ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags37b16 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha Length = 1609 Score = 107 bits (54), Expect = 2e-20 Identities = 72/79 (91%) Strand = Plus / Minus Query: 166 atttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgc 225 ||||||| |||||||||| |||||| |||||||| |||||||| |||||||| || |||| Sbjct: 1398 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 1339 Query: 226 ccttgatgacaccaacagc 244 ||||||||||||||||||| Sbjct: 1338 ccttgatgacaccaacagc 1320
>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev Length = 325 Score = 107 bits (54), Expect = 2e-20 Identities = 72/79 (91%) Strand = Plus / Plus Query: 166 atttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgc 225 ||||||| |||||||||| |||||| |||||||| |||||||| |||||||| || |||| Sbjct: 167 atttcttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgc 226 Query: 226 ccttgatgacaccaacagc 244 ||||||||||||||||||| Sbjct: 227 ccttgatgacaccaacagc 245
>gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha-subunit (TEF1) mRNA, complete cds Length = 2062 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/82 (89%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| |||||||||| |||||| |||||||| ||||| || |||||||| || | Sbjct: 1826 ctcatttcttcttgatggcagccttggtcaccttggcgccggttgggtccttcttctcca 1767 Query: 223 cgcccttgatgacaccaacagc 244 | |||||||||||||||||||| Sbjct: 1766 cacccttgatgacaccaacagc 1745
>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS Length = 1560 Score = 93.7 bits (47), Expect = 3e-16 Identities = 77/88 (87%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||||| |||| ||||||||||||||| ||||| || |||||||| || | Sbjct: 1391 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 1332 Query: 223 cgcccttgatgacaccaacagcaaccgt 250 ||| |||||| ||||| ||||||||||| Sbjct: 1331 cgctcttgatcacacccacagcaaccgt 1304
>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence Length = 1725 Score = 93.7 bits (47), Expect = 3e-16 Identities = 77/88 (87%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||||| |||| ||||||||||||||| ||||| || |||||||| || | Sbjct: 1452 ctcatttcttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctcca 1393 Query: 223 cgcccttgatgacaccaacagcaaccgt 250 ||| |||||| ||||| ||||||||||| Sbjct: 1392 cgctcttgatcacacccacagcaaccgt 1365
>gb|U80268.1|MDU80268 Malus domestica elongation factor 1 alpha (EF-1alpha) mRNA, partial cds Length = 748 Score = 91.7 bits (46), Expect = 1e-15 Identities = 62/68 (91%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||||||| ||||||||||||| ||||||| |||||| |||||| Sbjct: 417 gcagacttggtgaccttggcaccgctgggatccttcttctcaacgctcttgataacacca 358 Query: 240 acagcaac 247 |||||||| Sbjct: 357 acagcaac 350
>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence Length = 959 Score = 83.8 bits (42), Expect = 2e-13 Identities = 75/87 (86%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| || || |||| |||||| ||||||||||| || || |||||||| || || Sbjct: 804 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 745 Query: 224 gcccttgatgacaccaacagcaaccgt 250 || ||||||||| |||||||||||||| Sbjct: 744 gctcttgatgactccaacagcaaccgt 718
>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds Length = 1546 Score = 83.8 bits (42), Expect = 2e-13 Identities = 75/87 (86%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| || || |||| |||||| ||||||||||| || || |||||||| || || Sbjct: 1375 tcatttcttctttattgcagccttggtcaccttggcaccagttgggtccttcttctccac 1316 Query: 224 gcccttgatgacaccaacagcaaccgt 250 || ||||||||| |||||||||||||| Sbjct: 1315 gctcttgatgactccaacagcaaccgt 1289
>gb|DQ174253.1| Gossypium hirsutum translation elongation factor 1A-4 (EF1A4) mRNA, complete cds Length = 1565 Score = 81.8 bits (41), Expect = 1e-12 Identities = 71/82 (86%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| |||| ||||| ||||| |||||||| ||||||||||| |||| Sbjct: 1345 ctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctcaa 1286 Query: 223 cgcccttgatgacaccaacagc 244 ||| |||||||||||||||||| Sbjct: 1285 cgctcttgatgacaccaacagc 1264
>gb|DQ174250.1| Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds Length = 1567 Score = 81.8 bits (41), Expect = 1e-12 Identities = 71/82 (86%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| |||| ||||| ||||| |||||||| ||||||||||| |||| Sbjct: 1345 ctcatttcttcttggcagcagatttggtgaccttagcaccggttggatccttcttctcaa 1286 Query: 223 cgcccttgatgacaccaacagc 244 ||| |||||||||||||||||| Sbjct: 1285 cgctcttgatgacaccaacagc 1264
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4101208 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101149 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4101148 cgttcttgatgacgccaacagccaccgtt 4101120 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4078916 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078857 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4078856 cgttcttgatgacgccaacagccaccgtt 4078828 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 4084355 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084296 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 4084295 gttcttgatgacgccaacagccaccgtt 4084268 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4095038 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4094979 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4094978 cgttcttgatgacgccaacagccaccgtt 4094950
>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0061L19, from chromosome 3, complete sequence Length = 153322 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Plus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 20452 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 20511 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 20512 cgttcttgatgacgccaacagccaccgtt 20540 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Plus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 15013 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 15072 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 15073 gttcttgatgacgccaacagccaccgtt 15100 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Plus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4330 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4389 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4390 cgttcttgatgacgccaacagccaccgtt 4418
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4101317 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4101258 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4101257 cgttcttgatgacgccaacagccaccgtt 4101229 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4079027 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4078968 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4078967 cgttcttgatgacgccaacagccaccgtt 4078939 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 4084466 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 4084407 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 4084406 gttcttgatgacgccaacagccaccgtt 4084379 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 4095149 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 4095090 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 4095089 cgttcttgatgacgccaacagccaccgtt 4095061
>gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0050H14, complete sequence Length = 142245 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1845 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1786 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1785 cgttcttgatgacgccaacagccaccgtt 1757
>gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRNA, complete cds Length = 1738 Score = 79.8 bits (40), Expect = 4e-12 Identities = 56/62 (90%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||||||||| ||||||||||| || |||| ||||||||||||| Sbjct: 1425 gcagccttggtgaccttggcaccggtcggatccttcttctccacgctcttgatgacacca 1366 Query: 240 ac 241 || Sbjct: 1365 ac 1364
>dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-F06, full insert sequence Length = 1632 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1440 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1381 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1380 cgttcttgatgacgccaacagccaccgtt 1352
>dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A11, full insert sequence Length = 1661 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1435 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1376 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1375 cgttcttgatgacgccaacagccaccgtt 1347
>dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138K07, full insert sequence Length = 3222 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 3030 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 2971 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 2970 cgttcttgatgacgccaacagccaccgtt 2942
>dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024M04, full insert sequence Length = 2157 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 2001 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1942 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1941 cgttcttgatgacgccaacagccaccgtt 1913
>dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126K23, full insert sequence Length = 1760 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1439 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1380 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1379 cgttcttgatgacgccaacagccaccgtt 1351
>dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016F09, full insert sequence Length = 1653 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1428 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1369 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1368 cgttcttgatgacgccaacagccaccgtt 1340
>dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G10, full insert sequence Length = 1357 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1161 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1102 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1101 cgttcttgatgacgccaacagccaccgtt 1073
>gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-alpha 1 (EF-1-alpha1) mRNA, complete cds Length = 1700 Score = 79.8 bits (40), Expect = 4e-12 Identities = 73/85 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||||| |||| |||||| ||||||||||| |||||||||||||| |||| Sbjct: 1420 ctcacttcttcttgatagcagccttggtcaccttggcaccagtgggatccttcttctcaa 1361 Query: 223 cgcccttgatgacaccaacagcaac 247 | | ||| || || ||||||||||| Sbjct: 1360 cactcttaataaccccaacagcaac 1336
>gb|AF030517.1|AF030517 Oryza sativa translation elongation factor-1 alpha mRNA, complete cds Length = 1562 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1345 ctcatttcttcttgcgggcagccttggtcaccttggcaccggttgggtccttcttctcca 1286 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1285 cgttcttgatgacgccaacagccaccgtt 1257
>dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1630 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1406 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1347 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1346 cgttcttgatgacgccaacagccaccgtt 1318
>dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1644 Score = 79.8 bits (40), Expect = 4e-12 Identities = 76/89 (85%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1418 ctcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1359 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1358 cgttcttgatgacgccaacagccaccgtt 1330
>dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B11, full insert sequence Length = 1722 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 1441 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1382 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 1381 gttcttgatgacgccaacagccaccgtt 1354
>dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C01, full insert sequence Length = 1620 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 1440 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1381 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 1380 gttcttgatgacgccaacagccaccgtt 1353
>gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds Length = 1686 Score = 77.8 bits (39), Expect = 1e-11 Identities = 72/84 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| || | |||| ||||||||||||||| || |||||||||||||| ||||| Sbjct: 1383 tcatttcttcttcacagcagacttggtaaccttggctccagtgggatccttcttctcaac 1324 Query: 224 gcccttgatgacaccaacagcaac 247 |||||||||||| |||||||| Sbjct: 1323 attcttgatgacaccgacagcaac 1300
>dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1-alpha, complete cds Length = 1700 Score = 77.8 bits (39), Expect = 1e-11 Identities = 72/84 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||||| |||| |||||| |||||||| ||||| ||||||||||| || || Sbjct: 1377 tcatttcttcttgattgcagccttggtgaccttggctccggtaggatccttcttctccac 1318 Query: 224 gcccttgatgacaccaacagcaac 247 | ||||||||| || |||||||| Sbjct: 1317 actcttgatgactcccacagcaac 1294
>dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1857 Score = 77.8 bits (39), Expect = 1e-11 Identities = 72/84 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| || ||||||| |||||| |||||||||| || || |||||||| ||||| Sbjct: 1439 tcatttcttcttcatggcagccttggtgaccttggcactagttggttccttcttgtcaac 1380 Query: 224 gcccttgatgacaccaacagcaac 247 | |||||||||||| |||||||| Sbjct: 1379 actcttgatgacacccacagcaac 1356
>dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1599 Score = 77.8 bits (39), Expect = 1e-11 Identities = 75/88 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||||| |||||| |||||||||||||| || |||||||| || || Sbjct: 1419 tcatttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccac 1360 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | ||||||||| |||||||| |||||| Sbjct: 1359 gttcttgatgacgccaacagccaccgtt 1332
>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence Length = 1712 Score = 75.8 bits (38), Expect = 6e-11 Identities = 74/87 (85%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| |||| |||||| |||||||||||||| || |||||||| || || Sbjct: 1439 tcatttcttcttggcagcagccttggtcaccttggcaccggtcgggtccttcttctccac 1380 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||||| |||||||||||||| Sbjct: 1379 actcttgatgactccaacagcaaccgt 1353
>gb|AY962821.1| Prunus armeniaca elongation factor 1 alpha mRNA, partial cds Length = 314 Score = 75.8 bits (38), Expect = 6e-11 Identities = 60/68 (88%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||||||||| ||||||||||||| || |||| |||||| |||||| Sbjct: 243 gcagacttggtgaccttggcaccactgggatccttcttctccacgctcttgataacacca 184 Query: 240 acagcaac 247 |||||||| Sbjct: 183 acagcaac 176
>emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 on chromosome 3, complete sequence Length = 113400 Score = 75.8 bits (38), Expect = 6e-11 Identities = 60/68 (88%) Strand = Plus / Plus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| ||||| ||||||||||| || || |||||||||||||| Sbjct: 72737 gcagccttggtgaccttggctccggtaggatccttcttctccacagccttgatgacacca 72796 Query: 240 acagcaac 247 |||||||| Sbjct: 72797 acagcaac 72804 Score = 69.9 bits (35), Expect = 4e-09 Identities = 55/62 (88%) Strand = Plus / Plus Query: 186 ttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagca 245 ||||| || ||||| ||||||||||||||||| || || |||||||||||||||||||| Sbjct: 82280 ttggtgactttggctccggtgggatccttcttctccacagccttgatgacaccaacagca 82339 Query: 246 ac 247 || Sbjct: 82340 ac 82341
>dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic elongation factor 1A, complete cds Length = 1646 Score = 73.8 bits (37), Expect = 2e-10 Identities = 70/82 (85%) Strand = Plus / Minus Query: 166 atttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgc 225 ||||||| || | ||||| |||||| ||||||||||| || || |||||||| ||||| Sbjct: 1364 atttcttcttaagggcagccttggtgaccttggcaccagttgggtccttcttctcaacat 1305 Query: 226 ccttgatgacaccaacagcaac 247 ||||||||||||||||||||| Sbjct: 1304 tcttgatgacaccaacagcaac 1283
>dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C04, full insert sequence Length = 1818 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1371 cgttcttgatgacgccaacagccaccgtt 1343
>dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C03, full insert sequence Length = 1130 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 900 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 841 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 840 cgttcttgatgacgccaacagccaccgtt 812
>emb|X96678.1|NPELF N.pseudonarcissu mRNA for elongation factor Length = 988 Score = 71.9 bits (36), Expect = 9e-10 Identities = 72/85 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| |||| ||| || ||||||||||| || ||||||||||| |||| Sbjct: 732 ctcatttcttcttggcagcagcctttgtgaccttggcacctgtaggatccttcttctcaa 673 Query: 223 cgcccttgatgacaccaacagcaac 247 | | |||||| |||||||||||||| Sbjct: 672 cactcttgataacaccaacagcaac 648
>dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100M05, full insert sequence Length = 1867 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1706 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1647 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1646 cgttcttgatgacgccaacagccaccgtt 1618
>dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091A02, full insert sequence Length = 1658 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1431 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1372 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1371 cgttcttgatgacgccaacagccaccgtt 1343
>dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds Length = 1637 Score = 71.9 bits (36), Expect = 9e-10 Identities = 75/89 (84%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||| ||||| ||| ||||| |||||| |||||||||||||| || |||||||| || | Sbjct: 1410 ctcacttcttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctcca 1351 Query: 223 cgcccttgatgacaccaacagcaaccgtt 251 || ||||||||| |||||||| |||||| Sbjct: 1350 cgttcttgatgacgccaacagccaccgtt 1322
>emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a Length = 1979 Score = 69.9 bits (35), Expect = 4e-09 Identities = 60/69 (86%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| |||||||| ||||| ||||||||||| |||||| ||||||||| || Sbjct: 1894 ggcagccttggtgaccttggctccggtaggatccttcttctcaacgttcttgatgactcc 1835 Query: 239 aacagcaac 247 |||||||| Sbjct: 1834 cacagcaac 1826
>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds Length = 1596 Score = 69.9 bits (35), Expect = 4e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 ||||||||||||||| ||||| || |||||||| || || | ||||||||| |||||||| Sbjct: 1392 cttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaacagc 1333 Query: 245 aaccgt 250 |||||| Sbjct: 1332 aaccgt 1327
>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence Length = 1705 Score = 67.9 bits (34), Expect = 1e-08 Identities = 73/87 (83%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||| | |||||| |||||||| ||||| || |||||||| || || Sbjct: 1423 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1364 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||||| |||||||||||||| Sbjct: 1363 actcttgatgactccaacagcaaccgt 1337
>gb|AY264244.1| Trachydoras nattereri haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1110 Score = 67.9 bits (34), Expect = 1e-08 Identities = 36/37 (97%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||||||||||||||||||||||||| Sbjct: 1110 ccttcttctcaacgcccttgatgacaccaacagcaac 1074
>gb|AY310807.1| Nicotiana benthamiana clone 12-120 unknown mRNA Length = 451 Score = 67.9 bits (34), Expect = 1e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||||||||| || || |||||||| |||||| |||||| |||||| Sbjct: 116 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 57 Query: 240 acagcaac 247 |||||||| Sbjct: 56 acagcaac 49
>gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, complete cds Length = 1644 Score = 67.9 bits (34), Expect = 1e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 186 ttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagca 245 |||||||||||||| ||||||||||||||||| || |||| ||||| ||||| || ||| Sbjct: 1408 ttggtaaccttggctccggtgggatccttcttctccacgcttttgataacacccacggca 1349 Query: 246 accgt 250 ||||| Sbjct: 1348 accgt 1344
>gb|AY205999.1| Malva pusilla translation elongation factor-1 alpha mRNA, partial cds Length = 1320 Score = 67.9 bits (34), Expect = 1e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| | |||||||||||| || || ||||| ||||| | ||||||||||||| Sbjct: 1189 gcagccttggtgatcttggcaccggttgggtctttcttctcaacactcttgatgacacca 1130 Query: 240 acagcaac 247 |||||||| Sbjct: 1129 acagcaac 1122
>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds Length = 1604 Score = 67.9 bits (34), Expect = 1e-08 Identities = 73/87 (83%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||| | |||||| |||||||| ||||| || |||||||| || || Sbjct: 1404 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1345 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||||| |||||||||||||| Sbjct: 1344 actcttgatgactccaacagcaaccgt 1318
>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds Length = 1600 Score = 67.9 bits (34), Expect = 1e-08 Identities = 73/87 (83%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||| | |||||| |||||||| ||||| || |||||||| || || Sbjct: 1415 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1356 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||||| |||||||||||||| Sbjct: 1355 actcttgatgactccaacagcaaccgt 1329
>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence Length = 2360 Score = 67.9 bits (34), Expect = 1e-08 Identities = 73/87 (83%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||| | |||||| |||||||| ||||| || |||||||| || || Sbjct: 2032 tcatttcttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccac 1973 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||||| |||||||||||||| Sbjct: 1972 actcttgatgactccaacagcaaccgt 1946
>gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-like adhesion protein mRNA, complete cds Length = 1776 Score = 67.9 bits (34), Expect = 1e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||||||||| || || |||||||| |||||| |||||| |||||| Sbjct: 1423 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1364 Query: 240 acagcaac 247 |||||||| Sbjct: 1363 acagcaac 1356
>dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds Length = 1671 Score = 67.9 bits (34), Expect = 1e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||||||||| || || |||||||| |||||| |||||| |||||| Sbjct: 1355 gcagccttggtgaccttggcaccagttgggtccttcttgtcaacgttcttgataacacca 1296 Query: 240 acagcaac 247 |||||||| Sbjct: 1295 acagcaac 1288
>ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07920 mRNA, complete cds Length = 1782 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 1450 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1391 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 1390 gataacaccgactgcaac 1373
>gb|AF417301.1| Castanea sativa translation elongation factor 1 alpha-like protein mRNA, partial cds Length = 452 Score = 65.9 bits (33), Expect = 6e-08 Identities = 57/66 (86%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| ||||||||||||||| || | ||||||||||| ||||| |||||||||||| Sbjct: 87 ggcagacttggtaaccttggcnccagaaggatccttcttctcaacattcttgatgacacc 28 Query: 239 aacagc 244 |||||| Sbjct: 27 aacagc 22
>emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elongation factor 1-alpha Length = 6022 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 1910 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1851 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 1850 gataacaccgactgcaac 1833 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 5331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 5272 Query: 240 acagcaac 247 || ||||| Sbjct: 5271 actgcaac 5264
>dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, complete cds, clone: RAFL22-81-H15 Length = 630 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 358 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 299 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 298 gataacaccgactgcaac 281
>gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translation elongation factor 1 alpha chain (eEF-1) mRNA, partial cds Length = 460 Score = 65.9 bits (33), Expect = 6e-08 Identities = 61/71 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||| |||||||| || |||||||| || |||| |||||| |||||| Sbjct: 273 gcagccttggtgaccttagcaccggttgggtccttcttgtcgacgctcttgataacacca 214 Query: 240 acagcaaccgt 250 ||||| ||||| Sbjct: 213 acagccaccgt 203
>gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, partial cds Length = 523 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| |||||| |||||||| ||||| || |||||||| || |||| ||| Sbjct: 258 cttcttgacggcagccttggtcaccttggctccggttgggtccttcttgtccacgctctt 199 Query: 230 gatgacaccaacagcaac 247 ||||||||| || ||||| Sbjct: 198 gatgacaccgactgcaac 181
>emb|BX815663.1|CNS0ABIH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS81ZC04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 353 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 84 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 25 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 24 gataacaccgactgcaac 7
>gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete sequence Length = 1687 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 1419 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1360 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 1359 gataacaccgactgcaac 1342
>gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940) mRNA, complete cds Length = 1704 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 1358 gataacaccgactgcaac 1341
>gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07920) mRNA, complete cds Length = 1664 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 1418 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 1359 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 1358 gataacaccgactgcaac 1341
>gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I, complete sequence Length = 120965 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Minus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 12884 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 12825 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 12824 gataacaccgactgcaac 12807 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 16331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 16272 Query: 240 acagcaac 247 || ||||| Sbjct: 16271 actgcaac 16264 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Plus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 19267 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 19326 Query: 240 acagcaac 247 || ||||| Sbjct: 19327 actgcaac 19334
>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4, AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes, partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1), EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13 genes, complete cds Length = 63093 Score = 65.9 bits (33), Expect = 6e-08 Identities = 66/78 (84%) Strand = Plus / Plus Query: 170 cttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaacgccctt 229 ||| |||| ||||| ||||||||||||||| ||||| || |||||||| ||||| | ||| Sbjct: 47828 cttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactctt 47887 Query: 230 gatgacaccaacagcaac 247 ||| ||||| || ||||| Sbjct: 47888 gataacaccgactgcaac 47905 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Plus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 44398 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 44457 Query: 240 acagcaac 247 || ||||| Sbjct: 44458 actgcaac 44465 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 41457 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 41398 Query: 240 acagcaac 247 || ||||| Sbjct: 41397 actgcaac 41390
>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence Length = 930 Score = 63.9 bits (32), Expect = 2e-07 Identities = 55/63 (87%) Strand = Plus / Plus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 ||||||||||||||| ||||| || |||||||| || || | ||||||||| |||||||| Sbjct: 320 cttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaacagc 379 Query: 245 aac 247 ||| Sbjct: 380 aac 382
>gb|AY300042.1| Solanum tuberosum putative translation elongation factor protein mRNA, partial cds Length = 864 Score = 61.9 bits (31), Expect = 9e-07 Identities = 59/69 (85%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| |||||| ||||| ||||| Sbjct: 846 ggcagccttggtcaccttggcaccagttgggtccttcttgtcaacgttcttgacaacacc 787 Query: 239 aacagcaac 247 ||||||||| Sbjct: 786 aacagcaac 778
>gb|DQ174251.1| Gossypium hirsutum translation elongation factor 1A-2 (EF1A2) mRNA, complete cds Length = 1566 Score = 61.9 bits (31), Expect = 9e-07 Identities = 56/65 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||||||||| || |||||||| || || | |||||| |||||| Sbjct: 1328 gcagacttggtgaccttggcaccggttgggtccttcttctcgacactcttgataacacca 1269 Query: 240 acagc 244 ||||| Sbjct: 1268 acagc 1264
>gb|DQ399793.1| Phoenix dactylifera elongation factor 1-alpha mRNA, partial cds Length = 736 Score = 61.9 bits (31), Expect = 9e-07 Identities = 36/38 (94%) Strand = Plus / Minus Query: 207 ggatccttcttntcaacgcccttgatgacaccaacagc 244 ||||||||||| ||||||| |||||||||||||||||| Sbjct: 734 ggatccttcttctcaacgctcttgatgacaccaacagc 697
>gb|AF281361.1| Saccharum officinarum elongation factor mRNA, complete cds Length = 1745 Score = 61.9 bits (31), Expect = 9e-07 Identities = 73/88 (82%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| |||| |||||| |||||||| ||||| || |||||||| || || Sbjct: 1447 tcatttcttcttggcagcagccttggtcaccttggcgccggtcgggtccttcttctccac 1388 Query: 224 gcccttgatgacaccaacagcaaccgtt 251 | |||||||| ||||||||||||||| Sbjct: 1387 actcttgatgattccaacagcaaccgtt 1360
>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds Length = 1592 Score = 61.9 bits (31), Expect = 9e-07 Identities = 70/84 (83%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| ||| | |||||| |||||||| ||||| || |||||||| || || Sbjct: 1444 tcatttcttcttggcggccgccttggtcaccttggcgccggtcgggtccttcttctccac 1385 Query: 224 gcccttgatgacaccaacagcaac 247 | ||||||||| ||||||||||| Sbjct: 1384 actcttgatgactccaacagcaac 1361
>ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07930 mRNA, complete cds Length = 1778 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1365 Query: 240 acagcaac 247 || ||||| Sbjct: 1364 actgcaac 1357
>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence Length = 1687 Score = 60.0 bits (30), Expect = 3e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| |||| |||||| |||||||| ||||| || |||||||| || || Sbjct: 1424 tcatttcttcttggcagcagccttggtcaccttggcgccggttgggtccttcttctccac 1365 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | |||||| || |||||||||||||| Sbjct: 1364 actcttgataactccaacagcaaccgt 1338
>gb|AY264255.1| Centromochlus heckelii elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1072 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1072 ccttcttctcaacgctcttgatgacaccaacagcaac 1036
>gb|AY264252.1| Auchenipterichthys thoracatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1140 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1140 ccttcttctcaacgctcttgatgacaccaacagcaac 1104
>gb|AY264245.1| Trachydoras cf. microstomus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1118 ccttcttctcaacgctcttgatgacaccaacagcaac 1082
>gb|AY264241.1| Leptodoras cf. copei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1109 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1109 ccttcttctcaacgctcttgatgacaccaacagcaac 1073
>gb|AY264240.1| Leptodoras linnelli elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaac 1075
>gb|AY264237.1| Leptodoras sp. 1-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1110 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1110 ccttcttctcaacgctcttgatgacaccaacagcaac 1074
>gb|AY264236.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1083 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacagcaac 1047
>gb|AY264235.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacagcaac 1075
>gb|AY264225.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaac 1076
>gb|AY264224.1| Hassar sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaac 1076
>gb|AY264223.1| Opsodoras sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1113 ccttcttctcaacgctcttgatgacaccaacagcaac 1077
>gb|AY264222.1| Opsodoras ternetzi haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1107 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1107 ccttcttctcaacgctcttgatgacaccaacagcaac 1071
>gb|AY264219.1| Doras micropoeus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1112 ccttcttctcaacgctcttgatgacaccaacagcaac 1076
>gb|AY264217.1| Doraops zuloagai elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1120 ccttcttctcaacgctcttgatgacaccaacagcaac 1084
>gb|AY264214.1| Oxydoras niger haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1116 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1116 ccttcttctcaacgctcttgatgacaccaacagcaac 1080
>gb|AY264212.1| Orinocodoras eigenmanni elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1126 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1126 ccttcttctcaacgctcttgatgacaccaacagcaac 1090
>gb|AY264210.1| Rhinodoras cf. boehlkei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1117 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1117 ccttcttctcaacgctcttgatgacaccaacagcaac 1081
>gb|AY264209.1| Rhinodoras boehlkei elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1088 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1088 ccttcttctcaacgctcttgatgacaccaacagcaac 1052
>gb|AY264208.1| Platydoras costatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1108 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1108 ccttcttctcaacgctcttgatgacaccaacagcaac 1072
>gb|AY264206.1| Lithodoras dorsalis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1110 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1110 ccttcttctcaacgctcttgatgacaccaacagcaac 1074
>gb|AY264205.1| Megalodoras uranoscopus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1084 Score = 60.0 bits (30), Expect = 3e-06 Identities = 35/37 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||||||||| Sbjct: 1084 ccttcttctcaacgctcttgatgacaccaacagcaac 1048
>gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1381 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 240 acagcaac 247 || ||||| Sbjct: 1268 actgcaac 1261
>gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1-alpha (At1g07930) mRNA, complete cds Length = 1705 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 240 acagcaac 247 || ||||| Sbjct: 1360 actgcaac 1353
>emb|X60302.1|DCEF1A D.carota gene for elongation factor 1A Length = 1785 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || ||||||||||| ||||| |||||||||| ||| Sbjct: 1539 gcagccttggtgaccttggcgccagttggatccttcttctcaacagccttgatgactcca 1480 Query: 240 acagcaac 247 || ||||| Sbjct: 1479 actgcaac 1472
>emb|AJ223969.1|MDAJ39669 Malus domestica mRNA for elongation factor 1 alpha subunit Length = 1715 Score = 60.0 bits (30), Expect = 3e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 207 ggatccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||||||| ||||||| ||||||||||||||| ||||| Sbjct: 1395 ggatccttcttctcaacgctcttgatgacaccaactgcaac 1355
>gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1679 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 240 acagcaac 247 || ||||| Sbjct: 1360 actgcaac 1353
>gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1657 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 240 acagcaac 247 || ||||| Sbjct: 1360 actgcaac 1353
>gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1350 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 240 acagcaac 247 || ||||| Sbjct: 1268 actgcaac 1261
>gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, complete cds Length = 1682 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1414 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1355 Query: 240 acagcaac 247 || ||||| Sbjct: 1354 actgcaac 1347
>gb|AF154660.1| Nicotiana tabacum clone PR51 mRNA sequence Length = 948 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||| ||||| || || |||||||| |||||| |||||| |||||| Sbjct: 611 gcagccttggtgaccttagcaccagttgggtccttcttgtcaacgttcttgataacacca 552 Query: 240 acagcaac 247 |||||||| Sbjct: 551 acagcaac 544
>gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1677 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| ||||| Sbjct: 1420 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 1361 Query: 240 acagcaac 247 || ||||| Sbjct: 1360 actgcaac 1353
>dbj|AB019427.1| Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds Length = 1734 Score = 60.0 bits (30), Expect = 3e-06 Identities = 58/68 (85%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||| ||||| || || |||||||| |||||| |||||| |||||| Sbjct: 1396 gcagccttggtgaccttagcaccagttgggtccttcttgtcaacgttcttgataacacca 1337 Query: 240 acagcaac 247 |||||||| Sbjct: 1336 acagcaac 1329
>emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation factor 1-alpha (EF1-a) Length = 1304 Score = 58.0 bits (29), Expect = 1e-05 Identities = 71/86 (82%) Strand = Plus / Minus Query: 162 actcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntca 221 ||||| ||||| |||| |||| |||||| | |||||| || || ||||||||||| ||| Sbjct: 985 actcacttcttcttgactgcagccttggtgatcttggctccagttggatccttcttctca 926 Query: 222 acgcccttgatgacaccaacagcaac 247 || | ||| |||||||| |||||||| Sbjct: 925 acactcttaatgacaccgacagcaac 900
>emb|AJ720062.1| Gallus gallus mRNA for hypothetical protein, clone 10b5 Length = 3070 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 2722 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 2683
>ref|NM_204157.2| Gallus gallus eukaryotic translation elongation factor 1 alpha 1 (EEF1A1), mRNA Length = 3070 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 2722 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 2683
>gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromosome ul, complete sequence Length = 161905 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Plus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 127908 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 127947
>emb|BX935744.1| Gallus gallus finished cDNA, clone ChEST2k15 Length = 1043 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 711 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 672
>gb|AF268682.1|AF268682 Meleagris gallopavo DNA sequence derived using primers specific for chicken EST AW313486 Length = 589 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Plus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 158 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 197
>gb|AF268670.1|AF268670 Numida meleagris DNA sequence derived using primers specific for chicken EST AW313486 Length = 620 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Plus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 178 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 217
>gb|L00677.1|CHKEF1A Gallus gallus elongation factor 1 alpha mRNA, complete cds Length = 1690 Score = 58.0 bits (29), Expect = 1e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||||||||| Sbjct: 1393 ccttcttgtcgacggccttgatgacaccaacagcaaccgt 1354
>gb|AY264250.1| Ageneiosus ucayalensis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1136 Score = 56.0 bits (28), Expect = 5e-05 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| |||||| ||||||||||||||||||||| Sbjct: 1136 ccttcttctcaacgytcttgatgacaccaacagcaac 1100
>gb|AY114651.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920) mRNA, complete cds Length = 1463 Score = 56.0 bits (28), Expect = 5e-05 Identities = 50/58 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacac 237 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| |||| Sbjct: 1328 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacac 1271
>gb|AY062553.1| Arabidopsis thaliana putative elongation factor 1-a (At1g07920; T6D22.2) mRNA, complete cds Length = 1778 Score = 56.0 bits (28), Expect = 5e-05 Identities = 50/58 (86%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacac 237 |||| ||||||||||||||| ||||| || |||||||| ||||| | |||||| |||| Sbjct: 1424 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacac 1367
>gb|AY643400.1| Pimephales promelas elongation factor 1-alpha mRNA, complete cds Length = 1748 Score = 56.0 bits (28), Expect = 5e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 213 ttcttntcaacgcccttgatgacaccaacagcaac 247 ||||| ||||||| ||||||||||||||||||||| Sbjct: 1402 ttcttctcaacgctcttgatgacaccaacagcaac 1368
>dbj|AB056104.1| Carassius auratus mRNA for elongation factor-1 alpha, complete cds Length = 1704 Score = 56.0 bits (28), Expect = 5e-05 Identities = 33/35 (94%) Strand = Plus / Minus Query: 213 ttcttntcaacgcccttgatgacaccaacagcaac 247 ||||| ||||||| ||||||||||||||||||||| Sbjct: 1366 ttcttctcaacgctcttgatgacaccaacagcaac 1332
>gb|AY832572.1| Pseudotsuga menziesii haplotype Pm-EF1A_18 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 54.0 bits (27), Expect = 2e-04 Identities = 56/66 (84%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || ||||||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtaggatccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832560.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_5 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 54.0 bits (27), Expect = 2e-04 Identities = 56/66 (84%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || ||||||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtaggatccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1753 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 1380 ggcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 1321 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1320 aacagcaac 1312
>gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1723 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 1391 ggcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 1332 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1331 aacagcaac 1323
>gb|AF242732.1| Capsicum annuum translation elongation factor 1a mRNA, complete cds Length = 1521 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 1389 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 1330 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1329 aacagcaac 1321
>gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-related protein mRNA, partial cds Length = 965 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| |||||||| || || ||||||||||| || ||| ||||||||| || Sbjct: 567 ggcagccttggtgaccttggctccagtaggatccttcttctccacgttcttgatgactcc 508 Query: 239 aacagcaac 247 |||||||| Sbjct: 507 cacagcaac 499
>gb|AY264215.1| Agamyxis albomaculatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1115 Score = 54.0 bits (27), Expect = 2e-04 Identities = 32/34 (94%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagc 244 ||||||| ||||||| |||||||||||||||||| Sbjct: 1115 ccttcttctcaacgctcttgatgacaccaacagc 1082
>gb|AY496125.1| Capsicum annuum elongation factor 1-alpha mRNA, complete cds Length = 635 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 522 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 463 Query: 239 aacagcaac 247 ||||||||| Sbjct: 462 aacagcaac 454
>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds Length = 432 Score = 54.0 bits (27), Expect = 2e-04 Identities = 71/87 (81%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||||||| ||| |||| |||||| |||||||| ||||| |||||||| || || || Sbjct: 432 tcatttcttcttggccgcagccttggtcaccttggcgccggtcggatccttnttctccac 373 Query: 224 gcccttgatgacaccaacagcaaccgt 250 | ||||||| || || || |||||||| Sbjct: 372 ggccttgataacgcccaccgcaaccgt 346
>emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha Length = 4565 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 3862 ggcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 3803 Query: 239 aacagcaac 247 ||||||||| Sbjct: 3802 aacagcaac 3794
>emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 alpha Length = 1692 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 1389 ggcagccttggtcaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 1330 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1329 aacagcaac 1321
>gb|AF464925.1| Elaeis oleifera elongation factor 1-alpha mRNA, complete cds Length = 1805 Score = 54.0 bits (27), Expect = 2e-04 Identities = 47/54 (87%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 |||||| | ||||||||| || ||||||||||| || |||| |||||||||||| Sbjct: 1379 cttggtgatcttggcaccagttggatccttcttctccacgctcttgatgacacc 1326
>emb|AJ010225.1|CAR010225 Cicer arietinum mRNA for elongation factor 1-alpha (clone CanEF1-a2), partial Length = 626 Score = 54.0 bits (27), Expect = 2e-04 Identities = 47/54 (87%) Strand = Plus / Minus Query: 194 cttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagcaac 247 |||||| || || ||||||||||| ||||| | |||||||||||| |||||||| Sbjct: 364 cttggctccagttggatccttcttctcaacactcttgatgacaccgacagcaac 311
>gb|DQ268854.1| Solanum tuberosum clone 171A01 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1678 Score = 54.0 bits (27), Expect = 2e-04 Identities = 58/69 (84%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| ||||| Sbjct: 1355 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacacc 1296 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1295 aacagcaac 1287
>ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT5G60390 transcript variant AT5G60390.1 mRNA, complete cds Length = 1761 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1394 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1335 Query: 240 acagcaac 247 |||||||| Sbjct: 1334 acagcaac 1327
>ref|NM_001037030.1| Arabidopsis thaliana calmodulin binding / translation elongation factor AT5G60390 transcript variant AT5G60390.2 mRNA, complete cds Length = 1715 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1348 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1289 Query: 240 acagcaac 247 |||||||| Sbjct: 1288 acagcaac 1281
>ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.2 mRNA, complete cds Length = 1990 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 1571 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 1512 Query: 240 acagcaac 247 || ||||| Sbjct: 1511 actgcaac 1504
>ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / translation elongation factor AT1G07940 transcript variant AT1G07940.1 mRNA, complete cds Length = 1864 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 1445 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 1386 Query: 240 acagcaac 247 || ||||| Sbjct: 1385 actgcaac 1378
>gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1142 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| |||||||||||| |||||||| Sbjct: 1142 ccttcttctcaacgctcttgatgacaccgacagcaac 1106
>gb|AY264254.1| Liosomadoras morrowi elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1117 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1117 ccttcttctcaacactcttgatgacaccaacagcaac 1081
>gb|AY264253.1| Tatia intermedia elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1118 ccttcttctcgacgctcttgatgacaccaacagcaac 1082
>gb|AY264249.1| Parauchenipterus cf. galeatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1074 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1074 ccttcttctcgacgctcttgatgacaccaacagcaac 1038
>gb|AY264248.1| Acanthodoras cataphractus truncated elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1131 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1131 ccttcttctcgacgctcttgatgacaccaacagcaac 1095
>gb|AY264247.1| Acanthodoras spinosissimus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1077 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1077 ccttcttctcgacgctcttgatgacaccaacagcaac 1041
>gb|AY264243.1| Trachydoras steindachneri elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1120 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1120 ccttcttctcgacgctcttgatgacaccaacagcaac 1084
>gb|AY264238.1| Leptodoras cf. praelongus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||| ||||||||||| Sbjct: 1113 ccttcttctcaacgctcttgatgacgccaacagcaac 1077
>gb|AY264234.1| Leptodoras sp. 3-GM-2003 elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||| ||||||| Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaccagcaac 1075
>gb|AY264233.1| Leptodoras acipenserinus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1113 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||| ||||||||||||| Sbjct: 1113 ccttcttctcaacgctcttgatgccaccaacagcaac 1077
>gb|AY264232.1| Leptodoras juruensis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||| ||||| Sbjct: 1111 ccttcttctcaacgctcttgatgacaccaacggcaac 1075
>gb|AY264230.1| Leptodoras hasemani elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1110 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1110 ccttcttctcaacactcttgatgacaccaacagcaac 1074
>gb|AY264228.1| Opsodoras stuebelii elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1112 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1112 ccttcttctcaacactcttgatgacaccaacagcaac 1076
>gb|AY264227.1| Hemidoras stenopeltis haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1111 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1111 ccttcttctcaacactcttgatgacaccaacagcaac 1075
>gb|AY264226.1| Hemidoras stenopeltis haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1086 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1086 ccttcttctcaacactcttgatgacaccaacagcaac 1050
>gb|AY264221.1| Nemadoras hemipeltis elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1114 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1114 ccttcttctcgacgctcttgatgacaccaacagcaac 1078
>gb|AY264220.1| Nemadoras trimaculatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1109 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| |||||| ||||||||||||||||||||| Sbjct: 1109 ccttcttctcaacgttcttgatgacaccaacagcaac 1073
>gb|AY264218.1| Doras carinatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1083 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||||| ||||||||||||||| ||||| Sbjct: 1083 ccttcttctcaacgctcttgatgacaccaacggcaac 1047
>gb|AY264216.1| Pterodoras granulosus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1106 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1106 ccttcttctcaacactcttgatgacaccaacagcaac 1070
>gb|AY264213.1| Oxydoras niger haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1086 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1086 ccttcttctcaacactcttgatgacaccaacagcaac 1050
>gb|AY264211.1| Rhinodoras thomersoni elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1122 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1122 ccttcttctcaacactcttgatgacaccaacagcaac 1086
>gb|AY264202.1| Hypodoras forficulatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1124 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1124 ccttcttctcgacgctcttgatgacaccaacagcaac 1088
>gb|AY264198.1| Zungaro zungaro elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1060 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 1060 ccttcttctcaacactcttgatgacaccaacagcaac 1024
>gb|AY264196.1| Hypophthalmus edentatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1115 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||||||||||||||| Sbjct: 1115 ccttcttctcgacgctcttgatgacaccaacagcaac 1079
>gb|DQ174256.1| Gossypium hirsutum translation elongation factor 1A-7 (EF1A7) mRNA, complete cds Length = 1617 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || || | |||||| |||||| Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgattacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|DQ174252.1| Gossypium hirsutum translation elongation factor 1A-3 (EF1A3) mRNA, complete cds Length = 1711 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || || | |||||| |||||| Sbjct: 1328 gcagacttggtcaccttggctccagttgggtccttcttctccacactcttgatcacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|AY490176.1| Capsicum annuum U-Lim mRNA, partial sequence Length = 709 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| | ||| ||||| || || |||||||| ||||| | |||||| |||||| Sbjct: 681 gcagccttggtgatctttgcaccagttgggtccttcttgtcaacactcttgataacacca 622 Query: 240 acagcaac 247 |||||||| Sbjct: 621 acagcaac 614
>gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086) putative translation elongation factor eEF-1 alpha chain (gene A4) (At5g60390) mRNA, complete cds Length = 1653 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 240 acagcaac 247 |||||||| Sbjct: 1331 acagcaac 1324
>gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940/T6D22_14) mRNA, complete cds Length = 1350 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 1328 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 1269 Query: 240 acagcaac 247 || ||||| Sbjct: 1268 actgcaac 1261
>emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFTU 4) gene for elongation factor 1-alpha Length = 2594 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 2009 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1950 Query: 240 acagcaac 247 |||||||| Sbjct: 1949 acagcaac 1942
>emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene for elongation factor 1-alpha Length = 3230 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 2579 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 2520 Query: 240 acagcaac 247 || ||||| Sbjct: 2519 actgcaac 2512
>gb|AF360167.1| Arabidopsis thaliana putative translation elongation factor eEF-1 alpha chain A4 (At5g60390) mRNA, complete cds Length = 1597 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1389 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1330 Query: 240 acagcaac 247 |||||||| Sbjct: 1329 acagcaac 1322
>emb|AJ536671.1|STU536671 Solanum tuberosum mRNA for elongation factor (ef-1alpha gene) Length = 1753 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || | || |||||||| ||||| | |||||| |||||| Sbjct: 1414 gcagccttggtgaccttggctccagatgggtccttcttgtcaacactcttgataacacca 1355 Query: 240 acagcaac 247 |||||||| Sbjct: 1354 acagcaac 1347
>gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1601 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 240 acagcaac 247 |||||||| Sbjct: 1333 acagcaac 1326
>gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 1615 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1390 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1331 Query: 240 acagcaac 247 |||||||| Sbjct: 1330 acagcaac 1323
>gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, complete cds Length = 1350 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mRNA, complete cds Length = 1526 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|AF498320.1| Oncorhynchus mykiss elongation factor EF1 alpha mRNA, complete cds Length = 1725 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || ||| |||||||||||||||||||||| Sbjct: 1389 ccttcttgtcgacggccttgatgacaccaacagcaac 1353
>gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1595 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 240 acagcaac 247 |||||||| Sbjct: 1331 acagcaac 1324
>gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mRNA, complete cds Length = 1583 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 240 acagcaac 247 |||||||| Sbjct: 1331 acagcaac 1324
>gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (EF-1-alpha) (MUF9.4) mRNA, complete cds Length = 1616 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1391 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1332 Query: 240 acagcaac 247 |||||||| Sbjct: 1331 acagcaac 1324
>dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, partial cds, clone: RAFL22-71-O21 Length = 599 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 263 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 204 Query: 240 acagcaac 247 || ||||| Sbjct: 203 actgcaac 196
>dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elongation factor eEF-1 alpha chain, partial cds, clone: RAFL22-97-N17 Length = 623 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 410 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 351 Query: 240 acagcaac 247 |||||||| Sbjct: 350 acagcaac 343
>gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, complete cds Length = 1350 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1328 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, complete cds Length = 1650 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 1400 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 1341 Query: 240 acagcaac 247 || ||||| Sbjct: 1340 actgcaac 1333
>emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB8ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1593 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||||||||||||||| || || || |||||||| ||||| | |||||| ||||| Sbjct: 1349 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 1290 Query: 240 acagcaac 247 || ||||| Sbjct: 1289 actgcaac 1282
>emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZG03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1526 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1377 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1318 Query: 240 acagcaac 247 |||||||| Sbjct: 1317 acagcaac 1310
>gb|DQ353797.1| Ictalurus punctatus isolate C94SB10 elongation factor 1-alpha mRNA, partial cds Length = 651 Score = 52.0 bits (26), Expect = 9e-04 Identities = 34/37 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | ||||||||||||||||||||| Sbjct: 406 ccttcttctcaacactcttgatgacaccaacagcaac 370
>gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1576 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 1393 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 1334 Query: 240 acagcaac 247 |||||||| Sbjct: 1333 acagcaac 1326
>dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9 Length = 77298 Score = 52.0 bits (26), Expect = 9e-04 Identities = 57/68 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || || || |||||||| || |||| ||| || |||||| Sbjct: 11153 gcagccttggtgaccttggctccagttgggtccttcttgtccacgctcttaataacacca 11094 Query: 240 acagcaac 247 |||||||| Sbjct: 11093 acagcaac 11086
>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds Length = 1623 Score = 50.1 bits (25), Expect = 0.003 Identities = 59/71 (83%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||||||||| | || |||||||| ||||| | ||||||||| || Sbjct: 1401 gcagacttggtgaccttggcaccactagggtccttcttctcaacactcttgatgactccc 1342 Query: 240 acagcaaccgt 250 ||||| ||||| Sbjct: 1341 acagccaccgt 1331
>gb|AF485331.1| Cyprinus carpio elongation factor 1-alpha mRNA, complete cds Length = 1757 Score = 50.1 bits (25), Expect = 0.003 Identities = 30/32 (93%) Strand = Plus / Minus Query: 213 ttcttntcaacgcccttgatgacaccaacagc 244 ||||| ||||||| |||||||||||||||||| Sbjct: 1388 ttcttctcaacgctcttgatgacaccaacagc 1357
>gb|AF268667.1|AF268667 Coturnix coturnix DNA sequence derived using primers specific for chicken EST AW313486 Length = 966 Score = 50.1 bits (25), Expect = 0.003 Identities = 36/40 (90%) Strand = Plus / Plus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| |||||||||||||||| |||||||| Sbjct: 168 ccttcttgtccacggccttgatgacaccaacggcaaccgt 207
>dbj|AB183717.1| Lethenteron japonicum LjEF-1a mRNA for elongation factor-1 alpha, complete cds Length = 1751 Score = 50.1 bits (25), Expect = 0.003 Identities = 36/40 (90%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||||| || ||| ||||||||||||||||||| ||||| Sbjct: 1428 ccttcttctcgacggccttgatgacaccaacagccaccgt 1389
>gb|DQ174255.1| Gossypium hirsutum translation elongation factor 1A-6 (EF1A6) mRNA, complete cds Length = 1499 Score = 48.1 bits (24), Expect = 0.013 Identities = 69/85 (81%) Strand = Plus / Minus Query: 163 ctcatttcttnttgatggcagncttggtaaccttggcaccggtgggatccttcttntcaa 222 |||||||||| ||| |||| ||||| ||||| ||||| || || |||||||| |||| Sbjct: 1345 ctcatttcttcttggcagcagatttggtgaccttagcaccagttgggtccttcttctcaa 1286 Query: 223 cgcccttgatgacaccaacagcaac 247 | | |||||||||||| || ||||| Sbjct: 1285 cactcttgatgacaccgacggcaac 1261
>gb|AF067195.1|AF067195 Oryza sativa translation elongation factor mRNA, partial cds Length = 269 Score = 48.1 bits (24), Expect = 0.013 Identities = 37/42 (88%) Strand = Plus / Minus Query: 164 tcatttcttnttgatggcagncttggtaaccttggcaccggt 205 ||||||||| ||| ||||| |||||| |||||||||||||| Sbjct: 49 tcatttcttcttggcggcagccttggtcaccttggcaccggt 8
>dbj|AB106676.1| Avicennia marina EF1-A mRNA for elongation factor 1A, complete cds Length = 1809 Score = 48.1 bits (24), Expect = 0.013 Identities = 53/63 (84%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| | || |||||||| || |||| ||| |||||||||||||| Sbjct: 1476 cttggtcaccttagcacctgaaggctccttcttttccacgctctttatgacaccaacagc 1417 Query: 245 aac 247 ||| Sbjct: 1416 aac 1414
>gb|AY832582.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m2 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832581.1| Pseudotsuga menziesii haplotype Pm-EF1A_412m1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832579.1| Pseudotsuga menziesii haplotype Pm-EF1A_013d1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832578.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_24 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832577.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_23 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832576.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_22 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832575.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_21 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832574.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_20 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832571.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_17 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832570.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_16 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832569.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_15 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832568.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_14 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832567.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_12 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832566.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_11 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832565.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_10 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832563.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_8 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832562.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_7 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832561.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_6 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832559.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_4 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832558.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_3 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832557.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_2 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|AY832556.1| Pseudotsuga menziesii var. menziesii haplotype Pm-EF1A_1 translation elongation factor-1 alpha (EF1A) gene, partial cds Length = 1072 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | || ||||| |||||||| Sbjct: 725 cttggtgacctttgcaccagtagggtccttcttttcaacagctttaatgactccaacagc 666 Query: 245 aaccgt 250 |||||| Sbjct: 665 aaccgt 660
>gb|DQ228347.1| Solanum tuberosum clone 149A09 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1691 Score = 46.1 bits (23), Expect = 0.053 Identities = 39/45 (86%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||| |||||| ||||||||||| || || |||||||| ||||| Sbjct: 1380 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaac 1336
>gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor 1-alpha-like protein mRNA, complete cds Length = 1708 Score = 46.1 bits (23), Expect = 0.053 Identities = 57/69 (82%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| ||||||||||| || || |||||||| ||||| ||||| || || Sbjct: 1391 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaacattcttgacaacgcc 1332 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1331 aacagcaac 1323
>gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence Length = 1768 Score = 46.1 bits (23), Expect = 0.053 Identities = 39/45 (86%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||| |||||| ||||||||||| || || |||||||| ||||| Sbjct: 1415 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaac 1371
>gb|AY264207.1| Centrodoras cf. brachiatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1087 Score = 46.1 bits (23), Expect = 0.053 Identities = 26/27 (96%) Strand = Plus / Minus Query: 221 aacgcccttgatgacaccaacagcaac 247 ||||| ||||||||||||||||||||| Sbjct: 1077 aacgctcttgatgacaccaacagcaac 1051
>gb|DQ174257.1| Gossypium hirsutum translation elongation factor 1A-8 (EF1A8) mRNA, complete cds Length = 1555 Score = 46.1 bits (23), Expect = 0.053 Identities = 57/69 (82%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacc 238 ||||| |||||| |||||||| || | || |||||||| || || | |||||| ||||| Sbjct: 1329 ggcagacttggtcaccttggctccagatgggtccttcttctccacactcttgatcacacc 1270 Query: 239 aacagcaac 247 ||||||||| Sbjct: 1269 aacagcaac 1261
>emb|AJ132534.1|PAB132534 Picea abies mRNA for translation elongation factor-1 alpha, partial Length = 1747 Score = 46.1 bits (23), Expect = 0.053 Identities = 55/66 (83%) Strand = Plus / Minus Query: 185 cttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacaccaacagc 244 |||||| ||||| ||||| || || |||||||| ||||| | |||||||| || ||||| Sbjct: 1314 cttggtgacctttgcaccagtagggtccttcttttcaacagctttgatgactcctacagc 1255 Query: 245 aaccgt 250 |||||| Sbjct: 1254 aaccgt 1249
>dbj|AB124568.1| Pelodiscus sinensis PsEF1a mRNA for elongation factor-1 alpha (EF-1alpha), complete cds Length = 1766 Score = 46.1 bits (23), Expect = 0.053 Identities = 31/34 (91%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagc 244 ||||||| ||||| ||||||||||||||||||| Sbjct: 1415 ccttcttatcaactgccttgatgacaccaacagc 1382
>gb|DQ333888.1| Hirudo medicinalis putative elongation factor 1 alpha (EF-1alpha) gene, complete cds Length = 6463 Score = 46.1 bits (23), Expect = 0.053 Identities = 23/23 (100%) Strand = Plus / Minus Query: 222 acgcccttgatgacaccaacagc 244 ||||||||||||||||||||||| Sbjct: 6181 acgcccttgatgacaccaacagc 6159
>gb|AF041463.1|AF041463 Manihot esculenta elongation factor 1-alpha (MeEF1) gene, complete cds Length = 4866 Score = 46.1 bits (23), Expect = 0.053 Identities = 34/38 (89%) Strand = Plus / Minus Query: 213 ttcttntcaacgcccttgatgacaccaacagcaaccgt 250 ||||| ||||| | |||||| ||||||||||||||||| Sbjct: 4378 ttcttctcaacactcttgatcacaccaacagcaaccgt 4341
>gb|DQ252511.1| Solanum tuberosum clone 087B12 elongation factor 1-alpha-like mRNA, complete cds Length = 1718 Score = 46.1 bits (23), Expect = 0.053 Identities = 39/45 (86%) Strand = Plus / Minus Query: 179 ggcagncttggtaaccttggcaccggtgggatccttcttntcaac 223 ||||| |||||| ||||||||||| || || |||||||| ||||| Sbjct: 1390 ggcagccttggtgaccttggcaccagttgggtccttcttgtcaac 1346
>gb|BT012812.1| Lycopersicon esculentum clone 113856R, mRNA sequence Length = 2059 Score = 44.1 bits (22), Expect = 0.21 Identities = 56/68 (82%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| |||||||| || | || |||||||| ||||| |||||| |||||| Sbjct: 1710 gcagccttggtgaccttggctccagatgggtccttcttgtcaacattcttgataacacca 1651 Query: 240 acagcaac 247 |||||||| Sbjct: 1650 acagcaac 1643
>gb|AY264258.1| Dianema longibarbus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1194 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| |||||| ||||||||||||| || ||||| Sbjct: 1194 ccttcttctcaacggccttgatgacaccgacggcaac 1158
>gb|AY264257.1| Henonemus punctatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1096 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| |||||| ||||||||||||||| Sbjct: 1096 ccttcttttcaacagccttgacgacaccaacagcaac 1060
>gb|AY264246.1| Doras punctatus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1115 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| |||||| |||||||||||| |||||||| Sbjct: 1115 ccttcttctcaacgttcttgatgacacctacagcaac 1079
>gb|AY264242.1| Trachydoras nattereri haplotype I elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1090 Score = 44.1 bits (22), Expect = 0.21 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacag 243 ||||||| ||||||| ||||||||||| ||||| Sbjct: 1090 ccttcttctcaacgctcttgatgacacaaacag 1058
>gb|AY264239.1| Leptodoras praelongus elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1118 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| |||||| ||||||||| ||||||||||| Sbjct: 1118 ccttcttctcaacgttcttgatgacgccaacagcaac 1082
>gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1105 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| |||||||||||| |||||||| Sbjct: 1105 ccttcttctcgacgctcttgatgacaccgacagcaac 1069
>gb|AY264199.1| Amblydoras cf. affinis haplotype II elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1040 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| || |||| ||||||||| ||||||||||| Sbjct: 1040 ccttcttctcgacgctcttgatgacgccaacagcaac 1004
>gb|AY264197.1| Sorubim lima elongation factor-1 alpha gene, exons 4 through 8 and partial cds Length = 1168 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| | |||||||||||| |||||||| Sbjct: 1168 ccttcttctcaacactcttgatgacaccgacagcaac 1132
>gb|DQ174258.1| Gossypium hirsutum translation elongation factor 1A-9 (EF1A9) mRNA, complete cds Length = 1734 Score = 44.1 bits (22), Expect = 0.21 Identities = 56/68 (82%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||| || |||||||| || || || |||||||| || || | |||||| |||||| Sbjct: 1328 gcagacttcgtcaccttggctccagttgggtccttcttctccacactcttgatcacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>gb|DQ174254.1| Gossypium hirsutum translation elongation factor 1A-5 (EF1A5) mRNA, complete cds Length = 1738 Score = 44.1 bits (22), Expect = 0.21 Identities = 56/68 (82%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| ||| || |||||||| || || || |||||||| || || | |||||| |||||| Sbjct: 1328 gcagacttcgtcaccttggctccagttgggtccttcttctccacactcttgatcacacca 1269 Query: 240 acagcaac 247 |||||||| Sbjct: 1268 acagcaac 1261
>dbj|AB253792.1| Athalia rosae EF-1-alpha mRNA for elongation factor 1-alpha, complete cds Length = 1936 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Minus Query: 226 ccttgatgacaccaacagcaac 247 |||||||||||||||||||||| Sbjct: 1384 ccttgatgacaccaacagcaac 1363
>gb|AF321836.1| Salmo salar elongation factor 1 alpha mRNA, complete cds Length = 1445 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| ||||||||||||| |||||||| Sbjct: 1388 ccttcttgtcaacagccttgatgacaccgacagcaac 1352
>dbj|AB199910.1| Hyla japonica ef 1a mRNA for elongation factor 1 alpha, complete cds Length = 1498 Score = 44.1 bits (22), Expect = 0.21 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 ccttcttntcaacgcccttgatgacaccaacagcaac 247 ||||||| ||||| |||||||||| ||||||||||| Sbjct: 1399 ccttcttttcaacagccttgatgactccaacagcaac 1363
>gb|AF120093.1|AF120093 Nicotiana tabacum elongation factor 1-alpha mRNA, complete cds Length = 1678 Score = 44.1 bits (22), Expect = 0.21 Identities = 56/68 (82%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||| | ||||| || || |||||||| ||||| |||||| |||||| Sbjct: 1361 gcagccttggtgaccatagcaccagttgggtccttcttgacaacgttcttgataacacca 1302 Query: 240 acagcaac 247 |||||||| Sbjct: 1301 acagcaac 1294
>gb|AY378166.1| Cichorium intybus elongation factor 1-alpha mRNA, complete cds Length = 1582 Score = 42.1 bits (21), Expect = 0.82 Identities = 58/71 (81%) Strand = Plus / Minus Query: 180 gcagncttggtaaccttggcaccggtgggatccttcttntcaacgcccttgatgacacca 239 |||| |||||| ||||| || || || || |||||||| ||||| |||| | |||||| Sbjct: 1368 gcagccttggtcaccttagctccagtcgggtccttcttgtcaacattcttggtaacacca 1309 Query: 240 acagcaaccgt 250 ||||||||||| Sbjct: 1308 acagcaaccgt 1298
>gb|AY692223.1| Homo sapiens coagulation factor XIII, B polypeptide (F13B) gene, complete cds Length = 32002 Score = 42.1 bits (21), Expect = 0.82 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 tatttaaaagacacacaatag 33 ||||||||||||||||||||| Sbjct: 29456 tatttaaaagacacacaatag 29476
>emb|CR698727.2|CNS0G237 Tetraodon nigroviridis full-length cDNA Length = 1352 Score = 42.1 bits (21), Expect = 0.82 Identities = 24/25 (96%) Strand = Plus / Minus Query: 227 cttgatgacaccaacagcaaccgtt 251 |||||||||||| |||||||||||| Sbjct: 993 cttgatgacaccgacagcaaccgtt 969
>emb|AL353809.20| Human DNA sequence from clone RP11-32D17 on chromosome 1p31.2-32.1 Contains the 3' end of ASPM gene for asp (abnormal spindle)-like, microcephaly associated (Drosophila) protein, FLJ10517, FLJ10549, the F13B gene for coagulation factor XIII, B polypeptide and the 3' end of FHR5 gene for factor H-related protein 5, complete sequence Length = 155892 Score = 42.1 bits (21), Expect = 0.82 Identities = 21/21 (100%) Strand = Plus / Minus Query: 13 tatttaaaagacacacaatag 33 ||||||||||||||||||||| Sbjct: 49098 tatttaaaagacacacaatag 49078
>gb|AC182474.3| Pan troglodytes BAC clone CH251-134M22 from chromosome 1, complete sequence Length = 152000 Score = 42.1 bits (21), Expect = 0.82 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 tatttaaaagacacacaatag 33 ||||||||||||||||||||| Sbjct: 54444 tatttaaaagacacacaatag 54464
>gb|M64554.1|HUMBFXIII Human factor XIII b subunit gene, complete cds Length = 33206 Score = 42.1 bits (21), Expect = 0.82 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 tatttaaaagacacacaatag 33 ||||||||||||||||||||| Sbjct: 30364 tatttaaaagacacacaatag 30384
>ref|XM_712562.1| Candida albicans SC5314 putative translation elongation factor EF-1 alpha (CaO19_5119), mRNA Length = 1377 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ttgatgacaccaacagcaac 247 |||||||||||||||||||| Sbjct: 1310 ttgatgacaccaacagcaac 1291
>ref|XM_712488.1| Candida albicans SC5314 putative translation elongation factor EF-1 alpha (CaO19_12585), mRNA Length = 1377 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ttgatgacaccaacagcaac 247 |||||||||||||||||||| Sbjct: 1310 ttgatgacaccaacagcaac 1291
>ref|XM_706806.1| Candida albicans SC5314 translation elongation factor EF-1 alpha (CaO19.8012), mRNA Length = 1377 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ttgatgacaccaacagcaac 247 |||||||||||||||||||| Sbjct: 1310 ttgatgacaccaacagcaac 1291 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,805,417 Number of Sequences: 3902068 Number of extensions: 1805417 Number of successful extensions: 33073 Number of sequences better than 10.0: 323 Number of HSP's better than 10.0 without gapping: 323 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 32717 Number of HSP's gapped (non-prelim): 356 length of query: 251 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 229 effective length of database: 17,147,199,772 effective search space: 3926708747788 effective search space used: 3926708747788 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
