>gb|AC149072.1| x. tropicalis BAC clone ISB1-341L17 containing genes for vex1 and
             vent1, complete sequence
          Length = 65797

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    tgctccgaagggcttcaacg 113
             ||||||||||||||||||||
Sbjct: 34317 tgctccgaagggcttcaacg 34298

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 30    aattccaaaggctagctac 48
             |||||||||||||||||||
Sbjct: 71151 aattccaaaggctagctac 71169

>gb|AC122852.2| Mus musculus BAC clone RP23-172A6 from 18, complete sequence
          Length = 189709

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 36   aaaggctagctacttcaaa 54
            |||||||||||||||||||
Sbjct: 5555 aaaggctagctacttcaaa 5573

>gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, complete sequence
          Length = 178929

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 36     aaaggctagctacttcaaa 54
              |||||||||||||||||||
Sbjct: 155173 aaaggctagctacttcaaa 155191

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 98     ccgaagggcttcaacgaaatcca 120
              ||||||| |||||||||||||||
Sbjct: 249674 ccgaaggtcttcaacgaaatcca 249652

>gb|AC137838.40| Medicago truncatula clone mth2-34l12, complete sequence
          Length = 121469

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 89    tcacatgctccgaagggct 107
             |||||||||||||||||||
Sbjct: 13223 tcacatgctccgaagggct 13241

>emb|BX649538.4| Zebrafish DNA sequence from clone CH211-239N21 in linkage group 3,
             complete sequence
          Length = 147441

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    ttaaggcaattccaaaggc 41
             |||||||||||||||||||
Sbjct: 66422 ttaaggcaattccaaaggc 66440

>gb|AC104062.3| Homo sapiens BAC clone RP11-11I23 from 4, complete sequence
          Length = 159658

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 40     gctagctacttcaaatctt 58
              |||||||||||||||||||
Sbjct: 125779 gctagctacttcaaatctt 125797

>gb|AY064470.1| Aplysia californica CREB-binding protein (CBP) mRNA, complete cds
          Length = 7752

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 105  gcttcaacgaaatccaaac 123
            |||||||||||||||||||
Sbjct: 3866 gcttcaacgaaatccaaac 3884

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 38.2 bits (19), Expect = 6.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 109    caacgaaatccaaacctcc 127
              |||||||||||||||||||
Sbjct: 774181 caacgaaatccaaacctcc 774163


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 592,930
Number of Sequences: 3902068
Number of extensions: 592930
Number of successful extensions: 36601
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36570
Number of HSP's gapped (non-prelim): 31
length of query: 128
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 107
effective length of database: 17,151,101,840
effective search space: 1835167896880
effective search space used: 1835167896880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)