Clone Name	rbags37b15
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein	460	e-126
2	emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMW...	84	5e-13
3	gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich ...	50	0.007
4	gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome...	48	0.026
5	gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23...	48	0.026
6	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.026
7	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	46	0.10
8	gb|AC163706.2| Gallus gallus BAC clone CH261-71A16 from chromoso...	46	0.10
9	gb|AC009159.12| Homo sapiens chromosome 16 clone RP11-70D24, com...	44	0.40
10	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	44	0.40
11	ref|XM_515163.1| PREDICTED: Pan troglodytes similar to D-PCa-2 p...	42	1.6
12	ref|XM_530683.1| PREDICTED: Pan troglodytes LOC460985 (LOC460985...	42	1.6
13	ref|NM_005517.2| Homo sapiens high-mobility group nucleosomal bi...	42	1.6
14	ref|XM_516308.1| PREDICTED: Pan troglodytes similar to 2-hydroxy...	42	1.6
15	ref|XM_515655.1| PREDICTED: Pan troglodytes similar to Nonhiston...	42	1.6
16	ref|XM_530248.1| PREDICTED: Pan troglodytes LOC457914 (LOC457914...	42	1.6
17	ref|XM_530110.1| PREDICTED: Pan troglodytes LOC456663 (LOC456663...	42	1.6
18	gb|BC081567.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
19	gb|AY704551.1| Gekko japonicus GekBS049P mRNA, complete cds	42	1.6
20	gb|BC075837.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
21	gb|BC072010.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
22	gb|BC072011.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
23	gb|BC000378.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
24	gb|BC014644.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
25	gb|BC003050.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
26	gb|BC070297.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
27	gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic ...	42	1.6
28	ref|XM_846735.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
29	gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome...	42	1.6
30	ref|XM_844334.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
31	gb|AY459322.1| Mus musculus apoptosis repressor interacting with...	42	1.6
32	gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome...	42	1.6
33	ref|XM_534124.2| PREDICTED: Canis familiaris similar to L-plasti...	42	1.6
34	ref|XM_843311.1| PREDICTED: Canis familiaris similar to L-plasti...	42	1.6
35	ref|XM_847544.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
36	gb|BC075848.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
37	gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome...	42	1.6
38	ref|XM_847200.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
39	gb|AC112504.6| Homo sapiens 3 BAC RP11-271K21 (Roswell Park Canc...	42	1.6
40	emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A...	42	1.6
41	ref|XM_845631.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
42	ref|XM_845691.1| PREDICTED: Canis familiaris similar to Nonhisto...	42	1.6
43	gb|BC063551.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolo...	42	1.6
44	gb|BC001783.1| Homo sapiens mRNA similar to ribosomal protein L3...	42	1.6
45	emb|Z83840.7|HS216E10 Human DNA sequence from clone CTA-216E10 o...	42	1.6
46	emb|Z97055.1|HS388M5 Human DNA sequence from clone RP3-388M5 on ...	42	1.6
47	emb|AL607067.17| Human DNA sequence from clone RP11-201K10 on ch...	42	1.6
48	emb|AL513365.27| Human DNA sequence from clone RP3-476K8 on chro...	42	1.6
49	emb|AL513185.12| Human DNA sequence from clone RP11-167P22 on ch...	42	1.6
50	emb|AL390838.26| Human DNA sequence from clone RP11-158D2 on chr...	42	1.6
51	ref|NM_030152.2| Mus musculus nucleolar protein 3 (apoptosis rep...	42	1.6
52	emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chr...	42	1.6
53	emb|AL139415.10| Human DNA sequence from clone RP3-477M7 on chro...	42	1.6
54	emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chro...	42	1.6
55	emb|CR859118.1| Pongo pygmaeus mRNA; cDNA DKFZp468C094 (from clo...	42	1.6
56	emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chr...	42	1.6
57	gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, R...	42	1.6
58	gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome	42	1.6
59	gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome	42	1.6
60	emb|CR624609.1| full-length cDNA clone CS0CAP008YJ21 of Thymus o...	42	1.6
61	emb|CR624004.1| full-length cDNA clone CS0DI075YK09 of Placenta ...	42	1.6
62	emb|CR622123.1| full-length cDNA clone CS0DL009YG08 of B cells (...	42	1.6
63	emb|CR621179.1| full-length cDNA clone CS0DI055YJ13 of Placenta ...	42	1.6
64	emb|CR619884.1| full-length cDNA clone CS0DJ013YC12 of T cells (...	42	1.6
65	emb|CR614459.1| full-length cDNA clone CS0DM006YI10 of Fetal liv...	42	1.6
66	emb|CR612973.1| full-length cDNA clone CL0BA002ZH08 of Placenta ...	42	1.6
67	emb|CR611141.1| full-length cDNA clone CS0CAP003YB16 of Thymus o...	42	1.6
68	emb|CR609228.1| full-length cDNA clone CS0DF002YD20 of Fetal bra...	42	1.6
69	emb|CR608465.1| full-length cDNA clone CL0BA008ZE05 of Placenta ...	42	1.6
70	emb|CR607698.1| full-length cDNA clone CS0CAP006YC12 of Thymus o...	42	1.6
71	emb|CR606135.1| full-length cDNA clone CS0DD003YG22 of Neuroblas...	42	1.6
72	emb|CR605166.1| full-length cDNA clone CL0BA011ZG12 of Placenta ...	42	1.6
73	emb|CR602382.1| full-length cDNA clone CS0DB001YD15 of Neuroblas...	42	1.6
74	emb|CR599316.1| full-length cDNA clone CS0CAP006YG17 of Thymus o...	42	1.6
75	emb|CR598323.1| full-length cDNA clone CS0CAP004YI14 of Thymus o...	42	1.6
76	emb|CR596866.1| full-length cDNA clone CS0DH005YD16 of T cells (...	42	1.6
77	emb|CR595538.1| full-length cDNA clone CS0DC025YM12 of Neuroblas...	42	1.6
78	emb|CR595467.1| full-length cDNA clone CL0BB010ZB04 of Neuroblas...	42	1.6
79	emb|CR593313.1| full-length cDNA clone CS0DI020YC24 of Placenta ...	42	1.6
80	emb|CR592727.1| full-length cDNA clone CS0DI051YN20 of Placenta ...	42	1.6
81	emb|CR590834.1| full-length cDNA clone CS0DI082YF23 of Placenta ...	42	1.6
82	emb|CR590487.1| full-length cDNA clone CS0DD005YI07 of Neuroblas...	42	1.6
83	gb|AC116441.2| Homo sapiens chromosome 3 clone RP11-20O23, compl...	42	1.6
84	gb|AC022394.7| Homo sapiens chromosome 10 clone RP11-325M24, com...	42	1.6
85	gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, co...	42	1.6
86	dbj|AK136964.1| Mus musculus 12 days embryo embryonic body betwe...	42	1.6
87	gb|AC099560.2| Homo sapiens chromosome 3 clone RP11-761N21, comp...	42	1.6
88	ref|XM_937222.1| PREDICTED: Homo sapiens similar to TRM5 tRNA me...	42	1.6
89	ref|XM_945624.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
90	ref|XM_945621.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
91	ref|XM_942006.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
92	ref|XM_929021.1| PREDICTED: Homo sapiens similar to TRM5 tRNA me...	42	1.6
93	ref|XM_933938.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
94	ref|XM_933937.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
95	ref|XM_929731.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
96	ref|XM_927624.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
97	ref|XM_939591.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
98	ref|XM_941943.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
99	ref|XM_930287.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
100	ref|XM_937902.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
101	ref|XM_937758.1| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
102	ref|XM_086360.6| PREDICTED: Homo sapiens similar to Nonhistone c...	42	1.6
103	emb|CR542122.1| Homo sapiens full open reading frame cDNA clone ...	42	1.6
104	dbj|AB179399.1| Macaca fascicularis testis cDNA clone: QtsA-1926...	42	1.6
105	dbj|AK079536.1| Mus musculus adult male hypothalamus cDNA, RIKEN...	42	1.6
106	ref|NG_000892.1| Homo sapiens high-mobility group (nonhistone ch...	42	1.6
107	ref|NG_001142.1| Homo sapiens high-mobility group (nonhistone ch...	42	1.6
108	ref|NG_002646.1| Homo sapiens high-mobility group (nonhistone ch...	42	1.6
109	dbj|AK053846.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	42	1.6
110	dbj|AK021023.1| Mus musculus 4 days neonate male adipose cDNA, R...	42	1.6
111	gb|DQ015919.1| Homo sapiens tight junction protein 1 (zona occlu...	42	1.6
112	gb|DQ000559.1| Synthetic construct clone PSF:109216 high mobilit...	42	1.6
113	gb|AC117394.10| Homo sapiens 3 BAC RP11-529G21 (Roswell Park Can...	42	1.6
114	gb|BC029638.1| Homo sapiens, Similar to high-mobility group (non...	42	1.6
115	ref|NM_001003101.1| Canis familiaris non-histone chromosomal pro...	42	1.6
116	gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complet...	42	1.6
117	gb|AC007395.3|AC007395 Homo sapiens BAC clone RP11-504O1 from 2,...	42	1.6
118	gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p...	42	1.6
119	gb|AF198109.1|AF198109 Trichomonas vaginalis eukaryotic release ...	42	1.6
120	dbj|AK026562.1| Homo sapiens cDNA: FLJ22909 fis, clone KAT05694,...	42	1.6
121	gb|BC071707.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
122	gb|BC027290.1| Mus musculus nucleolar protein 3 (apoptosis repre...	42	1.6
123	gb|BC032140.2| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
124	emb|AL163052.4|CNS01RIB Human chromosome 14 DNA sequence BAC R-7...	42	1.6
125	emb|AL160236.4|CNS01RH0 Human chromosome 14 DNA sequence BAC R-1...	42	1.6
126	gb|BC099178.1| Rattus norvegicus high mobility group nucleosomal...	42	1.6
127	gb|BC099815.1| Rattus norvegicus high mobility group nucleosomal...	42	1.6
128	ref|NM_001025624.1| Rattus norvegicus high mobility group nucleo...	42	1.6
129	gb|BC053971.1| Mus musculus nucleolar protein 3 (apoptosis repre...	42	1.6
130	gb|BC003689.1| Homo sapiens high-mobility group nucleosomal bind...	42	1.6
131	emb|AL732543.8| Mouse DNA sequence from clone RP23-13D22 on chro...	42	1.6
132	gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome ...	42	1.6
133	ref|NM_020810.1| Homo sapiens TRM5 tRNA methyltransferase 5 homo...	42	1.6
134	emb|AL732319.17| Mouse DNA sequence from clone RP23-180O4 on chr...	42	1.6
135	emb|AL844586.5| Mouse DNA sequence from clone RP23-259N17 on chr...	42	1.6
136	emb|AL844537.5| Mouse DNA sequence from clone RP23-448A16 on chr...	42	1.6
137	gb|M12623.1|HUMHMG17 Human non-histone chromosomal protein HMG-1...	42	1.6
138	emb|AJ388518.1|CFA388518 Canis familiaris mRNA for non-histone c...	42	1.6
139	emb|X06444.1|HSHMG17P Human retropseudogene for chromosomal prot...	42	1.6
140	emb|X13546.1|HSHMG17G Human HMG-17 gene for non-histone chromoso...	42	1.6
141	dbj|AB037814.1| Homo sapiens mRNA for KIAA1393 protein, partial cds	42	1.6
142	gb|U80815.2| Caenorhabditis elegans cosmid W02C12, complete sequ...	40	6.3
143	gb|AC154426.2| Mus musculus BAC clone RP24-199A21 from chromosom...	40	6.3
144	ref|XM_477690.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.3
145	ref|XM_360938.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	6.3
146	ref|NM_003632.1| Homo sapiens contactin associated protein 1 (CN...	40	6.3
147	emb|Z93375.1|CEC38C6 Caenorhabditis elegans Cosmid C38C6, comple...	40	6.3
148	gb|AF036699.2| Caenorhabditis elegans cosmid F58F6, complete seq...	40	6.3
149	emb|AL357515.26| Human DNA sequence from clone RP11-397G5 on chr...	40	6.3
150	emb|AL158139.26| Human DNA sequence from clone RP1-80B9 on chrom...	40	6.3
151	gb|AC091204.3| Drosophila melanogaster 3L NOVECTOR RP98-27G13 (R...	40	6.3
152	gb|AC091221.3| Drosophila melanogaster 3L BAC RP98-9I19 (Roswell...	40	6.3
153	ref|NM_061930.2| Caenorhabditis elegans F34D6.1 (F34D6.1) mRNA, ...	40	6.3
154	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
155	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
156	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
157	emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 i...	40	6.3
158	gb|AE004965.1| Pseudomonas aeruginosa PAO1, section 526 of 529 o...	40	6.3
159	gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Can...	40	6.3
160	gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, com...	40	6.3
161	dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
162	dbj|AP004264.4| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
163	dbj|AP003062.3| Homo sapiens genomic DNA, chromosome 11q clone:R...	40	6.3
164	dbj|AK105956.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.3
165	gb|AF025454.1| Caenorhabditis elegans cosmid F34D6, complete seq...	40	6.3
166	gb|U87223.1|HSU87223 Homo sapiens contactin associated protein (...	40	6.3
167	gb|AE003557.4| Drosophila melanogaster chromosome 3L, section 28...	40	6.3
168	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	6.3
169	emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4,...	40	6.3
170	emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa...	40	6.3
171	emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa...	40	6.3
172	gb|U23764.1|PAU23764 Pseudomonas aeruginosa TonB (tonB) gene, co...	40	6.3
173	gb|AF040654.3| Caenorhabditis elegans cosmid R06B10, complete se...	40	6.3

---

>emb|X52472.1|TAPRP T.aestivum mRNA for a proline-rich protein
          Length = 1487

 Score =  460 bits (232), Expect = e-126
 Identities = 350/387 (90%), Gaps = 5/387 (1%)
 Strand = Plus / Minus

                                                                        
Query: 51   atgtgcacagatgaacgcataccagnacgcaaatgataattacaaagnagaaataatcat 110
            ||||||||||||||||  ||||||  |||||||||||||||||| |  || | || ||||
Sbjct: 1466 atgtgcacagatgaacatataccaacacgcaaatgataattacagaatagtagtactcat 1407

                                                                        
Query: 111  catgggtgcatggaacaagagaaactaaaaagggatgatggaatacaaggaatgcaaaaa 170
            |||||||||||||||||| ||||||||||| || ||| ||||||||||||||| ||||||
Sbjct: 1406 catgggtgcatggaacaacagaaactaaaa-ggaatggtggaatacaaggaatacaaaaa 1348

                                                                        
Query: 171  agatgcatcatcactatctcgctagccggatactatgccacttattctggaaatagcaca 230
             ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 1347 -gatgcatcatcactatctcgctaaccggatactatgccacttattctagaaatagcaca 1289

                                                                        
Query: 231  tcgtggctccggacggggtcgatctcctcctccttcggctgtcatatgtgagcatcacat 290
            |||||||||||||||||||||||||||||||   || ||||||||||||||| |||||||
Sbjct: 1288 tcgtggctccggacggggtcgatctcctcct---tcagctgtcatatgtgagtatcacat 1232

                                                                        
Query: 291  naattgtccgtcatcggcggcttgcccttcggaggcggctccggcttgggttcgggttca 350
             ||||||| |||||||| ||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 1231 caattgtcagtcatcggtggcttgcccttcggaggcggctccggcttcggttcgggctca 1172

                                                                        
Query: 351  ggcttgggctctggcttaggcatgggttgaggcttgggctctggttttggcattgggtaa 410
            ||||||||||||||||||||||| |||| |||||| ||||||||||| |||| ||| |  
Sbjct: 1171 ggcttgggctctggcttaggcataggttcaggcttaggctctggtttaggcaatggtttg 1112

                                       
Query: 411  ggcttgggctctggctttggcatcggc 437
            ||||| |||||||||||||||||||||
Sbjct: 1111 ggcttaggctctggctttggcatcggc 1085



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 345  ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttggcatt 404
            ||||||||||| |||||||| |||||||  ||||  ||||| |||||||| |||||||| 
Sbjct: 1147 ggttcaggcttaggctctggtttaggcaatggtttgggcttaggctctggctttggcatc 1088

                                   
Query: 405  gggtaaggcttgggctctggctt 427
            || | ||||||||||||||||||
Sbjct: 1087 ggctcaggcttgggctctggctt 1065



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 380 aggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 430
           |||||| ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 890 aggcttaggctcaggtttgggcattgggtaaggcttgggctcaggctttgg 840



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 363 ggcttaggcatgggttgaggcttgggctctggttttggcattgggtaaggcttgggctct 422
           |||| |||| |||| | ||||||||| || ||||||||||| || | |||||||||||||
Sbjct: 781 ggctcaggcttgggctcaggcttgggttccggttttggcatcggctcaggcttgggctct 722

                
Query: 423 ggctt 427
           |||||
Sbjct: 721 ggctt 717



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 381 ggcttgggctctggttttggcattgggtaaggcttgggctctggctt 427
           ||||||||||| ||||||||||| || | |||||||||||| |||||
Sbjct: 805 ggcttgggctccggttttggcatcggctcaggcttgggctcaggctt 759



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 380 aggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 430
           |||||| ||||| ||||| ||||| |||| |||||||||||| ||||||||
Sbjct: 470 aggcttaggctcaggtttgggcatcgggtcaggcttgggctcaggctttgg 420



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 354 ttgggctctggcttaggcatgggttgaggcttgggc 389
           |||||||||||||| |||||||||| ||| ||||||
Sbjct: 382 ttgggctctggctttggcatgggttcaggtttgggc 347



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 350 aggcttgggctctggcttaggcatgggttgaggctt 385
           |||||| ||||||||||| |||||||||| ||||||
Sbjct: 302 aggcttaggctctggctttggcatgggttcaggctt 267



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 348 tcaggcttgggctctggcttagg 370
           |||||||||||||||||||||||
Sbjct: 736 tcaggcttgggctctggcttagg 714



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 344 gggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctgg 394
           |||||||||||| |||  |||||  ||| ||||||| ||||||||||||||
Sbjct: 278 gggttcaggcttaggcattggctctggcttgggttgcggcttgggctctgg 228



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 393 ggttttggcattgggtaaggcttgggctctggctttgg 430
           ||||||||||| || |  ||||||||||||||||||||
Sbjct: 541 ggttttggcataggctcgggcttgggctctggctttgg 504



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 cggcttgggttcgggttcaggcttgggctctggcttaggcatgggttgaggcttgggctc 391
           ||||| ||||| ||| |||||||| ||||| || || ||||| || | ||||||||||||
Sbjct: 908 cggctcgggtttgggctcaggcttaggctcaggtttgggcattgggtaaggcttgggctc 849

                    
Query: 392 tggttttgg 400
            || |||||
Sbjct: 848 aggctttgg 840



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 379 gaggcttgggctctggttttggcat 403
           ||||||| |||||||||||||||||
Sbjct: 345 gaggcttaggctctggttttggcat 321



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 414 ttgggctctggctttggcat 433
           ||||||||||||||||||||
Sbjct: 382 ttgggctctggctttggcat 363



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 410 aggcttgggctctggctttggcat 433
           |||||| |||||||||||||||||
Sbjct: 302 aggcttaggctctggctttggcat 279

---

>emb|AJ234401.1|HVU234401 Hordeum vulgare partial mRNA; clone cMWG0646
          Length = 694

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 58/61 (95%), Gaps = 2/61 (3%)
 Strand = Plus / Minus

                                                                       
Query: 405 gggtaaggcttgggctctggctttggcat-cggcatcgngcttaggctccggctttggca 463
           ||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||
Sbjct: 694 gggtaaggcttgggctctggctttggcattcggc-tcgggcttaggctccggctttggca 636

            
Query: 464 t 464
           |
Sbjct: 635 t 635



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 380 aggcttgggctctggttttggcattgggtaaggcttgggctctggctt 427
           |||||| ||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 438 aggcttaggctcaggtttgggcatggggtaaggcttgggctcaggctt 391



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Minus

                                                                      
Query: 380 aggcttgggctctggttttggcatt-gggtaaggcttgggctctggctttggcatcggc 437
           ||||||||||||||| ||||||||| || |  ||||| ||||| |||||||||||||||
Sbjct: 689 aggcttgggctctggctttggcattcggctcgggcttaggctccggctttggcatcggc 631



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 339 ggttcgggttcaggcttgggctctggcttaggcatgggttgaggcttgggctc 391
           |||| ||| |||||||| ||||| || || |||||||| | ||||||||||||
Sbjct: 449 ggtttgggctcaggcttaggctcaggtttgggcatggggtaaggcttgggctc 397



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 350 aggcttgggctctggcttaggcat 373
           |||||||||||||||||| |||||
Sbjct: 689 aggcttgggctctggctttggcat 666



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 411 ggcttgggctctggctttgg 430
           ||||||||||||||||||||
Sbjct: 365 ggcttgggctctggctttgg 346

---

>gb|AF331853.1| Saccharum hybrid cultivar CP72-2086 proline-rich protein mRNA,
           partial sequence
          Length = 1173

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 327 ggctccggcttgggttcgggttcaggcttgggctctggctt 367
           ||||| || ||||||| ||||||||||||||||| ||||||
Sbjct: 732 ggctctggtttgggtttgggttcaggcttgggctttggctt 692



 Score = 44.1 bits (22), Expect = 0.40
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 345 ggttcaggcttgggctctggcttaggcatgggttgaggcttgggct 390
           ||||||||||| |||||||| || ||  |||||| |||||||||||
Sbjct: 744 ggttcaggctttggctctggtttgggtttgggttcaggcttgggct 699



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 324 ggcggctccggcttgggttcgggttcaggcttgggctctggcttaggcatgggttgaggc 383
           ||||| || ||||| |||| ||| ||||||||||| || |||| |||  | ||||| |||
Sbjct: 963 ggcgggtcgggctttggtttgggctcaggcttgggttcgggctcaggttttggttggggc 904

                            
Query: 384 ttgggctctggttttgg 400
           || ||||| ||||||||
Sbjct: 903 ttaggctccggttttgg 887



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 336 ttgggttcgggttcaggcttgggctctggcttaggca 372
           |||||||  ||| ||||||||||||||||||| ||||
Sbjct: 621 ttgggttttggtccaggcttgggctctggcttcggca 585

---

>gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_C10,
             complete sequence
          Length = 138209

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 375   ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 430
             |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 83074 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 83129



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 345   ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 400
             ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 83074 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 83129

---

>gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23221 proline-rich
            protein mRNA, complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 375  ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 430
            |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 1097 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 1042



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 345  ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 400
            ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 1097 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 1042

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                       
Query: 375     ggttgaggcttgggctctggttttggcattgggtaaggcttgggctctggctttgg 430
               |||| |||||| |||||||||||||||   || |  ||||||||||||||||||||
Sbjct: 7646679 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 7646734



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                       
Query: 345     ggttcaggcttgggctctggcttaggcatgggttgaggcttgggctctggttttgg 400
               ||||||||||| |||||||| || |||   || || |||||||||||||| |||||
Sbjct: 7646679 ggttcaggcttcggctctggttttggctccggctgtggcttgggctctggctttgg 7646734

---

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 320     cggaggcggctccggcttgggttcggg 346
               ||||||||||||||||||||| |||||
Sbjct: 3480480 cggaggcggctccggcttgggctcggg 3480506

---

>gb|AC163706.2| Gallus gallus BAC clone CH261-71A16 from chromosome w, complete sequence
          Length = 206206

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 131    gaaactaaaaagggatgatggaatacaagga 161
              |||||||||  ||||||||||||||||||||
Sbjct: 113780 gaaactaaactgggatgatggaatacaagga 113810

---

>gb|AC009159.12| Homo sapiens chromosome 16 clone RP11-70D24, complete sequence
          Length = 165921

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 398    tggcattgggtaaggcttgggc 419
              ||||||||||||||||||||||
Sbjct: 124291 tggcattgggtaaggcttgggc 124312

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 329     ctccggcttgggttcgggttcaggcttggg 358
               |||||||||||||| ||| |||||||||||
Sbjct: 2710023 ctccggcttgggtttgggctcaggcttggg 2710052

---

>ref|XM_515163.1| PREDICTED: Pan troglodytes similar to D-PCa-2 protein isoform c;
           Dresden prostate cancer 2; Dresden prostate carcinoma 2
           (LOC458871), mRNA
          Length = 388

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103

---

>ref|XM_530683.1| PREDICTED: Pan troglodytes LOC460985 (LOC460985), mRNA
          Length = 902

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 626 aggcttgggctctggctttgg 646

---

>ref|NM_005517.2| Homo sapiens high-mobility group nucleosomal binding domain 2
           (HMGN2), mRNA
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 313 aggcttgggctctggctttgg 293

---

>ref|XM_516308.1| PREDICTED: Pan troglodytes similar to 2-hydroxyphytanoyl-CoA lyase
            (2-HPCL) (HSPC279) (LOC460203), mRNA
          Length = 1882

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 1732 aggcttgggctctggctttgg 1712

---

>ref|XM_515655.1| PREDICTED: Pan troglodytes similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC459448), mRNA
          Length = 993

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 423 aggcttgggctctggctttgg 403

---

>ref|XM_530248.1| PREDICTED: Pan troglodytes LOC457914 (LOC457914), mRNA
          Length = 922

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 622 aggcttgggctctggctttgg 642

---

>ref|XM_530110.1| PREDICTED: Pan troglodytes LOC456663 (LOC456663), mRNA
          Length = 1412

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 623 aggcttgggctctggctttgg 643

---

>gb|BC081567.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88718 IMAGE:4131303), complete cds
          Length = 1230

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191

---

>gb|AY704551.1| Gekko japonicus GekBS049P mRNA, complete cds
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 234 aggcttgggctctggctttgg 214

---

>gb|BC075837.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88719 IMAGE:6272425), complete cds
          Length = 1306

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 313 aggcttgggctctggctttgg 293

---

>gb|BC072010.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88720 IMAGE:6273507), complete cds
          Length = 1222

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 212 aggcttgggctctggctttgg 192

---

>gb|BC072011.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88721 IMAGE:6647282), complete cds
          Length = 1209

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188

---

>gb|BC000378.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:8383 IMAGE:2820349), complete cds
          Length = 1250

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 228 aggcttgggctctggctttgg 208

---

>gb|BC014644.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:15731 IMAGE:3355317), complete cds
          Length = 1231

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188

---

>gb|BC003050.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:750 IMAGE:3543809), complete cds
          Length = 1242

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198

---

>gb|BC070297.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:88292 IMAGE:4282630), complete cds
          Length = 1181

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 176 aggcttgggctctggctttgg 156

---

>gb|AF377565.1| Tripsacum dactyloides clone T. anonymous genomic RFLP marker
           Csu1138
          Length = 369

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 354 ttgggctctggcttaggcatgggttgaggcttgggctctgg 394
           |||||||||||||| ||| |||| |  ||||||||||||||
Sbjct: 141 ttgggctctggcttgggcttgggctccggcttgggctctgg 101



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 327 ggctccggcttgggttcgggttcaggcttgggctctggctt 367
           ||||| |||||||| | ||| || |||||||||||||||||
Sbjct: 138 ggctctggcttgggcttgggctccggcttgggctctggctt 98

---

>ref|XM_846735.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC609476), mRNA
          Length = 580

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 246 aggcttgggctctggctttgg 226

---

>gb|AC140074.2| Mus musculus BAC clone RP23-141A5 from chromosome 8, complete sequence
          Length = 190381

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 326    cggctccggcttgggttcgggttcaggcttgggctctggct 366
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 152163 cggctcgggctcgggttcgggttctggctcgggctccggct 152203

---

>ref|XM_844334.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC607595), mRNA
          Length = 1096

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 666 aggcttgggctctggctttgg 646

---

>gb|AY459322.1| Mus musculus apoptosis repressor interacting with CARD (Nol3) mRNA,
           complete cds
          Length = 983

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 750 cggctcgggctcgggttcgggttctggctcgggctccggct 710

---

>gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome 14, complete sequence
          Length = 174986

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 80378 aggcttgggctctggctttgg 80398

---

>ref|XM_534124.2| PREDICTED: Canis familiaris similar to L-plastin (Lymphocyte
            cytosolic protein 1) (LCP-1) (LC64P), transcript variant
            1 (LOC476921), mRNA
          Length = 3110

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 2144 aggcttgggctctggctttgg 2124

---

>ref|XM_843311.1| PREDICTED: Canis familiaris similar to L-plastin (Lymphocyte
            cytosolic protein 1) (LCP-1) (LC64P), transcript variant
            2 (LOC476921), mRNA
          Length = 3116

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 2150 aggcttgggctctggctttgg 2130

---

>ref|XM_847544.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC610127), mRNA
          Length = 462

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 220 aggcttgggctctggctttgg 200

---

>gb|BC075848.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
            (cDNA clone IMAGE:4581619), **** WARNING: chimeric clone
            ****
          Length = 3796

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 2797 aggcttgggctctggctttgg 2777

---

>gb|AC124584.5| Mus musculus BAC clone RP23-127B8 from chromosome 8, complete sequence
          Length = 193083

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 326    cggctccggcttgggttcgggttcaggcttgggctctggct 366
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 113786 cggctcgggctcgggttcgggttctggctcgggctccggct 113826

---

>ref|XM_847200.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC609853), mRNA
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203

---

>gb|AC112504.6| Homo sapiens 3 BAC RP11-271K21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 215077

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 96392 aggcttgggctctggctttgg 96372

---

>emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A2 on chromosome 1q42.11-42.3
             Contains the 5' end of the NUP133 gene, a novel gene, the
             ABCB10 gene for ATP-binding cassette, sub-family B
             (MDR/TAP), member 10, a high-mobility group nucleosomal
             binding domain 2 (HMGN2) pseudogene, the TAF5L gene for
             TAF5-like RNA polymerase II, p300/CBP-associated factor
             (PCAF)-associated factor, 65kDa, the 5' end of a novel
             gene (KIAA0133) and three CpG islands, complete sequence
          Length = 147913

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 380   aggcttgggctctggttttgg 400
             |||||||||||||||||||||
Sbjct: 84668 aggcttgggctctggttttgg 84648

---

>ref|XM_845631.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC608920), mRNA
          Length = 1198

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203

---

>ref|XM_845691.1| PREDICTED: Canis familiaris similar to Nonhistone chromosomal
           protein HMG-17 (High-mobility group nucleosome binding
           domain 2) (LOC608614), mRNA
          Length = 1535

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 576 aggcttgggctctggctttgg 556

---

>gb|BC063551.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae),
           mRNA (cDNA clone IMAGE:4779792), complete cds
          Length = 1363

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 456 aggcttgggctctggctttgg 436

---

>gb|BC001783.1| Homo sapiens mRNA similar to ribosomal protein L35a (cDNA clone
            IMAGE:3355533)
          Length = 4331

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 3027 aggcttgggctctggctttgg 3047

---

>emb|Z83840.7|HS216E10 Human DNA sequence from clone CTA-216E10 on chromosome 22, complete
              sequence
          Length = 122320

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 104520 aggcttgggctctggctttgg 104540

---

>emb|Z97055.1|HS388M5 Human DNA sequence from clone RP3-388M5 on chromosome 22, complete
             sequence
          Length = 177568

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 56316 aggcttgggctctggctttgg 56296

---

>emb|AL607067.17| Human DNA sequence from clone RP11-201K10 on chromosome 1 Contains a
            high-mobility group nucleosomal binding domain 2 (HMGN2)
            pseudogene and the KRTCAP2 gene for keratinocyte
            associated protein 2, complete sequence
          Length = 32360

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 6843 aggcttgggctctggctttgg 6823

---

>emb|AL513365.27| Human DNA sequence from clone RP3-476K8 on chromosome 1 Contains the
             LIN28 gene for lin-28 homolog (C. elegans), the DHDDS gene
             for dehydrodolichyl diphosphate synthase, a ribosomal
             protein L17 (RPL17) pseudogene, a novel gene, the HMGN2
             gene for high-mobility group nucleosomal binding domain 2
             and two CpG islands, complete sequence
          Length = 107415

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 40227 aggcttgggctctggctttgg 40247

---

>emb|AL513185.12| Human DNA sequence from clone RP11-167P22 on chromosome 10 Contains the
              5' end of the CBARA1 gene for calcium binding atopy-related
              autoantigen 1, an HMG17 pseudogene, a cytochrome c oxidase
              subunit VIIc (COX7C) pseudogene, a novel gene, a novel
              pseudogene (FLJ12684) and a CpG island, complete sequence
          Length = 163632

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 137312 aggcttgggctctggctttgg 137332

---

>emb|AL390838.26| Human DNA sequence from clone RP11-158D2 on chromosome 9 Contains a
             novel pseudogene and a novel gene, complete sequence
          Length = 193709

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 63970 aggcttgggctctggctttgg 63950

---

>ref|NM_030152.2| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain) (Nol3), mRNA
          Length = 2870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 743 cggctcgggctcgggttcgggttctggctcgggctccggct 703

---

>emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chromosome 13 Contains a
              high-mobility group pseudogene, complete sequence
          Length = 162763

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 140895 aggcttgggctctggctttgg 140875

---

>emb|AL139415.10| Human DNA sequence from clone RP3-477M7 on chromosome 1 Contains the
             ENO1 gene for  enolase 1 (alpha), two novel genes, a novel
             pseudogene, a pseudogene similar to part of a Zinc finger
             protein, a pseudogene similar to part of cytochrome
             oxidase subunit II, the CA6 gene for carbonic anhydrase VI
             and a CpG island, complete sequence
          Length = 141428

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 39050 aggcttgggctctggctttgg 39030

---

>emb|AL138776.10| Human DNA sequence from clone RP11-20H6 on chromosome 1q25.1-31.1
             Contains the 3' end of the RGSL1 gene for regulator of
             G-protein signalling like 1, the RNASEL gene for
             ribonuclease L (2',5'-oligoisoadenylate
             synthetase-dependent) and a CpG island, complete sequence
          Length = 100549

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   ggaatacaaggaatgcaaaaa 170
             |||||||||||||||||||||
Sbjct: 33257 ggaatacaaggaatgcaaaaa 33277

---

>emb|CR859118.1| Pongo pygmaeus mRNA; cDNA DKFZp468C094 (from clone DKFZp468C094)
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 231 aggcttgggctctggctttgg 211

---

>emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chromosome 11 Contains gene
              D930008C07Rik, the Canx gene for calnexin, a high mobility
              group nucleosomal binding domain 2 (Hmgn2) pseudogene and
              two CpG islands, complete sequence
          Length = 113907

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 105281 aggcttgggctctggctttgg 105261

---

>gb|AC090480.11| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-248L18, Complete
              Sequence, complete sequence
          Length = 231039

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 326    cggctccggcttgggttcgggttcaggcttgggctctggct 366
              |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 215031 cggctcgggctcgggttcgggttctggctcgggctccggct 215071

---

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 381     ggcttgggctctggttttggc 401
               |||||||||||||||||||||
Sbjct: 2958492 ggcttgggctctggttttggc 2958512

---

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 381     ggcttgggctctggttttggc 401
               |||||||||||||||||||||
Sbjct: 1056648 ggcttgggctctggttttggc 1056668

---

>emb|CR624609.1| full-length cDNA clone CS0CAP008YJ21 of Thymus of Homo sapiens
           (human)
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 202 aggcttgggctctggctttgg 182

---

>emb|CR624004.1| full-length cDNA clone CS0DI075YK09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1142

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188

---

>emb|CR622123.1| full-length cDNA clone CS0DL009YG08 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1180

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 240 aggcttgggctctggctttgg 220

---

>emb|CR621179.1| full-length cDNA clone CS0DI055YJ13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1131

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195

---

>emb|CR619884.1| full-length cDNA clone CS0DJ013YC12 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1305

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 419 aggcttgggctctggctttgg 399

---

>emb|CR614459.1| full-length cDNA clone CS0DM006YI10 of Fetal liver of Homo sapiens
           (human)
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 222 aggcttgggctctggctttgg 202

---

>emb|CR612973.1| full-length cDNA clone CL0BA002ZH08 of Placenta of Homo sapiens
           (human)
          Length = 1119

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191

---

>emb|CR611141.1| full-length cDNA clone CS0CAP003YB16 of Thymus of Homo sapiens
           (human)
          Length = 1173

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198

---

>emb|CR609228.1| full-length cDNA clone CS0DF002YD20 of Fetal brain of Homo sapiens
           (human)
          Length = 1496

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 689 aggcttgggctctggctttgg 669

---

>emb|CR608465.1| full-length cDNA clone CL0BA008ZE05 of Placenta of Homo sapiens
           (human)
          Length = 1180

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191

---

>emb|CR607698.1| full-length cDNA clone CS0CAP006YC12 of Thymus of Homo sapiens
           (human)
          Length = 1153

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198

---

>emb|CR606135.1| full-length cDNA clone CS0DD003YG22 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1162

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 213 aggcttgggctctggctttgg 193

---

>emb|CR605166.1| full-length cDNA clone CL0BA011ZG12 of Placenta of Homo sapiens
           (human)
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195

---

>emb|CR602382.1| full-length cDNA clone CS0DB001YD15 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1163

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 213 aggcttgggctctggctttgg 193

---

>emb|CR599316.1| full-length cDNA clone CS0CAP006YG17 of Thymus of Homo sapiens
           (human)
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 216 aggcttgggctctggctttgg 196

---

>emb|CR598323.1| full-length cDNA clone CS0CAP004YI14 of Thymus of Homo sapiens
           (human)
          Length = 1164

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 216 aggcttgggctctggctttgg 196

---

>emb|CR596866.1| full-length cDNA clone CS0DH005YD16 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1184

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195

---

>emb|CR595538.1| full-length cDNA clone CS0DC025YM12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 240 aggcttgggctctggctttgg 220

---

>emb|CR595467.1| full-length cDNA clone CL0BB010ZB04 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1127

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191

---

>emb|CR593313.1| full-length cDNA clone CS0DI020YC24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1157

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 215 aggcttgggctctggctttgg 195

---

>emb|CR592727.1| full-length cDNA clone CS0DI051YN20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1167

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 219 aggcttgggctctggctttgg 199

---

>emb|CR590834.1| full-length cDNA clone CS0DI082YF23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1032

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 155 aggcttgggctctggctttgg 135

---

>emb|CR590487.1| full-length cDNA clone CS0DD005YI07 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1226

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 281 aggcttgggctctggctttgg 261

---

>gb|AC116441.2| Homo sapiens chromosome 3 clone RP11-20O23, complete sequence
          Length = 142374

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 94281 aggcttgggctctggctttgg 94301

---

>gb|AC022394.7| Homo sapiens chromosome 10 clone RP11-325M24, complete sequence
          Length = 154064

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 124779 aggcttgggctctggctttgg 124759

---

>gb|AC022613.13| Homo sapiens chromosome 15, clone RP11-680F8, complete sequence
          Length = 188117

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 86341 aggcttgggctctggctttgg 86321

---

>dbj|AK136964.1| Mus musculus 12 days embryo embryonic body between diaphragm region
            and neck cDNA, RIKEN full-length enriched library,
            clone:9430017G04 product:unclassifiable, full insert
            sequence
          Length = 2832

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 1732 aggcttgggctctggctttgg 1752

---

>gb|AC099560.2| Homo sapiens chromosome 3 clone RP11-761N21, complete sequence
          Length = 192169

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 156983 aggcttgggctctggctttgg 156963

---

>ref|XM_937222.1| PREDICTED: Homo sapiens similar to TRM5 tRNA methyltransferase 5
           homolog (S. cerevisiae) (LOC653961), mRNA
          Length = 1826

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 929 aggcttgggctctggctttgg 909

---

>ref|XM_945624.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 3 (LOC649445), mRNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_945621.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 2 (LOC649445), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_942006.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 1 (LOC649445), mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_929021.1| PREDICTED: Homo sapiens similar to TRM5 tRNA methyltransferase 5
           homolog (S. cerevisiae) (LOC653695), mRNA
          Length = 1826

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 929 aggcttgggctctggctttgg 909

---

>ref|XM_933938.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 3 (LOC643872), mRNA
          Length = 1214

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_933937.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 2 (LOC643872), mRNA
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_929731.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain
           2), transcript variant 1 (LOC643872), mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 237 aggcttgggctctggctttgg 217

---

>ref|XM_927624.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC644498), mRNA
          Length = 440

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 230 aggcttgggctctggctttgg 210

---

>ref|XM_939591.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC650503), mRNA
          Length = 440

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 230 aggcttgggctctggctttgg 210

---

>ref|XM_941943.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC652483), mRNA
          Length = 696

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 444 aggcttgggctctggctttgg 424

---

>ref|XM_930287.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC647242), mRNA
          Length = 696

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 444 aggcttgggctctggctttgg 424

---

>ref|XM_937902.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC648822), mRNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103

---

>ref|XM_937758.1| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC148915), mRNA
          Length = 1568

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 582 aggcttgggctctggctttgg 562

---

>ref|XM_086360.6| PREDICTED: Homo sapiens similar to Nonhistone chromosomal protein
           HMG-17 (High-mobility group nucleosome binding domain 2)
           (LOC148915), mRNA
          Length = 1568

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 582 aggcttgggctctggctttgg 562

---

>emb|CR542122.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0523D for
           gene HMGN2, high-mobility group nucleosomal binding
           domain 2; complete cds, incl. stopcodon
          Length = 273

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 123 aggcttgggctctggctttgg 103

---

>dbj|AB179399.1| Macaca fascicularis testis cDNA clone: QtsA-19263, similar to human
           high-mobility group nucleosomal binding domain 2(HMGN2),
           mRNA, RefSeq: NM_005517.1
          Length = 1092

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 255 aggcttgggctctggctttgg 235

---

>dbj|AK079536.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230035L15 product:nucleolar
           protein 3 (apoptosis repressor with CARD domain) [Homo
           sapiens]., full insert sequence
          Length = 1620

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 774 cggctcgggctcgggttcgggttctggctcgggctccggct 734

---

>ref|NG_000892.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17-like 2 (HMG17L2) pseudogene on chromosome 22
          Length = 465

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 223 aggcttgggctctggctttgg 203

---

>ref|NG_001142.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17 pseudogene 2 (HMG17P2) on chromosome 6
          Length = 1308

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 287 aggcttgggctctggctttgg 267

---

>ref|NG_002646.1| Homo sapiens high-mobility group (nonhistone chromosomal) protein
           17-like 1 (HMG17L1) pseudogene on chromosome 22
          Length = 1660

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 619 aggcttgggctctggctttgg 599

---

>dbj|AK053846.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130314L04 product:apoptosis repressor
           with CARD domain [Homo sapiens], full insert sequence
          Length = 2870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 743 cggctcgggctcgggttcgggttctggctcgggctccggct 703

---

>dbj|AK021023.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
           enriched library, clone:B430311C09 product:apoptosis
           repressor with CARD domain [Homo sapiens], full insert
           sequence
          Length = 927

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 688 cggctcgggctcgggttcgggttctggctcgggctccggct 648

---

>gb|DQ015919.1| Homo sapiens tight junction protein 1 (zona occludens 1) (TJP1) gene,
             complete cds
          Length = 125625

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 92962 aggcttgggctctggctttgg 92982

---

>gb|DQ000559.1| Synthetic construct clone PSF:109216 high mobility group protein 17
           gene, complete cds
          Length = 345

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 195 aggcttgggctctggctttgg 175

---

>gb|AC117394.10| Homo sapiens 3 BAC RP11-529G21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 198170

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 168343 aggcttgggctctggctttgg 168363



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 347    ttcaggcttgggctctggctt 367
              |||||||||||||||||||||
Sbjct: 168340 ttcaggcttgggctctggctt 168360

---

>gb|BC029638.1| Homo sapiens, Similar to high-mobility group (nonhistone
           chromosomal) protein 17, clone IMAGE:4777228, mRNA
          Length = 1295

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 379 aggcttgggctctggctttgg 359

---

>ref|NM_001003101.1| Canis familiaris non-histone chromosomal protein HMG-17 (HMG-17),
           mRNA
          Length = 656

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188

---

>gb|AC068538.8| Homo sapiens BAC clone RP11-141G4 from 2, complete sequence
          Length = 173169

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 131885 aggcttgggctctggctttgg 131905

---

>gb|AC007395.3|AC007395 Homo sapiens BAC clone RP11-504O1 from 2, complete sequence
          Length = 158458

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 109708 aggcttgggctctggctttgg 109688

---

>gb|AC027125.5| Homo sapiens chromosome 3 clone RP11-584M7 map 3p, complete sequence
          Length = 173842

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 117509 aggcttgggctctggctttgg 117489

---

>gb|AF198109.1|AF198109 Trichomonas vaginalis eukaryotic release factor 3 GTPase subunit
           (erf3) gene, complete cds
          Length = 2242

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 381 ggcttgggctctggttttggc 401
           |||||||||||||||||||||
Sbjct: 585 ggcttgggctctggttttggc 565



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 357 ggctctggcttaggcatgggttgaggcttgggctctggttttgg 400
           |||| ||||| |||| ||||||  ||||| ||||||||||||||
Sbjct: 537 ggctttggctcaggcttgggttctggctttggctctggttttgg 494

---

>dbj|AK026562.1| Homo sapiens cDNA: FLJ22909 fis, clone KAT05694, highly similar to
           HUMHMG17 Human non-histone chromosomal protein HMG-17
           mRNA
          Length = 1164

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 167 aggcttgggctctggctttgg 147

---

>gb|BC071707.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:87991 IMAGE:3849426), complete cds
          Length = 1200

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 218 aggcttgggctctggctttgg 198

---

>gb|BC027290.1| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain), mRNA (cDNA clone MGC:27734 IMAGE:2647023),
           complete cds
          Length = 1022

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 769 cggctcgggctcgggttcgggttctggctcgggctccggct 729

---

>gb|BC032140.2| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone MGC:29711 IMAGE:5021546), complete cds
          Length = 1265

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 217 aggcttgggctctggctttgg 197

---

>emb|AL163052.4|CNS01RIB Human chromosome 14 DNA sequence BAC R-769B21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181905

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 34283 aggcttgggctctggctttgg 34263

---

>emb|AL160236.4|CNS01RH0 Human chromosome 14 DNA sequence BAC R-193F5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192401

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 46598 aggcttgggctctggctttgg 46578

---

>gb|BC099178.1| Rattus norvegicus high mobility group nucleosomal binding domain 2,
           mRNA (cDNA clone MGC:116347 IMAGE:7383003), complete cds
          Length = 1240

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 245 aggcttgggctctggctttgg 225

---

>gb|BC099815.1| Rattus norvegicus high mobility group nucleosomal binding domain 2,
           mRNA (cDNA clone MGC:124667 IMAGE:7929654), complete cds
          Length = 1228

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 254 aggcttgggctctggctttgg 234

---

>ref|NM_001025624.1| Rattus norvegicus high mobility group nucleosomal binding domain 2
           (Hmgn2), mRNA
          Length = 1240

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 245 aggcttgggctctggctttgg 225

---

>gb|BC053971.1| Mus musculus nucleolar protein 3 (apoptosis repressor with CARD
           domain), mRNA (cDNA clone IMAGE:1397304)
          Length = 960

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 326 cggctccggcttgggttcgggttcaggcttgggctctggct 366
           |||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 714 cggctcgggctcgggttcgggttctggctcgggctccggct 674

---

>gb|BC003689.1| Homo sapiens high-mobility group nucleosomal binding domain 2, mRNA
           (cDNA clone IMAGE:3455121)
          Length = 1199

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 189 aggcttgggctctggctttgg 169

---

>emb|AL732543.8| Mouse DNA sequence from clone RP23-13D22 on chromosome 4, complete
             sequence
          Length = 195272

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   gggatgatggaatacaaggaa 162
             |||||||||||||||||||||
Sbjct: 77733 gggatgatggaatacaaggaa 77713

---

>gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome 14, complete sequence
          Length = 255753

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 410   aggcttgggctctggctttgg 430
             |||||||||||||||||||||
Sbjct: 76218 aggcttgggctctggctttgg 76198

---

>ref|NM_020810.1| Homo sapiens TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae)
            (TRMT5), mRNA
          Length = 5272

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 4379 aggcttgggctctggctttgg 4359

---

>emb|AL732319.17| Mouse DNA sequence from clone RP23-180O4 on chromosome X, complete
              sequence
          Length = 151503

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 139040 aggcttgggctctggctttgg 139020

---

>emb|AL844586.5| Mouse DNA sequence from clone RP23-259N17 on chromosome 2, complete
              sequence
          Length = 181467

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    aggcttgggctctggctttgg 430
              |||||||||||||||||||||
Sbjct: 170594 aggcttgggctctggctttgg 170614

---

>emb|AL844537.5| Mouse DNA sequence from clone RP23-448A16 on chromosome 2, complete
            sequence
          Length = 185541

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 5931 aggcttgggctctggctttgg 5911

---

>gb|M12623.1|HUMHMG17 Human non-histone chromosomal protein HMG-17 mRNA, complete cds
          Length = 1187

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 211 aggcttgggctctggctttgg 191

---

>emb|AJ388518.1|CFA388518 Canis familiaris mRNA for non-histone chromosomal protein HMG-17
           (hmg-17 gene)
          Length = 656

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 208 aggcttgggctctggctttgg 188

---

>emb|X06444.1|HSHMG17P Human retropseudogene for chromosomal protein HMG-17 (clone 60H)
          Length = 1392

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 410 aggcttgggctctggctttgg 430
           |||||||||||||||||||||
Sbjct: 371 aggcttgggctctggctttgg 351

---

>emb|X13546.1|HSHMG17G Human HMG-17 gene for non-histone chromosomal protein HMG-17
          Length = 7195

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 4002 aggcttgggctctggctttgg 3982

---

>dbj|AB037814.1| Homo sapiens mRNA for KIAA1393 protein, partial cds
          Length = 5164

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 410  aggcttgggctctggctttgg 430
            |||||||||||||||||||||
Sbjct: 4273 aggcttgggctctggctttgg 4253

---

>gb|U80815.2| Caenorhabditis elegans cosmid W02C12, complete sequence
          Length = 22847

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 363  ggcttaggcatgggttgaggcttgggct 390
            |||||||||||||| |||||||| ||||
Sbjct: 8200 ggcttaggcatgggctgaggcttaggct 8173

---

>gb|AC154426.2| Mus musculus BAC clone RP24-199A21 from chromosome 14, complete
            sequence
          Length = 210568

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 149  tggaatacaaggaatgcaaaaaag 172
            |||||||||||| |||||||||||
Sbjct: 6876 tggaatacaaggcatgcaaaaaag 6853

---

>ref|XM_477690.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1057

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 ggttcgggttcaggcttgggctctggcttagg 370
           |||| |||||||||||| ||||| ||||||||
Sbjct: 660 ggtttgggttcaggctttggctccggcttagg 629

---

>ref|XM_360938.1| Magnaporthe grisea 70-15 hypothetical protein (MG03481.4) partial
            mRNA
          Length = 2076

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 339  ggttcgggttcaggcttggg 358
            ||||||||||||||||||||
Sbjct: 1358 ggttcgggttcaggcttggg 1339

---

>ref|NM_003632.1| Homo sapiens contactin associated protein 1 (CNTNAP1), mRNA
          Length = 5293

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 326 cggctccggcttgggttcgggttcaggcttgggctc 361
           ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 180 cggctccggctagggctcgagttctggcttgggctc 145

---

>emb|Z93375.1|CEC38C6 Caenorhabditis elegans Cosmid C38C6, complete sequence
          Length = 25943

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 344  gggttcaggcttgggctctggcttaggc 371
            |||||||||||| |||| ||||||||||
Sbjct: 2139 gggttcaggcttaggctttggcttaggc 2112

---

>gb|AF036699.2| Caenorhabditis elegans cosmid F58F6, complete sequence
          Length = 43764

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 363   ggcttaggcatgggttgaggcttgggct 390
             |||||||||||||||||| |||| ||||
Sbjct: 30666 ggcttaggcatgggttgatgcttaggct 30639

---

>emb|AL357515.26| Human DNA sequence from clone RP11-397G5 on chromosome 6 Contains the 3'
              end of the AMD1 gene for S-adenosylmethionine decarboxylase
              1, two novel genes, a glutathione S-transferase M2 (muscle)
              (GSTM2) pseudogene and three CpG islands, complete sequence
          Length = 190440

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     atgtgcacagatgaacgcat 70
              ||||||||||||||||||||
Sbjct: 121760 atgtgcacagatgaacgcat 121741

---

>emb|AL158139.26| Human DNA sequence from clone RP1-80B9 on chromosome 6 Contains the 5'
              end of the GMDS gene for GDP-mannose 4,6-dehydratase, a
              novel gene and a CpG island, complete sequence
          Length = 130403

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 411    ggcttgggctctggctttgg 430
              ||||||||||||||||||||
Sbjct: 112204 ggcttgggctctggctttgg 112185

---

>gb|AC091204.3| Drosophila melanogaster 3L NOVECTOR RP98-27G13 (Roswell Park Cancer
              Institute Drosophila BAC Library) complete sequence
          Length = 185825

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 148    atggaatacaaggaatgcaaaaaa 171
              |||||||||| |||||||||||||
Sbjct: 165497 atggaatacagggaatgcaaaaaa 165520

---

>gb|AC091221.3| Drosophila melanogaster 3L BAC RP98-9I19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 185790

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 148    atggaatacaaggaatgcaaaaaa 171
              |||||||||| |||||||||||||
Sbjct: 182112 atggaatacagggaatgcaaaaaa 182089

---

>ref|NM_061930.2| Caenorhabditis elegans F34D6.1 (F34D6.1) mRNA, complete cds
          Length = 1525

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 363  ggcttaggcatgggttgaggcttgggct 390
            ||||||||| |||| |||||||||||||
Sbjct: 1431 ggcttaggcttgggctgaggcttgggct 1404

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 247     ggtcgatctcctcctccttcggct 270
               ||||||||||||||||||| ||||
Sbjct: 8641318 ggtcgatctcctcctcctttggct 8641295

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    tcctcctccttcggctgtca 274
              ||||||||||||||||||||
Sbjct: 301516 tcctcctccttcggctgtca 301497

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 339      ggttcgggttcaggcttgggctctggcttagg 370
                |||| |||||||||||| ||||| ||||||||
Sbjct: 13301053 ggtttgggttcaggctttggctccggcttagg 13301084

---

>emb|BX005483.3| Zebrafish DNA sequence from clone CH211-286G12 in linkage group 23,
             complete sequence
          Length = 182479

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 327   ggctccggcttgggttcgggttcaggcttgggctctggct 366
             ||||| |||| |||||||||||| |||| |||||| ||||
Sbjct: 33139 ggctcgggctcgggttcgggttcgggctcgggctcgggct 33178

---

>gb|AE004965.1| Pseudomonas aeruginosa PAO1, section 526 of 529 of the complete
            genome
          Length = 10353

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  ggcggctccggcttgggttc 343
            ||||||||||||||||||||
Sbjct: 8235 ggcggctccggcttgggttc 8254

---

>gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 211550

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 152    aatacaaggaatgcaaaaaagatg 175
              ||||||||||||||||| ||||||
Sbjct: 209378 aatacaaggaatgcaaagaagatg 209401

---

>gb|AC100793.8| Homo sapiens chromosome 17, clone CTD-3193K9, complete sequence
          Length = 134465

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 326   cggctccggcttgggttcgggttcaggcttgggctc 361
             ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 20565 cggctccggctagggctcgagttctggcttgggctc 20530

---

>dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1123_B01
          Length = 105736

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 339   ggttcgggttcaggcttgggctctggcttagg 370
             |||| |||||||||||| ||||| ||||||||
Sbjct: 15491 ggtttgggttcaggctttggctccggcttagg 15522

---

>dbj|AP004264.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0025D09
          Length = 142593

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 339   ggttcgggttcaggcttgggctctggcttagg 370
             |||| |||||||||||| ||||| ||||||||
Sbjct: 88916 ggtttgggttcaggctttggctccggcttagg 88947

---

>dbj|AP003062.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-555G19, complete
              sequence
          Length = 171428

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 407    gtaaggcttgggctctggct 426
              ||||||||||||||||||||
Sbjct: 153257 gtaaggcttgggctctggct 153238

---

>dbj|AK105956.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-D07, full
           insert sequence
          Length = 1057

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 339 ggttcgggttcaggcttgggctctggcttagg 370
           |||| |||||||||||| ||||| ||||||||
Sbjct: 660 ggtttgggttcaggctttggctccggcttagg 629

---

>gb|AF025454.1| Caenorhabditis elegans cosmid F34D6, complete sequence
          Length = 23656

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 363 ggcttaggcatgggttgaggcttgggct 390
           ||||||||| |||| |||||||||||||
Sbjct: 719 ggcttaggcttgggctgaggcttgggct 746

---

>gb|U87223.1|HSU87223 Homo sapiens contactin associated protein (Caspr) mRNA, complete
           cds
          Length = 5293

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 326 cggctccggcttgggttcgggttcaggcttgggctc 361
           ||||||||||| ||| ||| |||| |||||||||||
Sbjct: 180 cggctccggctagggctcgagttctggcttgggctc 145

---

>gb|AE003557.4| Drosophila melanogaster chromosome 3L, section 28 of 83 of the complete
              sequence
          Length = 287988

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 148    atggaatacaaggaatgcaaaaaa 171
              |||||||||| |||||||||||||
Sbjct: 273298 atggaatacagggaatgcaaaaaa 273321

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    tcctcctccttcggctgtca 274
              ||||||||||||||||||||
Sbjct: 301516 tcctcctccttcggctgtca 301497

---

>emb|AL731598.2|OSJN00248 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065B15,
              complete sequence
          Length = 150007

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 247    ggtcgatctcctcctccttcggct 270
              ||||||||||||||||||| ||||
Sbjct: 101761 ggtcgatctcctcctcctttggct 101738

---

>emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa0032J07 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 160673

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  tcctcctccttcggctgtca 274
            ||||||||||||||||||||
Sbjct: 3477 tcctcctccttcggctgtca 3496

---

>emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa0010K05 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 164143

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 255  tcctcctccttcggctgtca 274
            ||||||||||||||||||||
Sbjct: 8834 tcctcctccttcggctgtca 8815

---

>gb|U23764.1|PAU23764 Pseudomonas aeruginosa TonB (tonB) gene, complete cds
          Length = 1200

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 324 ggcggctccggcttgggttc 343
           ||||||||||||||||||||
Sbjct: 593 ggcggctccggcttgggttc 574

---

>gb|AF040654.3| Caenorhabditis elegans cosmid R06B10, complete sequence
          Length = 40468

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 350  aggcttgggctctggcttaggcatgggttgaggcttgggctctggttttggc 401
            ||||||||||| || ||||||| | |||| |||||| ||||| || ||||||
Sbjct: 9008 aggcttgggctttgacttaggctttggtttaggctttggctcaggctttggc 8957


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,845,793
Number of Sequences: 3902068
Number of extensions: 3845793
Number of successful extensions: 79655
Number of sequences better than 10.0: 173
Number of HSP's better than 10.0 without gapping: 173
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78703
Number of HSP's gapped (non-prelim): 930
length of query: 467
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 445
effective length of database: 17,147,199,772
effective search space: 7630503898540
effective search space used: 7630503898540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---