Length = 375

 Score =  236 bits (119), Expect = 6e-59
 Identities = 232/270 (85%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcatggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   |||||||| || |||| |||||||  |  |||||| 
Sbjct: 311 agacccaccaggtaggcctcgctggcctcctgcagagccatcacggcgctgctctggaag 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | ||||||||||||||||||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgagcgatctcacggaccaggcgctggaagggcagcttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||||||||| ||||||||||||||    |||||||| || |||||||| || |||
Sbjct: 191 cggatcagcagctcagtgctcttctggtagcgacggatctcacgcagggccactgtgccg 132

                                         
Query: 518 ggcctgtancggtgaggcttcttcacgccg 547
           || |  || || || |||||||||||||||
Sbjct: 131 gggcgatagcgatggggcttcttcacgccg 102



to top

>gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partial cds
          Length = 333

 Score =  234 bits (118), Expect = 2e-58
 Identities = 213/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||| ||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcaaacagacccaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||  |||
Sbjct: 209 agcgatctcwctcaccaggcgctggaarggcagyttgcggatcagcagctcagtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| | ||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagyggcggatctccctgagrgccacggtaccgggcctgtagcggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|DQ028079.1| Velifer hypselopterus histone H3 gene, partial cds
          Length = 333

 Score =  234 bits (118), Expect = 2e-58
 Identities = 214/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcggcggatctccctcagagccacggtaccgggcctgtaacggtgrggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY539186.1| Sebastes matsubarae histone H3 gene, partial cds
          Length = 333

 Score =  234 bits (118), Expect = 2e-58
 Identities = 214/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcrgagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 ggcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagggccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds
          Length = 328

 Score =  232 bits (117), Expect = 1e-57
 Identities = 208/240 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  ||||||  |  |||||| |  | ||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatracggcggagctctggaagcgcargtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||| ||||||||| |||||||||||||| || ||||| |||  |||
Sbjct: 205 ggcgatctccctcaccaagcgctggaagggcagcttgcggatgaggagctcggtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| |||||||| ||||||| ||| ||||||||||||||
Sbjct: 145 ctggtascggcggatctcgcggagagccacggtgccgggccggtagcggtgaggcttctt 86



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  232 bits (117), Expect = 1e-57
 Identities = 222/257 (86%)
 Strand = Plus / Plus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 147 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 206

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 207 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 266

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 267 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 326

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||| ||||| ||||||||||||||    |||||||| || ||||| 
Sbjct: 327 ggcagcttgcggatcagaagctcagtgctcttctggtagcgacggatctcacgtagggct 386

                            
Query: 509 acggtcccgggcctgta 525
           ||||| ||||| |||||
Sbjct: 387 acggtgccgggtctgta 403



to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  232 bits (117), Expect = 1e-57
 Identities = 222/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 371 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 312

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 311 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 252

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 251 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 192

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||| ||||| ||||||||||||||    |||||||| || ||||| 
Sbjct: 191 ggcagcttgcggatcagaagctcagtgctcttctggtagcgacggatctcacgtagggct 132

                            
Query: 509 acggtcccgggcctgta 525
           ||||| ||||| |||||
Sbjct: 131 acggtgccgggtctgta 115



to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  232 bits (117), Expect = 1e-57
 Identities = 222/257 (86%)
 Strand = Plus / Plus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 68  agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 127

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 128 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 187

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 188 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 247

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||| ||||| ||||||||||||||    |||||||| || ||||| 
Sbjct: 248 ggcagcttgcggatcagaagctcagtgctcttctggtagcgacggatctcacgtagggct 307

                            
Query: 509 acggtcccgggcctgta 525
           ||||| ||||| |||||
Sbjct: 308 acggtgccgggtctgta 324



to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  232 bits (117), Expect = 1e-57
 Identities = 222/257 (86%)
 Strand = Plus / Plus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 121 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 180

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           |||||||| || ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 181 tcctcgaagagaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 240

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 241 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 300

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||| ||||| ||||||||||||||    |||||||| || ||||| 
Sbjct: 301 ggcagcttgcggatcagaagctcagtgctcttctggtagcgacggatctcacgtagggct 360

                            
Query: 509 acggtcccgggcctgta 525
           ||||| ||||| |||||
Sbjct: 361 acggtgccgggtctgta 377



to top

>gb|AY662881.1| Polycentropsis abbreviata histone H3a gene, partial cds
          Length = 333

 Score =  232 bits (117), Expect = 1e-57
 Identities = 209/240 (87%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcrcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| ||||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcgacggatctcacggagagccacggtaccgggcctgtaacggtggggcttctt 90



to top

>gb|AY655591.1| Cololabis saira histone H3a gene, partial cds
          Length = 333

 Score =  230 bits (116), Expect = 4e-57
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtargcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||| ||||
Sbjct: 269 ggcctcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagycctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| |||||||| |||||||| |||||||||||||||||||||| ||||  |||
Sbjct: 209 agcgatctctctcaccagmcgctggaagggcagcttgcggatcagcagctmcgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctccctcagagccacggtaccgggcctgtagcggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3) gene, partial
           cds
          Length = 369

 Score =  230 bits (116), Expect = 4e-57
 Identities = 227/267 (85%)
 Strand = Plus / Minus

                                                                       
Query: 281 ttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagc 340
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| || || 
Sbjct: 369 ttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcaaagagg 310

                                                                       
Query: 341 ccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctg 400
           ||||| ||||| ||||||   |||||||| || ||||  ||||||  |  |||||| |  
Sbjct: 309 ccgaccaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaagcgc 250

                                                                       
Query: 401 aggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcgg 460
           ||||| |||||||||||||| |||||||| | |||||  |||||||| ||||||||||||
Sbjct: 249 aggtcsgtcttgaagtcctgagcgatctcrcgcaccanacgctggaagggcagcttgcgg 190

                                                                       
Query: 461 atcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggc 520
           |||| |||||| |||  |||||||||    |||||||| ||||| || ||||||||||||
Sbjct: 189 atcarcagctcngtggacttctggtaacgncggatctcacggagngcgacggtcccgggc 130

                                      
Query: 521 ctgtancggtgaggcttcttcacgccg 547
           ||||| || || |||||||||||||||
Sbjct: 129 ctgtaacgatggggcttcttcacgccg 103



to top

>gb|AY662930.1| Crenicichla alta histone H3a gene, partial cds
          Length = 333

 Score =  230 bits (116), Expect = 4e-57
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtargcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| |  |||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 209 agcgatctcgckgaccaggcgctggaagggcagcttgcggatsagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| || || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctcacgcagrgccacggtgccgggcctgtarcggtgaggcttctt 90

                  
Query: 541 cacgccg 547
            ||||||
Sbjct: 89  sacgccg 83



to top

>gb|AY539263.1| Etheostoma blennioides histone H3 gene, partial cds
          Length = 333

 Score =  230 bits (116), Expect = 4e-57
 Identities = 214/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| ||||||||||||||||| |||||||||||||||||||||||||||   ||
Sbjct: 209 agcgatctctctcaccaggcgctggaagggcagcttgcggatcagcagctccgtggattt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY520695.1| Semibalanus cariosus histone H3 gene, partial cds
          Length = 328

 Score =  228 bits (115), Expect = 2e-56
 Identities = 216/250 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||||||||||||||||||||||||||| || || ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctc 269

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |  ||||||||| ||||||| |||||||  |  |||||| | ||| || |||||||||||
Sbjct: 268 gctagcctcctgaagggccatcacggcgctgctctggaagcggagatccgtcttgaagtc 209

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           ||| |||||||| | |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 208 ctgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcagctcagtgct 149

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||   ||||||||| || || ||||| || ||||| | ||| ||||| |||||
Sbjct: 148 cttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtaacggtggggctt 89

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 88  cttgacgccg 79



to top

>gb|AY520703.1| Elminius modestus histone H3 gene, partial cds
          Length = 328

 Score =  226 bits (114), Expect = 6e-56
 Identities = 215/249 (86%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctcg 268

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
              |||||||| |||||||  ||||||  |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           || |||||||| | |||||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 207 tgagcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcagctcggtgctc 148

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||    |||||||| |||||||| || || ||||| | ||| ||||||||||||
Sbjct: 147 ttctggtagcgacggatctcacggagggcgaccgtgccgggacggtagcggtgaggcttc 88

                    
Query: 539 ttcacgccg 547
           || ||||||
Sbjct: 87  ttgacgccg 79



to top

>gb|AY520694.1| Semibalanus balanoides histone H3 gene, partial cds
          Length = 328

 Score =  226 bits (114), Expect = 6e-56
 Identities = 215/249 (86%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           ||||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccaaccaggtaggcctcg 268

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
             ||||||||| ||||||| |||||||  |  |||||| | ||| || ||||||||||||
Sbjct: 267 ctagcctcctgaagggccatcacggcgctgctctggaagcggagatccgtcttgaagtcc 208

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           || |||||||| | |||||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 207 tgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcagctcagtgctc 148

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||   ||||||||| || || ||||| || ||||| | ||| ||||| ||||||
Sbjct: 147 ttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtaacggtggggcttc 88

                    
Query: 539 ttcacgccg 547
           || ||||||
Sbjct: 87  ttgacgccg 79



to top

>gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) gene, partial cds
          Length = 376

 Score =  226 bits (114), Expect = 6e-56
 Identities = 230/269 (85%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           |||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||
Sbjct: 372 tccttgggcatgatggtgacacgcttggcgtggatagcgcacaagttggtgtcctcgaac 313

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| ||||||  ||||||||| |||||||  |||||    |||||||| 
Sbjct: 312 agaccgacgaggtaggcctcgctagcctcctgcagggccatgacggccgacgactggaat 253

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| |||||||| | |||||| |||||||| |||||||| 
Sbjct: 252 cgaaggtcggtcttgaagtcctgtgcgatctcacgcaccagacgctggaagggcagcttc 193

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           | ||| |||||||| ||||||||||||||    |||||||| |  || |||||||| |||
Sbjct: 192 ctgatgagcagctcggtgctcttctggtaacgacggatctctctcagagccacggtaccg 133

                                        
Query: 518 ggcctgtancggtgaggcttcttcacgcc 546
           |||||||| | ||| ||||||||||||||
Sbjct: 132 ggcctgtacctgtggggcttcttcacgcc 104



to top

>gb|AY539273.1| Gymnodraco acuticeps histone H3 gene, partial cds
          Length = 333

 Score =  226 bits (114), Expect = 6e-56
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| |||||||| |||||
Sbjct: 149 ctggtagcggcggatctccctcagagccacggtaccgggcctgtaacggtgaggyttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY655592.1| Fundulus heteroclitus histone H3a-like gene, partial sequence
          Length = 333

 Score =  224 bits (113), Expect = 2e-55
 Identities = 213/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcagagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| |||||| |||||||| |||||||||||||||||||||||||||  |||
Sbjct: 209 agcgatctcccgcaccagncgctggaagggcagcttgcggatcagcagctccgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctctctcagagccacggtaccgggcctgtagcggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  224 bits (113), Expect = 2e-55
 Identities = 226/264 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 342
           |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttcgtgtcctcgaacaggcc 295

                                                                       
Query: 343 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 402
           ||| ||||||||||||   |||||||| |||||||  |||||   |  |||||| | |||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgacggccgagctctggaagcggag 235

                                                                       
Query: 403 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 462
           |||||||||||||||||| |||||||| | |||||| |||||||| ||||||||||||||
Sbjct: 234 gtcggtcttgaagtcctgggcgatctcgcgcaccagacgctggaagggcagcttgcggat 175

                                                                       
Query: 463 cagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcct 522
           ||| ||||| ||||||||||||||   ||||||||| | ||| || || || || |||||
Sbjct: 174 caggagctcggtgctcttctggtagcggcggatctccctgagcgcgaccgttcccggcct 115

                                   
Query: 523 gtancggtgaggcttcttcacgcc 546
           ||| || || |||||||| |||||
Sbjct: 114 gtagcgatggggcttcttgacgcc 91



to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  224 bits (113), Expect = 2e-55
 Identities = 221/257 (85%)
 Strand = Plus / Minus

                                                                       
Query: 269 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 328
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 370 agctggatgtccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtg 311

                                                                       
Query: 329 tcctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgg 388
           ||||||||  | ||||| ||||| ||||||   ||||||||||| ||||  ||||||  |
Sbjct: 310 tcctcgaagggaccgacgaggtaagcctcgctggcctcctggagagccataacggcggag 251

                                                                       
Query: 389 gactggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 448
             |||||| |  |||||||||||||||||||| |||||||| |  ||||| |||||||| 
Sbjct: 250 ctctggaagcgcaggtcggtcttgaagtcctgagcgatctcacggaccagacgctggaag 191

                                                                       
Query: 449 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggcc 508
           ||||||||||||||||| ||||| ||||||||||||||    |||||||| || ||||| 
Sbjct: 190 ggcagcttgcggatcagaagctcagtgctcttctggtagcgacggatctcacgtagggct 131

                            
Query: 509 acggtcccgggcctgta 525
           ||||| ||||| |||||
Sbjct: 130 acggtgccgggtctgta 114



to top

>gb|DQ284349.1| Nyctibates corrugatus histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataagcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||| ||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggccggtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284348.1| Cardioglossa leucomystax histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || || |||||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagatacgcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| |||||||||||||| |||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284213.1| Cardioglossa gratiosa histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || || |||||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagatacgcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| |||||||||||||| |||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284132.1| Cardioglossa leucomystax histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || || |||||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagatacgcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| |||||||||||||| |||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284131.1| Schoutedenella sylvatica histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||| ||||||||||||||||||||||||||||||||||| || || || ||||||  
Sbjct: 325 cttggcatggatggcgcacaggttggtgtcctcgaacagccccaccagataagcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial cds
          Length = 328

 Score =  222 bits (112), Expect = 9e-55
 Identities = 213/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||| |||||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcacacaggttggtgtcctcgaagagkccgaccaggtaagcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           |||||||||||  |||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 205 cgcgatctcccggaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |||||||||||||| ||||||| ||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctctcggagggccacggtgccgggccggtagcggtgaggcttctt 86

                  
Query: 541 cacgccg 547
            ||||||
Sbjct: 85  gacgccg 79



to top

>gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds
          Length = 411

 Score =  222 bits (112), Expect = 9e-55
 Identities = 232/272 (85%)
 Strand = Plus / Minus

                                                                       
Query: 248 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 307
           ||||| ||||| | |||||| || ||||||||||| |||||||| ||||||||||| |||
Sbjct: 401 tcgccccggattctgcgggccagttggatgtcctttggcatgattgtgacgcgctttgcg 342

                                                                       
Query: 308 tggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcc 367
           ||||||||||||| ||| ||||| ||||| || || || ||||||||||| |||||||||
Sbjct: 341 tggatggcgcacaagtttgtgtcttcgaaaagacccacgaggtacgcctccgcagcctcc 282

                                                                       
Query: 368 tggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatc 427
           || || || ||||| |||  ||||||||| |  | ||| |||||||||||||||||||||
Sbjct: 281 tgcagcgcgagcaccgcggaggactggaaacgcaagtccgtcttgaagtcctgcgcgatc 222

                                                                       
Query: 428 tccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtac 487
           || |  ||||| |||||||| ||||||||||| |||||||| |||||||| || ||||||
Sbjct: 221 tcgcggaccagccgctggaaaggcagcttgcgaatcagcaggtccgtgcttttttggtac 162

                                           
Query: 488 ttgcggatctcgcggagggccacggtcccggg 519
            ||||||| ||||||||||| ||||| |||||
Sbjct: 161 ctgcggatttcgcggagggcgacggtgccggg 130



to top

>gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, partial cds
          Length = 333

 Score =  222 bits (112), Expect = 9e-55
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| || |||||||||||||| |||||||||||||| |||||||| |||   ||
Sbjct: 209 agcgatctcgctgaccaggcgctggaagggcagcttgcggatgagcagctcggtggattt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| | ||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctctctgagagccacggtaccgggcctgtagcggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY539272.1| Harpagifer kerguelensis histone H3 gene, partial cds
          Length = 333

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaggcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| ||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctcwctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcggcggatctccctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539253.1| Careproctus melanurus histone H3 gene, partial cds
          Length = 333

 Score =  222 bits (112), Expect = 9e-55
 Identities = 213/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagcgccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| || || ||||||||
Sbjct: 149 ctggtagcggcggatctccctcagagccacggtaccgggcctgtagcgatggggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY539248.1| Cottunculus thomsonii histone H3 gene, partial cds
          Length = 327

 Score =  222 bits (112), Expect = 9e-55
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 323 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 264

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 263 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 204

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 203 agcgatytccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 144

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 143 ctggtagcggcggatctccctcagagccacggtaccgggcctgtaacggtggggcttctt 84

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 83  cackccg 77



to top

>gb|AY539247.1| Xeneretmus latifrons histone H3 gene, partial cds
          Length = 333

 Score =  222 bits (112), Expect = 9e-55
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagcgccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcgrcggatctccctsagagccacggtaccgggcctgtagcggtgrggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539244.1| Nautichthys pribilovius histone H3 gene, partial cds
          Length = 324

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 320 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 261

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 260 ggactcctgcagagccatracrgcggagctctggaagcgcaggtcggtcttgaagtcctg 201

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || |||||||| |||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 200 agcgatytcyctcaccagccgctggaagggcagcttgcggatcagcagctcsgtggactt 141

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| || || |||||||| ||||||||||| || || ||||||||
Sbjct: 140 ctggtagcggcggatctcccgcagagccacggtaccgggcctgtaacgktgrggcttctt 81

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 80  cacgccg 74



to top

>gb|AY539215.1| Bembras japonica histone H3 gene, partial cds
          Length = 331

 Score =  222 bits (112), Expect = 9e-55
 Identities = 210/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||| |||||| ||||| ||||| ||||||  
Sbjct: 327 cttggcgtggatggcgcacaggttggtgtcctygaacaggccgaccaggtargcctcgct 268

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  |||||| |  |||||||||||||| |||||
Sbjct: 267 ggactcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaartcctg 208

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || ||||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 207 agcgatytcyctcaccaggcgctggaagggcagcttgcggatcagcagctcsgtggaytt 148

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| || || |||||||| ||||||||||| ||||||||||||||
Sbjct: 147 ctggtagcgacggatctctcgcagagccacggtaccgggcctgtaacggtgaggcttctt 88

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 87  cacgccg 81



to top

>gb|AY539176.1| Chilara taylori histone H3 gene, partial cds
          Length = 333

 Score =  222 bits (112), Expect = 9e-55
 Identities = 213/247 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||| ||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctctctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| ||||| ||||| || ||||||||||| || |||||||||||
Sbjct: 149 ctggtagcgacggatctcwcggagcgccactgttccgggcctgtaacgatgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|DQ028083.1| Lota lota histone H3 gene, partial cds
          Length = 333

 Score =  220 bits (111), Expect = 4e-54
 Identities = 212/246 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || |||| ||| |||  |  |||||| | |||||||||||||||||||||
Sbjct: 269 ggcctcctgaagagccatcacagcggagctctggaagcggaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcrgtggattt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||| ||    |||||||| | ||| |||||||| ||||||||||| || || ||||||||
Sbjct: 149 ctgataacgacggatctctctgagagccacggtgccgggcctgtarcgatggggcttctt 90

                 
Query: 541 cacgcc 546
           ||||||
Sbjct: 89  cacgcc 84



to top

>gb|AY520705.1| Tetraclitella divisa histone H3 gene, partial cds
          Length = 328

 Score =  220 bits (111), Expect = 4e-54
 Identities = 215/250 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtaggcctc 269

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |   |||||||| ||||||| |||||||  |  |||||| | ||||||||||||||||||
Sbjct: 268 gctggcctcctgcagggccatcacggcgctgctctggaaacggaggtcggtcttgaagtc 209

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           ||| || ||||| |  ||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 208 ctgagcaatctcgcggaccagacgctggaacggcagcttgcggatcagcagctcggtgct 149

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||    |||||||| || ||||| || || ||||| | ||| |||||||| ||
Sbjct: 148 cttctggtagcgacggatctcacgcagggcgaccgtgccgggacggtagcggtgaggttt 89

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 88  cttgacgccg 79



to top

>gb|AF370818.1|AF370818 Balanus balanus histone H3 gene, partial cds
          Length = 316

 Score =  220 bits (111), Expect = 4e-54
 Identities = 214/250 (85%)
 Strand = Plus / Minus

                                                                       
Query: 298 gcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctc 357
           |||||||||||||||||||||||||||||| ||||||||||| || || || || |||||
Sbjct: 316 gcgcttggcgtggatggcgcacaggttggtrtcctcgaacagrccaaccagrtaggcctc 257

                                                                       
Query: 358 ggcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtc 417
           |  ||||||||| ||||||| |||||||  |  |||||| | ||| || |||||||||||
Sbjct: 256 gctagcctcctgmagggccatcacggcgctgctctggaagcggagatccgtcttgaagtc 197

                                                                       
Query: 418 ctgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgct 477
           ||| |||||||| | |||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 196 ctgggcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcagctcagtgct 137

                                                                       
Query: 478 cttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggctt 537
           |||||||||   ||||||||| || || ||||| || ||||| | ||| ||||| |||||
Sbjct: 136 cttctggtagcggcggatctcacgcagcgccaccgtgccgggacggtaacggtggggctt 77

                     
Query: 538 cttcacgccg 547
           ||| ||||||
Sbjct: 76  cttgacgccg 67



to top

>gb|AY662875.1| Badis badis histone H3a gene, partial cds
          Length = 333

 Score =  220 bits (111), Expect = 4e-54
 Identities = 204/236 (86%)
 Strand = Plus / Minus

                                                                       
Query: 305 gcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcc 364
           ||||||||||||||||||||||||||||||||||| ||||| || || ||||||   |||
Sbjct: 325 gcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggcc 266

                                                                       
Query: 365 tcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcg 424
           ||||| || ||||  ||||||  |  |||||| |  |||||||||||||||||||| |||
Sbjct: 265 tcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcg 206

                                                                       
Query: 425 atctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctgg 484
           ||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||||||
Sbjct: 205 atctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggacttctgg 146

                                                                   
Query: 485 tacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           |||   |||||||| | ||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 145 taccgacggatctccctgagagccacggtaccgggcctgtaacggtgrggcttctt 90



to top

>gb|AY539246.1| Sarritor frenatus histone H3 gene, partial cds
          Length = 303

 Score =  220 bits (111), Expect = 4e-54
 Identities = 211/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 299 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 240

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 239 ggactcctgcagmgccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 180

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 179 agcgatytccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 120

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| || || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 119 ctggtagcgrcggatctcccgcagagccacggtaccgggcctgtarcggtggggcttctt 60

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 59  cacnccg 53



to top

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  220 bits (111), Expect = 4e-54
 Identities = 224/262 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 tgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcc 341
           |||||||||||||||||||||| |||||||| ||||||||||||||||||||||| || |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 342 cgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctga 401
           |||| ||||| ||||||   ||||||||||| ||||  ||||||  |  |||||| | ||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                                                                       
Query: 402 ggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcgga 461
           ||||||||||||||||||| |||||||| |  || ||||||||||| |||||||||||||
Sbjct: 241 ggtcggtcttgaagtcctgagcgatctcgcggacgaggcgctggaagggcagcttgcgga 182

                                                                       
Query: 462 tcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcc 521
           |||| ||||||||||||||||||||  | | |||||| ||||| |||||||| || || |
Sbjct: 181 tcaggagctccgtgctcttctggtatctcctgatctcacggagagccacggtaccagggc 122

                                 
Query: 522 tgtancggtgaggcttcttcac 543
            ||| | ||| |||||||||||
Sbjct: 121 ggtacctgtgtggcttcttcac 100



to top

>gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds
          Length = 377

 Score =  220 bits (111), Expect = 4e-54
 Identities = 227/266 (85%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaac 312

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 311 agacccaccaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||||||||| |||||||| | |||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| || ||||| ||||||||||||||    |||||||| || || ||||| || |||
Sbjct: 191 cggatgaggagctcagtgctcttctggtagcgacggatctcacgcagagccactgtgccg 132

                                     
Query: 518 ggcctgtancggtgaggcttcttcac 543
           |||||||| || || |||||||||||
Sbjct: 131 ggcctgtagcgatggggcttcttcac 106



to top

>gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccaggtargcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 209 ggcgatctccctgaccaggcgctggaagggcagcttgcggatsagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtgccgggcctgtagcggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY520720.1| Capitulum mitella histone H3 gene, partial cds
          Length = 328

 Score =  218 bits (110), Expect = 1e-53
 Identities = 214/249 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggccgacaaggtaggcctcg 268

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
              |||||||| |||||||  ||||||  |  |||||| |  ||||| ||||||||||||
Sbjct: 267 ctcgcctcctgcagggccatgacggcgctgctctggaagcgcaggtccgtcttgaagtcc 208

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           || |||||||| | |||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 207 tgagcgatctcgcgcaccagacgctggaacggcagcttgcggatcagcagctccgtgctc 148

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||    |||||||| || || ||||| || || || | ||| ||||| ||||||
Sbjct: 147 ttctggtagcgacggatctcacgcagcgccaccgtgcccggacggtagcggtggggcttc 88

                    
Query: 539 ttcacgccg 547
           || ||||||
Sbjct: 87  ttgacgccg 79



to top

>gb|AY520708.1| Tetraclita japonica histone H3 gene, partial cds
          Length = 328

 Score =  218 bits (110), Expect = 1e-53
 Identities = 214/249 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           ||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcaaacagaccgaccaggtaggcctcg 268

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
              |||||||| |||||||  ||||||  |  |||||| | ||| |||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggcgctgctctggaaacggagatcggtcttgaagtcc 208

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           || || ||||| | |||||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 207 tgggcaatctcacgcaccagacgctggaacggcagcttgcggatcagcagctcagtgctc 148

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||    ||||||||||| |||||||| || ||||| | ||| ||||| ||||||
Sbjct: 147 ttctggtagcgacggatctcgcgcagggccaccgtgccggggcggtagcggtggggcttc 88

                    
Query: 539 ttcacgccg 547
           || ||||||
Sbjct: 87  ttgacgccg 79



to top

>ref|XM_789723.1| PREDICTED: Strongylocentrotus purpuratus similar to H3 histone,
           family 2 isoform 2 (LOC590106), mRNA
          Length = 438

 Score =  218 bits (110), Expect = 1e-53
 Identities = 247/293 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 307
           ||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||||
Sbjct: 428 tcgccacggatacggcgggccagctggatgtcctttggcatgatggtgacacgcttggcg 369

                                                                       
Query: 308 tggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcc 367
           ||||||||||||||||||||||||||||| || ||||| | ||| || |||  |||||||
Sbjct: 368 tggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaagcttcgctagcctcc 309

                                                                       
Query: 368 tggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatc 427
           || || ||||  |||||   |  |||||| | ||| ||||||||||| ||||| ||||||
Sbjct: 308 tgaagagccataacggcagagctctggaatcggagctcggtcttgaaatcctgagcgatc 249

                                                                       
Query: 428 tccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtac 487
           || |  ||||| |||||||| || ||||||||||| || ||||| |||||||||||||| 
Sbjct: 248 tcacggaccagacgctggaaggggagcttgcggatgagaagctcggtgctcttctggtaa 189

                                                                
Query: 488 ttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
              |||||||| ||||| || ||||| ||||||||||| || || ||||||||
Sbjct: 188 cgacggatctcacggagagcgacggtaccgggcctgtaacgatggggcttctt 136



to top

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 247/293 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 tcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 307
           ||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 401 tcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcg 342

                                                                       
Query: 308 tggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcc 367
           ||||||||||||||||||||||||||||| || ||||| | ||| || |||  |||||||
Sbjct: 341 tggatggcgcacaggttggtgtcctcgaagagaccgaccaagtaggcttcgctagcctcc 282

                                                                       
Query: 368 tggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatc 427
           || || ||||  |||||   |  |||||| | ||| ||||||||||||||||| ||||||
Sbjct: 281 tgaagagccatgacggcagagctctggaatcggagctcggtcttgaagtcctgagcgatc 222

                                                                       
Query: 428 tccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtac 487
           || |  ||||| |||||||| || ||||||||||| || ||||| |||||||||||||| 
Sbjct: 221 tcacggaccagacgctggaaggggagcttgcggatgagaagctcggtgctcttctggtag 162

                                                                
Query: 488 ttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
              |||||||| ||||| || ||||| || ||||| || || || ||||||||
Sbjct: 161 cgacggatctcacggagagcgacggttccaggcctataacgatggggcttctt 109



to top

>gb|DQ284378.1| Tylototriton shanjing histone H3a gene, partial cds
          Length = 328

 Score =  218 bits (110), Expect = 1e-53
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||| || |||||||| ||||| |||||   
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcaaagagcccgaccaggtaggcctcact 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  || ||   |  |||||| |  | ||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgaccgccgagctctggaagcgcaagtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
           ||||||||||| ||||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 205 cgcgatctcccgcaccaggcgctggaagggcagcttgcggatgagcagctcagtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| |||||||||||||||| ||| ||||||||||||||
Sbjct: 145 ctggtaacggcggatctcgcggagagccacggtcccgggccggtagcggtgaggcttctt 86

              
Query: 541 cac 543
            ||
Sbjct: 85  sac 83



to top

>gb|DQ284325.1| Thorius sp. JAC 21291 histone H3a gene, partial cds
          Length = 328

 Score =  218 bits (110), Expect = 1e-53
 Identities = 214/249 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcg 358
           |||||||||||||||||||||||||||||||||||||| || || || ||||| ||||||
Sbjct: 327 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagacccaccaggtaggcctcg 268

                                                                       
Query: 359 gcagcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 418
              |||||||| |||||||  |||||   |  |||||| |  ||||||||||||||||||
Sbjct: 267 ctggcctcctgcagggccatgacggccgagctctggaagcgcaggtcggtcttgaagtcc 208

                                                                       
Query: 419 tgcgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctc 478
           || |||||||| | ||||||||||||||| ||||||||||||||||||||||| |||  |
Sbjct: 207 tgggcgatctctcgcaccaggcgctggaagggcagcttgcggatcagcagctcggtggac 148

                                                                       
Query: 479 ttctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttc 538
           ||||||||    |||||||| | ||| |||||||| ||||||||||| ||||||||||||
Sbjct: 147 ttctggtagcgccggatctccctgagcgccacggtgccgggcctgtaacggtgaggcttc 88

                    
Query: 539 ttcacgccg 547
           |||||||||
Sbjct: 87  ttcacgccg 79



to top

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 250/297 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 ccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 310
           |||||||||||||| || ||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 398 ccacggatgcggcgagccagctggatgtccttgggcatgatggtgaccctcttggcgtgg 339

                                                                       
Query: 311 atggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggcagcctcctgg 370
           ||||||||||||||||||||||||||||| ||||| || || ||||||   |||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctggcctcctgc 279

                                                                       
Query: 371 agggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgatctcc 430
           || ||||  ||||||  |  |||||| |  || |||||||| |||||||| ||||| || 
Sbjct: 278 agagccatgacggcggagctctggaaacgcagatcggtcttaaagtcctgggcgatttct 219

                                                                       
Query: 431 ctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttctggtacttg 490
           |  ||||| |||||||| ||||| ||||||||||||||||| |||  |||||||||    
Sbjct: 218 cggaccagacgctggaagggcagtttgcggatcagcagctcggtggacttctggtagcga 159

                                                                    
Query: 491 cggatctcgcggagggccacggtcccgggcctgtancggtgaggcttcttcacgccg 547
           ||||||||||| || || ||||| || |||||||| |||||||| ||||| ||||||
Sbjct: 158 cggatctcgcgcagagcaacggtgccaggcctgtaacggtgaggtttcttgacgccg 102



to top

>gb|AY064472.1| Aplysia californica histone H3 (His.H3) gene, complete cds
          Length = 878

 Score =  218 bits (110), Expect = 1e-53
 Identities = 232/273 (84%)
 Strand = Plus / Minus

                                                                       
Query: 271 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtc 330
           ||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||
Sbjct: 488 ctggatgtccttgggcatgatcgtcacacgcttggcgtggatggcgcacaggttggtgtc 429

                                                                       
Query: 331 ctcgaacagcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtggga 390
           ||| ||||| || || ||||| ||||||  ||||||||| || ||||  |||||   |  
Sbjct: 428 ctcaaacagacccacgaggtaagcctcgctagcctcctgcagagccatgacggcagagct 369

                                                                       
Query: 391 ctggaacctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacgg 450
           ||||||||  | ||||||||||||||| || |||||||| |  || ||||||||||||||
Sbjct: 368 ctggaaccgcaagtcggtcttgaagtcttgtgcgatctcacgaacaaggcgctggaacgg 309

                                                                       
Query: 451 cagcttgcggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccac 510
           || |||||||||||||||||| ||||||||||||||    |||||||| || || |||||
Sbjct: 308 caacttgcggatcagcagctcggtgctcttctggtaacgacggatctcacgcagagccac 249

                                            
Query: 511 ggtcccgggcctgtancggtgaggcttcttcac 543
           ||| ||||||||||| || ||||| ||||||||
Sbjct: 248 ggtaccgggcctgtaacgatgaggtttcttcac 216



to top

>gb|AY662931.1| Dicrossus sp. JSS-2004 histone H3a gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 210/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagrccgaccaggtargcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 209 agcgatctccctgaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   |||||||||    || |||||||| || |||||||| ||||| ||||||||
Sbjct: 149 ctggtagcggcggatctccytcagrgccacggtgccrggcctgtagcggtgrggcttctt 90

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 89  cackccg 83



to top

>gb|AY539275.1| Trichodon trichodon histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 211/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatracagcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcgrcggatctccctcagagccacggtaccgggcctgtaccggtgrggcttctt 90

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 89  cackccg 83



to top

>gb|AY539267.1| Kuhlia rupestris histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggattt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539249.1| Dasycottus setiger histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatracrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtagcgrcggatctccctcagagccacggtaccgggcctgtarcggtgrggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539243.1| Hemitripterus americanus histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 208/247 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagcgccatracrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || |||||||| |||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatytcyctcaccagrcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| |  || |||||||| ||||||| ||| ||||| ||||||||
Sbjct: 149 ctggtagcggcggatctcccksagagccacggtaccgggcckgtaacggtgrggcttctt 90

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 89  cackccg 83



to top

>gb|AY539232.1| Icelinus filamentosus histone H3 gene, partial cds
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagsgccatracrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatttccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| | ||| |||||||| ||||||||||| || || ||||||||
Sbjct: 149 ctggtagcggcggatctccctgagagccacggtaccgggcctgtarcgatgrggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539197.1| Taenianotus triacanthus histone H3-like gene, partial sequence
          Length = 333

 Score =  218 bits (110), Expect = 1e-53
 Identities = 212/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |||| |  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcraacaggccgaccaggtaagcctagct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  ||||||  |  ||| || |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccatgacggcggagctctgaaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           |||||||   |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtaccgtcggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|AY539194.1| Scorpaena plumieri histone H3 gene, partial cds
          Length = 306

 Score =  218 bits (110), Expect = 1e-53
 Identities = 209/247 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 302 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 243

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 242 ggactcctgcagagccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 183

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || |||||||| |||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 182 agcgatytcyctcaccagrcgctggaagggcagcttgcggatcagcagctckgtggactt 123

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| || || |||||||| ||||||||||| || || ||||||||
Sbjct: 122 ctggtagcgrcggatctcccgcagagccacggtaccgggcctgtaacgrtgrggcttctt 63

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 62  cacgccg 56



to top

>gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds
          Length = 345

 Score =  218 bits (110), Expect = 1e-53
 Identities = 223/261 (85%)
 Strand = Plus / Minus

                                                                       
Query: 283 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagccc 342
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 343 gacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaacctgag 402
            || ||||| ||||||   |||||||| |||||||  ||||||  |  |||||| |  ||
Sbjct: 285 tacgaggtaagcctcgcttgcctcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 403 gtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttgcggat 462
           |||||||||||||||||| |||||||| | ||||||||||||||| ||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgtgcgatctcacgcaccaggcgctggaagggcagcttgcggat 166

                                                                       
Query: 463 cagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccgggcct 522
            |||||||| ||||||||||||||    |||||||| || || ||||| || || |||||
Sbjct: 165 gagcagctcagtgctcttctggtagcgacggatctcacgcagagccactgtgcctggcct 106

                                
Query: 523 gtancggtgaggcttcttcac 543
           ||| || || |||||||||||
Sbjct: 105 gtaacgatggggcttcttcac 85



to top

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  218 bits (110), Expect = 1e-53
 Identities = 229/269 (85%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || || || ||||| ||||||   ||||||||||| ||||  ||||||  |  |||||| 
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           | ||||||||||||||||||||| |||||||| |  || || ||||||||||||| ||||
Sbjct: 250 cggaggtcggtcttgaagtcctgggcgatctcgcggacgagtcgctggaacggcaacttg 191

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           ||||| || ||||| ||||||||||||||  | | |||||| |||||||||||||| |||
Sbjct: 190 cggatgaggagctcggtgctcttctggtatctcctgatctctcggagggccacggtaccg 131

                                        
Query: 518 ggcctgtancggtgaggcttcttcacgcc 546
           || |  || | ||| ||||||||||||||
Sbjct: 130 ggacgatacctgtggggcttcttcacgcc 102



to top

>emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant
          Length = 772

 Score =  216 bits (109), Expect = 6e-53
 Identities = 211/245 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 504 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 445

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 444 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 385

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 384 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 325

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           || ||||| | |||||| ||||||||||||||||||||||| ||||||||||||  ||||
Sbjct: 324 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagctccgtggacttc 265

                
Query: 482 tggta 486
           |||||
Sbjct: 264 tggta 260



to top

>gb|DQ284421.1| Pachytriton brevipes histone H3a gene, partial cds
          Length = 328

 Score =  216 bits (109), Expect = 6e-53
 Identities = 206/240 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaggcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| |||||||  || |||  |  |||||| |  ||||||||||| ||||||||
Sbjct: 265 ggcctcctgcagggccatgackgcggagctctggaagcgcaggtcggtcttraagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||| ||||||||| |||||||||||||| || ||||| |||  |||
Sbjct: 205 ggcgatctccctcaccaagcgctggaagggcagcttgcggatgaggagctcggtggactt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| ||||| |||||||| ||||||| ||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcwcggagagccacggtgccgggccggtagcggtgaggcttctt 86



to top

>gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA
          Length = 824

 Score =  216 bits (109), Expect = 6e-53
 Identities = 211/245 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 450

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 449 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 390

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           || ||||| | |||||| ||||||||||||||||||||||| ||||||||||||  ||||
Sbjct: 389 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagctccgtggacttc 330

                
Query: 482 tggta 486
           |||||
Sbjct: 329 tggta 325



to top

>ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA, transcript variant
           A (His3.3A), mRNA
          Length = 853

 Score =  216 bits (109), Expect = 6e-53
 Identities = 211/245 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 608 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 549

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 548 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 489

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 488 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 429

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           || ||||| | |||||| ||||||||||||||||||||||| ||||||||||||  ||||
Sbjct: 428 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagctccgtggacttc 369

                
Query: 482 tggta 486
           |||||
Sbjct: 368 tggta 364



to top

>gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA
          Length = 824

 Score =  216 bits (109), Expect = 6e-53
 Identities = 211/245 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 301
           |||| ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||
Sbjct: 569 gcccgctcgccacggatgcgtctggccagctggatgtccttgggcataatggtgacgcgc 510

                                                                       
Query: 302 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggca 361
           |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||||   
Sbjct: 509 ttggcgtgaatggcgcacagattggtgtcctcgaacagaccgaccaggtacgcctcgctg 450

                                                                       
Query: 362 gcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgc 421
           |||||||| |||||    | |||    |||||||| |  || ||||||||||||||||| 
Sbjct: 449 gcctcctgtagggctccaatggccgccgactggaagcgcagatcggtcttgaagtcctgg 390

                                                                       
Query: 422 gcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctcttc 481
           || ||||| | |||||| ||||||||||||||||||||||| ||||||||||||  ||||
Sbjct: 389 gctatctcgcgcaccagacgctggaacggcagcttgcggatgagcagctccgtggacttc 330

                
Query: 482 tggta 486
           |||||
Sbjct: 329 tggta 325



to top

>gb|AY539268.1| Cirrhitus rivulatus histone H3 gene, partial cds
          Length = 324

 Score =  216 bits (109), Expect = 6e-53
 Identities = 207/240 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||||  
Sbjct: 320 cttggcgtggatggcgcacaggttggtgtcctcgaagaggccgaccaggtaagcctcgct 261

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 260 ggcctcctgcagagccatgacagcggagctctggaagcgcaggtcggtcttgaagtcctg 201

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 200 agcgatctccctgaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 141

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||| ||||| |||||||| ||||||||||| ||||||||||||||
Sbjct: 140 ctggtagcggcggatctctcggagagccacggtaccgggcctgtaacggtgaggcttctt 81



to top

>gb|AY539245.1| Hypsagonus quadricornis histone H3 gene, partial cds
          Length = 260

 Score =  216 bits (109), Expect = 6e-53
 Identities = 208/246 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 256 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 197

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  | ||||||||||||||||||
Sbjct: 196 ggactcctgcagmgccatgacrgcggagctctggaagcgcargtcggtcttgaagtcctg 137

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| |||||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 136 agcgatytccctcaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 77

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| || || |||||||| ||||||||||| ||||| ||||| ||
Sbjct: 76  ctggtagcgrcggatctcccgcagagccacggtaccgggcctgtagcggtgrggcttmtt 17

                 
Query: 541 cacgcc 546
           || |||
Sbjct: 16  caygcc 11



to top

>gb|DQ028156.1| Secutor sp. L26 histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtargcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||||||||  |||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatctcccksaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtgccgggcctgtaacggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|DQ028122.1| Leiognathus equulus histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 rgcgatctccctgaccaggcgctggaagggcagcttgcggatcagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctcyctcagagccacggtgccgggcctgtaacggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|DQ028089.1| Gasterosteus aculeatus histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 211/247 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| || || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagagccataacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || |||||||| |||||||| |||||||||||||||||||||||||||  |||
Sbjct: 209 agcgatytctctcaccagacgctggaagggcagcttgcggatcagcagctccgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  ||||||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctccctcagggccacggtaccgggcctgtaacggtgaggcttctt 90

                  
Query: 541 cacgccg 547
           |||||||
Sbjct: 89  cacgccg 83



to top

>gb|DQ284256.1| Leptopelis argenteus histone H3a gene, partial cds
          Length = 328

 Score =  214 bits (108), Expect = 2e-52
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||| ||||| || || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ284199.1| Leptopelis sp. AMNH A168408 histone H3a gene, partial cds
          Length = 328

 Score =  214 bits (108), Expect = 2e-52
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||| ||||| || || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgct 266

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  |||||   |  |||||| |  ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||| ||||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 205 ggcgatctcccgcaccaggcgctggaagggcagcttgcggatcagcagctcggtggattt 146

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||   ||||||||||||||| ||||| || ||||||||||| ||||||||||||||
Sbjct: 145 ctggtagcggcggatctcgcggagagccacagtgccgggcctgtagcggtgaggcttctt 86

              
Query: 541 cac 543
           |||
Sbjct: 85  cac 83



to top

>gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone 3 (H3) gene,
           partial cds
          Length = 376

 Score =  214 bits (108), Expect = 2e-52
 Identities = 228/269 (84%)
 Strand = Plus / Minus

                                                                       
Query: 278 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaac 337
           ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| 
Sbjct: 372 tccttgggcatgatggtgacgcgcttggcgtggatsgcgcacaagttggtgtcctcgaaa 313

                                                                       
Query: 338 agcccgacaaggtacgcctcggcagcctcctggagggccagcacggcgtgggactggaac 397
           || ||||| ||||| || |||   |||||||| || ||||  ||||||  |  |||||| 
Sbjct: 312 agaccgacgaggtatgcttcgctggcctcctgcagagccatgacggcggagctctggaag 253

                                                                       
Query: 398 ctgaggtcggtcttgaagtcctgcgcgatctccctcaccaggcgctggaacggcagcttg 457
           |  |||||||||||||| ||||| |||||||| |  |||||||||||||| |||||||||
Sbjct: 252 cgcaggtcggtcttgaaatcctgrgcgatctcgcgaaccaggcgctggaaaggcagcttg 193

                                                                       
Query: 458 cggatcagcagctccgtgctcttctggtacttgcggatctcgcggagggccacggtcccg 517
           |||||||| ||||||||||||||||||||    ||||||||||| ||||| || || || 
Sbjct: 192 cggatcagaagctccgtgctcttctggtagcgacggatctcgcgaagggctaccgttccc 133

                                        
Query: 518 ggcctgtancggtgaggcttcttcacgcc 546
           |||||||| || |||||||| || |||||
Sbjct: 132 ggcctgtaacgatgaggctttttgacgcc 104



to top

>gb|AY539266.1| Haemulon plumieri histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           |||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            |||||||||||||||||||||||||| |||||||||||||| |||||||| |||  |||
Sbjct: 209 agcgatctccctcaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 149 ctggtaacgacggatctctctmagagccacggtaccgggcctgtaacggtggggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539264.1| Perca flavescens histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 207/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            |||||||| || ||||  ||||||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || || |||||||||||||| ||||||||||||||||||||||| |||   ||
Sbjct: 209 agcgatytcyctsaccaggcgctggaagggcagcttgcggatcagcagctcggtggaytt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 149 ctggtagcgacggatctctctcagagccacggtaccgggcctgtaacggtgaggcttctt 90

              
Query: 541 cac 543
           |||
Sbjct: 89  cac 87



to top

>gb|AY539240.1| Batrachocottus baicalensis histone H3 gene, partial cds
          Length = 333

 Score =  214 bits (108), Expect = 2e-52
 Identities = 208/247 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 270

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 269 ggactcctgcagmgccatracrgcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| || ||||||||||||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 209 agcgatytcyctcaccaggcgctggaagggcagcttgcggatcagcagctcsgtggactt 150

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||| ||| ||||| ||||||||
Sbjct: 149 ctggtagcgrcggatctccctcagagccacggtaccgggcckgtaacggtgrggcttctt 90

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 89  cackccg 83



to top

>gb|AY539235.1| Microcottus sellaris histone H3 gene, partial cds
          Length = 316

 Score =  214 bits (108), Expect = 2e-52
 Identities = 209/247 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 cttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacaaggtacgcctcggc 360
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 312 cttggcgtggatggcgcacaggttggtgtcctcgaacaggccgaccaggtaagcctcgct 253

                                                                       
Query: 361 agcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctg 420
            | |||||| || ||||  || |||  |  |||||| |  ||||||||||||||||||||
Sbjct: 252 ggactcctgcagagccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 193

                                                                       
Query: 421 cgcgatctccctcaccaggcgctggaacggcagcttgcggatcagcagctccgtgctctt 480
            ||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||  |||
Sbjct: 192 agcgatytccctcaccagrcgctggaagggcagcttgcggatcagcagctcsgtggactt 133

                                                                       
Query: 481 ctggtacttgcggatctcgcggagggccacggtcccgggcctgtancggtgaggcttctt 540
           ||||||    |||||||| |  || |||||||| ||||||||||| ||||| ||||||||
Sbjct: 132 ctggtagcgrcggatctccctcagagccacggtaccgggcctgtarcggtggggcttctt 73

                  
Query: 541 cacgccg 547
           ||| |||
Sbjct: 72  cackccg 66


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,407,876
Number of Sequences: 3902068
Number of extensions: 3407876
Number of successful extensions: 89622
Number of sequences better than 10.0: 4020
Number of HSP's better than 10.0 without gapping: 4086
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 71567
Number of HSP's gapped (non-prelim): 16367
length of query: 547
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 524
effective length of database: 17,143,297,704
effective search space: 8983087996896
effective search space used: 8983087996896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top