| Clone Name | rbags37a17 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein L27 (OSJNBa0027P10.10), mRNA Length = 676 Score = 521 bits (263), Expect = e-145 Identities = 377/413 (91%), Gaps = 4/413 (0%) Strand = Plus / Minus Query: 145 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 204 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| Sbjct: 449 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 390 Query: 205 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 264 ||||||||||||||| ||||| || |||||||||| |||||| ||| | |||||| Sbjct: 389 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 331 Query: 265 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 324 || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 330 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 273 Query: 325 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 384 ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| Sbjct: 272 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 213 Query: 385 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 444 ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 212 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 153 Query: 445 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 504 |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| Sbjct: 152 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 94 Query: 505 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 557 | ||| ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 93 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 41
>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete sequence Length = 141307 Score = 521 bits (263), Expect = e-145 Identities = 377/413 (91%), Gaps = 4/413 (0%) Strand = Plus / Plus Query: 145 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 204 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| Sbjct: 84027 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 84086 Query: 205 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 264 ||||||||||||||| ||||| || |||||||||| |||||| ||| | |||||| Sbjct: 84087 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 84145 Query: 265 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 324 || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 84146 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 84203 Query: 325 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 384 ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| Sbjct: 84204 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 84263 Query: 385 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 444 ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 84264 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 84323 Query: 445 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 504 |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| Sbjct: 84324 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 84382 Query: 505 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 557 | ||| ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 84383 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 84435
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 521 bits (263), Expect = e-145 Identities = 377/413 (91%), Gaps = 4/413 (0%) Strand = Plus / Plus Query: 145 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 204 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| Sbjct: 21769344 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21769403 Query: 205 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 264 ||||||||||||||| ||||| || |||||||||| |||||| ||| | |||||| Sbjct: 21769404 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21769462 Query: 265 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 324 || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21769463 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21769520 Query: 325 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 384 ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| Sbjct: 21769521 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21769580 Query: 385 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 444 ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 21769581 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 21769640 Query: 445 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 504 |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| Sbjct: 21769641 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 21769699 Query: 505 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 557 | ||| ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 21769700 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 21769752
>dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064A22, full insert sequence Length = 723 Score = 521 bits (263), Expect = e-145 Identities = 377/413 (91%), Gaps = 4/413 (0%) Strand = Plus / Minus Query: 145 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 204 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| Sbjct: 463 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 404 Query: 205 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 264 ||||||||||||||| ||||| || |||||||||| |||||| ||| | |||||| Sbjct: 403 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 345 Query: 265 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 324 || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 344 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 287 Query: 325 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 384 ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| Sbjct: 286 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 227 Query: 385 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 444 ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 226 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 167 Query: 445 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 504 |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| Sbjct: 166 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 108 Query: 505 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 557 | ||| ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 107 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 55
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 521 bits (263), Expect = e-145 Identities = 377/413 (91%), Gaps = 4/413 (0%) Strand = Plus / Plus Query: 145 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 204 |||||||||||||||||||||||||||||||||||||||||||||| | |||||||| Sbjct: 21781007 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21781066 Query: 205 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 264 ||||||||||||||| ||||| || |||||||||| |||||| ||| | |||||| Sbjct: 21781067 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21781125 Query: 265 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 324 || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21781126 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21781183 Query: 325 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 384 ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| Sbjct: 21781184 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21781243 Query: 385 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 444 ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct: 21781244 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 21781303 Query: 445 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 504 |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||| Sbjct: 21781304 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 21781362 Query: 505 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 557 | ||| ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 21781363 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 21781415
>ref|XM_464969.1| Oryza sativa (japonica cultivar-group), mRNA Length = 689 Score = 509 bits (257), Expect = e-141 Identities = 378/417 (90%), Gaps = 1/417 (0%) Strand = Plus / Minus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||||| | ||||||||| ||||| ||||| ||||| Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| || Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 |||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 ||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 226 Query: 442 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 501 ||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||| Sbjct: 225 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 166 Query: 502 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 165 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 110
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 509 bits (257), Expect = e-141 Identities = 378/417 (90%), Gaps = 1/417 (0%) Strand = Plus / Plus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 10700091 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 10700150 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||||| | ||||||||| ||||| ||||| ||||| Sbjct: 10700151 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 10700210 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| || Sbjct: 10700211 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 10700270 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 |||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| Sbjct: 10700271 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 10700330 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 ||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 10700331 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 10700390 Query: 442 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 501 ||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||| Sbjct: 10700391 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 10700450 Query: 502 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 10700451 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 10700506
>dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0018M09 Length = 157377 Score = 509 bits (257), Expect = e-141 Identities = 378/417 (90%), Gaps = 1/417 (0%) Strand = Plus / Plus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 117781 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 117840 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||||| | ||||||||| ||||| ||||| ||||| Sbjct: 117841 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 117900 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| || Sbjct: 117901 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 117960 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 |||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| Sbjct: 117961 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 118020 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 ||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 118021 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 118080 Query: 442 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 501 ||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||| Sbjct: 118081 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 118140 Query: 502 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 118141 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 118196
>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1115_D03 Length = 169378 Score = 509 bits (257), Expect = e-141 Identities = 378/417 (90%), Gaps = 1/417 (0%) Strand = Plus / Plus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 39572 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 39631 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||||| | ||||||||| ||||| ||||| ||||| Sbjct: 39632 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 39691 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| || Sbjct: 39692 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 39751 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 |||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| Sbjct: 39752 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 39811 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 ||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 39812 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 39871 Query: 442 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 501 ||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||| Sbjct: 39872 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 39931 Query: 502 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 39932 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 39987
>dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038C19, full insert sequence Length = 689 Score = 509 bits (257), Expect = e-141 Identities = 378/417 (90%), Gaps = 1/417 (0%) Strand = Plus / Minus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||||| | ||||||||| ||||| ||||| ||||| Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| || Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 |||||||||||||||||||||||||| |||||| | ||||||||| ||||||||||||| Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 ||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||| Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 226 Query: 442 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 501 ||||||||||||| ||||||||||||||||| ||||| ||||||||||||||| ||||| Sbjct: 225 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 166 Query: 502 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| Sbjct: 165 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 110
>gb|BT016577.1| Zea mays clone Contig410 mRNA sequence Length = 724 Score = 468 bits (236), Expect = e-128 Identities = 372/416 (89%), Gaps = 1/416 (0%) Strand = Plus / Minus Query: 143 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 202 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 454 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcgag 395 Query: 203 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 262 |||||||||| |||| |||| || ||||||||| ||||| ||| | |||||| Sbjct: 394 gcgcgccttggcggccttgcatgcggcgaccttcttgtcgcgggtggagagcgcgtcggg 335 Query: 263 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtg 322 |||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 334 cccgccggtggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggtg 275 Query: 323 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgc 382 |||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| || Sbjct: 274 ggtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgccgtcttcttggc 215 Query: 383 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggcc 442 ||||||| |||||| |||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 214 cgagtccctgcggaccaccttcttggggtacttggcgaggccggcgacgaggcagtggcc 155 Query: 443 gtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgc 502 |||||||||||||||||||||||||||||| ||||| |||||| | |||||| | || || Sbjct: 154 gtaggggcggtcgcgggtgccctcctcgaacacgcgcacgatctctgccttcctgccggc 95 Query: 503 gtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 558 | | || ||||||||| |||||||| ||||| |||||||||||||||||||||||| Sbjct: 94 g-aaccggccctgcaggaggatcacggccttgccgggcttgaggaacttcaccatc 40
>gb|AY104535.1| Zea mays PCO094675 mRNA sequence Length = 995 Score = 379 bits (191), Expect = e-102 Identities = 363/419 (86%), Gaps = 1/419 (0%) Strand = Plus / Minus Query: 143 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 202 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || Sbjct: 478 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcaag 419 Query: 203 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 262 || ||||| | |||| ||||| || ||||||||| | ||| | ||| | |||||| Sbjct: 418 gcgcgctttggccgtcttgcaggcggcgaccttcttgtcgtgggtagagagtgcgtcggg 359 Query: 263 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtg 322 | |||| ||| || ||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 358 cccaccggtggcgacatccttgaaatcgacgtcgagggtgtagcgggtgggcatgaggtg 299 Query: 323 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgc 382 ||||||||||||||||||| |||| |||||||||||||||||| || |||||||| || Sbjct: 298 agtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgcagtcttcttggc 239 Query: 383 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggcc 442 ||||||||||||||||||||||| |||||||| || ||||| ||||||||||||||||| Sbjct: 238 ggagtccttgcggatcaccttctttgggtacttggcgaggcctgcgacgaggcagtggcc 179 Query: 443 gtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgc 502 ||||||||||||||||||||||||||||| ||||| ||||| || |||||| | || || Sbjct: 178 ataggggcggtcgcgggtgccctcctcgaacacgcgcacgataactgccttcctgccggc 119 Query: 503 gtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatcttc 561 | | | |||||| || ||||| || ||||| ||||||||||||||||||||||||||| Sbjct: 118 g-aagcggccctggaggaggataacggccttgccgggcttgaggaacttcaccatcttc 61
>gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence Length = 537 Score = 357 bits (180), Expect = 3e-95 Identities = 291/328 (88%) Strand = Plus / Minus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 336 cctaaaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcga 277 Query: 202 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 261 | |||||||||| |||| ||| || |||||||||| ||||| ||| | ||||| Sbjct: 276 ggcgcgccttggcggccttgcaggcttcgaccttcttgtcccgggtggagagcgcgtcgg 217 Query: 262 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 321 | |||| || || || ||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 216 gcccgcccgatgcgacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggt 157 Query: 322 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 381 | ||||| ||||||||||||| |||| ||||||||| |||||||||||||||||||| | Sbjct: 156 gagtgaaattgacgagcttgatgaagcacttgacgcgggacttcttggccgtcttcttgg 97 Query: 382 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 441 | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 96 cggagtccttgcggatcaccttcttggggtacttggccaggccggcgacgaggcagtgcc 37 Query: 442 cgtaggggcggtcgcgggtgccctcctc 469 | ||||| |||||||||||||||||||| Sbjct: 36 catagggacggtcgcgggtgccctcctc 9
>emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27 Length = 485 Score = 95.6 bits (48), Expect = 2e-16 Identities = 54/56 (96%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 199 |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 427 tagaagcgcagcttggtgaagaaccacctgttcttgccggtcttgaacttctcctc 372 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 280 ccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtgggtgaagttgac 334 |||||| ||| || || |||||||||||||||||||| |||||| || ||||||| Sbjct: 300 ccttgaagtccacatccagggtgtagcgggtgggcatcaggtggttgtagttgac 246
>ref|NM_117587.2| Arabidopsis thaliana structural constituent of ribosome AT4G15000 mRNA, complete cds Length = 657 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 257 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 198 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 197 ccggcgacgaggcagtgtccgta 175
>gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence Length = 379 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||||||||||||||||||||| || |||||||| | |||||| ||||| ||||| Sbjct: 215 gagcttggtgaagaaccacctgttcttcccagtcttgaaacgctcctcaagcttagcctt 156
>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2 Length = 202860 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 137361 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 137302 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 137156 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 137097 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 137096 ccggcgacgaggcagtgtccgta 137074
>gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA, complete cds Length = 439 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 399 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 340 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 194 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 135 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 134 ccggcgacgaggcagtgtccgta 112
>gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA, complete cds Length = 640 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 257 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 198 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 197 ccggcgacgaggcagtgtccgta 175
>emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS23ZG03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 625 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 233 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 174 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 173 ccggcgacgaggcagtgtccgta 151
>emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS22ZD04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 625 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 233 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 174 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 173 ccggcgacgaggcagtgtccgta 151
>gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete sequence Length = 631 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| || ||||||||||||||||| ||||| ||||| Sbjct: 460 gagcttggtaaagaaccatctgttcttaccagtcttgaacctctcctcaagcttagcctt 401 Score = 54.0 bits (27), Expect = 6e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| ||| Sbjct: 255 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttcagt 196 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 195 ccggcgacgaggcagtgtccgta 173
>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40 Length = 197405 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 82815 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 82756 Score = 46.1 bits (23), Expect = 0.13 Identities = 68/83 (81%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| || |||||||| || ||||| |||||||| || || | ||||||||| || Sbjct: 82610 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 82551 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 82550 ccggcgacgaggcagtgtccgta 82528
>ref|NM_113120.2| Arabidopsis thaliana structural constituent of ribosome AT3G22230 mRNA, complete cds Length = 631 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 248 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 189 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 188 ccggcgacgaggcagtgtccgta 166 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 453 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 394
>gb|AY091218.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 439 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 134 ccggcgacgaggcagtgtccgta 112 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340
>gb|AY063860.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 577 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 210 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 151 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 150 ccggcgacgaggcagtgtccgta 128 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 415 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 356
>gb|AY136321.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 631 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 248 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 189 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 188 ccggcgacgaggcagtgtccgta 166 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 453 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 394
>gb|AY093389.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA, complete cds Length = 503 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 134 ccggcgacgaggcagtgtccgta 112 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340
>gb|AY062617.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA, complete cds Length = 567 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 210 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 151 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 150 ccggcgacgaggcagtgtccgta 128 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 415 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 356
>emb|BX822979.1|CNS0A73W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZE05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 552 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 184 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 125 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 124 ccggcgacgaggcagtgtccgta 102 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 389 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 330
>gb|AY086536.1| Arabidopsis thaliana clone 25631 mRNA, complete sequence Length = 577 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 210 ttcttcgccgtcttcttcgcggagtctttgcggatgactttgctcgggtacttcttcagt 151 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 150 ccggcgacgaggcagtgtccgta 128 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaa 190 |||||| || ||||||||||||||||| || |||||||| Sbjct: 415 gagcttagtaaagaaccacctgttcttaccagtcttgaa 377
>dbj|AP001306.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MKA23 Length = 70100 Score = 69.9 bits (35), Expect = 9e-09 Identities = 71/83 (85%) Strand = Plus / Plus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 52907 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 52966 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 52967 ccggcgacgaggcagtgtccgta 52989 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Plus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 52702 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 52761
>gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence Length = 640 Score = 67.9 bits (34), Expect = 4e-08 Identities = 100/122 (81%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaagaccttg 353 ||||| ||||| || || ||||||| |||| || |||| |||||||||| ||| |||| Sbjct: 301 tcgagtgtgtaacgagtaggcatgatgtggttgtagttcacgagcttgatgaaagcctta 242 Query: 354 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 413 || || || ||||| ||| |||||| || || |||||||||||||||||||| |||||| Sbjct: 241 acacgagatttcttcgcctgcttctttgctgaatccttgcggatcaccttcttcgggtac 182 Query: 414 tt 415 || Sbjct: 181 tt 180 Score = 50.1 bits (25), Expect = 0.009 Identities = 52/61 (85%) Strand = Plus / Minus Query: 153 agcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 212 |||||||| |||||||| | || || |||||||||||||||||||| ||| | |||||| Sbjct: 436 agcttggtaaagaaccagcgatttttcccggtcttgaacctctcctcaagcctagccttg 377 Query: 213 g 213 | Sbjct: 376 g 376
>dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, complete cds Length = 649 Score = 67.9 bits (34), Expect = 4e-08 Identities = 94/114 (82%) Strand = Plus / Minus Query: 359 cgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgc 418 ||||||||| |||||||||||||||||||| || | ||||||||||| |||||||| | Sbjct: 210 cgacttcttcgccgtcttcttcgccgagtctttccttatcaccttcttcgggtacttgga 151 Query: 419 caggccggcgacgaggcagtggccgtaggggcggtcgcgggtgccctcctcgaa 472 | ||||| || | ||||| ||||| |||||||| ||||| ||||| ||||| Sbjct: 150 tattccggcaaccaaacagtgtccgtacgggcggtctcgggttccctcgtcgaa 97
>gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, complete cds Length = 469 Score = 65.9 bits (33), Expect = 1e-07 Identities = 63/73 (86%) Strand = Plus / Minus Query: 142 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 ||||||| |||||||| ||||||||| ||||||||||||||||| |||||||||| | Sbjct: 431 cctagaatcggagcttctggaagaaccatttgttcttgccggtcttgtacctctcctcaa 372 Query: 202 gcttggccttggc 214 |||| ||||||| Sbjct: 371 acttgaccttggc 359
>ref|NM_128781.2| Arabidopsis thaliana structural constituent of ribosome AT2G32220 mRNA, complete cds Length = 605 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 153 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 196 ||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 424 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 381 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 354 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 413 |||||||| ||||| ||||||||||| ||||| |||||||| || || || | |||||| Sbjct: 229 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 170 Query: 414 ttcgccaggccggcgacgaggcagtggccgta 445 ||| || ||||||||||| ||||| ||||| Sbjct: 169 ttcttcaatccggcgacgagacagtgaccgta 138
>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete sequence Length = 103194 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 153 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 196 ||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 10068 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 10111 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 354 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 413 |||||||| ||||| ||||||||||| ||||| |||||||| || || || | |||||| Sbjct: 10263 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 10322 Query: 414 ttcgccaggccggcgacgaggcagtggccgta 445 ||| || ||||||||||| ||||| ||||| Sbjct: 10323 ttcttcaatccggcgacgagacagtgaccgta 10354
>gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds Length = 509 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 153 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 196 ||||||||||||||||| ||||||||||| ||||| |||||||| Sbjct: 417 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 374 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 354 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 413 |||||||| ||||| ||||||||||| ||||| |||||||| || || || | |||||| Sbjct: 222 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 163 Query: 414 ttcgccaggccggcgacgaggcagtggccgta 445 ||| || ||||||||||| ||||| ||||| Sbjct: 162 ttcttcaatccggcgacgagacagtgaccgta 131
>gb|BT000418.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230) mRNA, complete cds Length = 502 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| || || | ||||||||| ||| Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135 Query: 423 ccggcgacgaggcagtggccgta 445 |||||||| |||||||| ||||| Sbjct: 134 ccggcgacaaggcagtgtccgta 112 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340
>emb|BX823175.1|CNS0A74P Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 545 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 363 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 422 ||||| |||||||||||||| ||||| |||||||| | || | ||||||||| ||| Sbjct: 197 ttcttcgccgtcttcttcgctgagtctttgcggatgagtttgctcgggtacttcttcagt 138 Query: 423 ccggcgacgaggcagtggccgta 445 ||||||||||||||||| ||||| Sbjct: 137 ccggcgacgaggcagtgtccgta 115 Score = 48.1 bits (24), Expect = 0.034 Identities = 51/60 (85%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 211 |||||| || ||||||||||||||||| || |||||||| | ||||| ||||| ||||| Sbjct: 402 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 343
>ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06693.4) partial mRNA Length = 450 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 ||||| |||||||||||||||||||||||| || ||||||| | ||||| |||| Sbjct: 302 tcgagagtgtagcgggtgggcatgaggtggttgtagttgacaaccttgacgaag 249
>ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosomal protein L27, transcript variant 3 (LOC486183), mRNA Length = 464 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 161 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 214 |||||||||| | ||||||| ||||||| |||||||||||| |||| ||||||| Sbjct: 411 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 358
>ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosomal protein L27, transcript variant 1 (LOC486183), mRNA Length = 483 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 161 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 214 |||||||||| | ||||||| ||||||| |||||||||||| |||| ||||||| Sbjct: 426 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 373
>emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA Length = 479 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 161 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 214 |||||||||| |||| ||||| |||||| |||||||||| | |||||||||||| Sbjct: 422 gaagaaccacttgtttttgcccgtcttgtacctctcctcaaacttggccttggc 369
>gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete sequence Length = 136954 Score = 60.0 bits (30), Expect = 9e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacct 193 |||||||||||||||||| |||||||| ||||| |||||||| Sbjct: 110830 gagcttggtgaagaaccatctgttcttcccggttttgaacct 110789
>gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete sequence Length = 136333 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 152 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 201 ||||||||| ||||||||||| ||||| || ||||| ||||||||||||| Sbjct: 38418 gagcttggtaaagaaccacctattctttccagtcttaaacctctcctcga 38467
>gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L27 mRNA, complete cds Length = 474 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 161 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 214 ||||||||||||||| ||||| |||||| |||||||||| | |||| ||||||| Sbjct: 421 gaagaaccacctgtttttgcccgtcttgtacctctcctcaaacttgaccttggc 368
>gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence Length = 483 Score = 60.0 bits (30), Expect = 9e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 161 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 214 ||||||||| ||||||||||||||||| | |||||||||| |||| ||||||| Sbjct: 413 gaagaaccatttgttcttgccggtcttgtatctctcctcgaacttgaccttggc 360
>gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA, complete cds Length = 514 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 143 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 199 ||||||||| ||||| |||||||||| ||||||||||||||||| | |||||||| Sbjct: 442 ctagaagcgtagcttctggaagaaccacttgttcttgccggtcttgtatctctcctc 386
>gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete sequence Length = 7003 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 156 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 212 ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| |||| Sbjct: 3200 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 3144
>ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large subunit family member (rpl-27) (rpl-27) mRNA, complete cds Length = 463 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 156 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 212 ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| |||| Sbjct: 406 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 350
>gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L27 homolog mRNA, SL2 trans-spliced, complete cds Length = 506 Score = 58.0 bits (29), Expect = 4e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 156 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 212 ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| |||| Sbjct: 426 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 370
>gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, complete cds Length = 830 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 155 cttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 202 ||||| ||| ||||| |||||||| || |||||||||||||||||||| Sbjct: 466 cttggagaaaaaccatctgttctttcctgtcttgaacctctcctcgag 419
>gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog (RPL27-5) mRNA, complete cds Length = 568 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 153 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 196 ||||||||||| |||||||||||||| || || ||||||||||| Sbjct: 436 agcttggtgaaaaaccacctgttcttccctgttttgaacctctc 393
>gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, complete cds Length = 519 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 152 gagcttggtgaagaaccacctgttctt 178 ||||||||||||||||||||||||||| Sbjct: 444 gagcttggtgaagaaccacctgttctt 418
>ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predicted mRNA Length = 396 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttctt 178 ||||| ||||||||||||||||||||| ||||||| Sbjct: 395 tagaatcggagcttggtgaagaaccacttgttctt 361 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Minus Query: 293 gtcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 |||||||||||| || |||||||| | |||| || ||||||||| ||||| |||| Sbjct: 246 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 192
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttctt 178 ||||| ||||||||||||||||||||| ||||||| Sbjct: 790846 tagaatcggagcttggtgaagaaccacttgttctt 790812 Score = 46.1 bits (23), Expect = 0.13 Identities = 47/55 (85%) Strand = Plus / Minus Query: 293 gtcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 |||||||||||| || |||||||| | |||| || ||||||||| ||||| |||| Sbjct: 790697 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 790643
>ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial mRNA Length = 408 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 158 ggtgaagaaccacctgttcttgccgg 183 |||||||||||||||||||||||||| Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 ||||||||||||||||||||||| | |||| || |||||| || ||||| |||| Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207
>ref|XM_328265.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial mRNA Length = 408 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 158 ggtgaagaaccacctgttcttgccgg 183 |||||||||||||||||||||||||| Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 ||||||||||||||||||||||| | |||| || |||||| || ||||| |||| Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207
>gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL27) gene, complete cds Length = 691 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 143 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 |||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 691 ctagaatcggagcttctggaagaaccacttgttcttgccggtcttg 646
>ref|XM_656734.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4222.2), mRNA Length = 408 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 ||||| ||||| ||||||||||| |||||| || ||||||||| ||||| |||| Sbjct: 260 tcgagagtgtaacgggtgggcatcaggtggttgtagttgacgaccttgatgaag 207
>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 570 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 159 gtgaagaaccacctgttcttgccggtcttg 188 |||||||||||| ||||||||||||||||| Sbjct: 347 gtgaagaaccacttgttcttgccggtcttg 376
>emb|BX006453.1|CNS08D55 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 203 ||||| |||||||| |||||||||| ||||||||||||||||| | |||||||| | Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 531 Query: 204 ttggcc 209 |||||| Sbjct: 532 ttggcc 537
>emb|BX006452.1|CNS08D54 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 203 ||||| |||||||| |||||||||| ||||||||||||||||| | |||||||| | Sbjct: 409 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 350 Query: 204 ttggcc 209 |||||| Sbjct: 349 ttggcc 344
>emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BAC contig B23G1 Length = 106111 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 158 ggtgaagaaccacctgttcttgccgg 183 |||||||||||||||||||||||||| Sbjct: 94824 ggtgaagaaccacctgttcttgccgg 94799 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 294 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 347 ||||||||||||||||||||||| | |||| || |||||| || ||||| |||| Sbjct: 94691 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 94638
>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420
>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529
>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428
>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514
>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416
>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537
>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405
>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 487 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 531
>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 515
>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392
>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 477 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 521
>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 415
>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513
>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407
>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 434 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 390
>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528
>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 436
>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522
>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394
>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523
>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421
>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 843 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 799
>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 488 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 426 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 382
>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 444 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 400
>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518
>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 411
>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517
>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513
>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514
>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391
>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530
>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 707 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412
>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510
>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391
>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 506
>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 393 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 349
>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535
>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430
>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518
>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361
>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344
>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 415 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 371
>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409
>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 495 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 539
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414
>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532
>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393
>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535
>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407
>emb|BX068777.1|CNS09P8D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 468 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 512
>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 420 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 376
>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 507
>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 406 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 362
>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 674 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413
>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532
>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383
>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514
>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401
>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513
>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383
>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518
>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409
>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517
>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417
>emb|BX067173.1|CNS09NZT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 392 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 348
>emb|BX066730.1|CNS09NNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 550 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 496 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 540
>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428
>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523
>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409
>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387
>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412
>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389
>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 391 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 347
>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402
>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418
>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344
>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 441 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 397
>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530
>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409
>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 500
>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389
>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398
>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383
>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 652 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 407 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 363
>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529
>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423
>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 908 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405
>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 889 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 501
>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407
>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528
>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414
>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 735 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 508
>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 465 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391
>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 720 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 314 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 358
>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393
>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517
>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 419
>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510
>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418
>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413
>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1044 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 501 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 457
>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524
>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407
>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 443 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 399
>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517
>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 416 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 372
>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 509
>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387
>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396
>emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 408 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 110 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 66
>emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 114 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 47 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 3
>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 503
>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401
>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513
>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402
>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 475 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 519
>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402
>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 482 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 526
>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423
>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 482
>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386
>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407
>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 907 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392
>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395
>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 500 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387
>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 492 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 536
>emb|BX059324.1|CNS09HXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416
>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401
>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530
>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420
>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401
>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 502
>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395
>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544
>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 427
>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 429 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 385
>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392
>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420
>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 448 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 404
>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 450 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 406
>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544
>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394
>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 489 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 533
>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396
>emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 499
>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 447 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 403
>emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 583 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402
>emb|BX057111.1|CNS09G8B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405
>emb|BX057064.1|CNS09G70 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 425
>emb|BX056980.1|CNS09G4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 494 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393
>emb|BX056911.1|CNS09G2R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 511 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 555
>emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428
>emb|BX056816.1|CNS09G04 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 401 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 357
>emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524
>emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409
>emb|BX056536.1|CNS09FSC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 394 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 350
>emb|BX056232.1|CNS09FJW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 547 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398
>emb|BX056161.1|CNS09FHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529
>emb|BX056160.1|CNS09FHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408
>emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 385 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 341
>emb|BX053204.1|CNS09D7S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417
>emb|BX054990.1|CNS09ELE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 224 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 180
>emb|BX054749.1|CNS09EEP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 454 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 410
>emb|BX053049.1|CNS09D3H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518
>emb|BX053048.1|CNS09D3G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361
>emb|BX054473.1|CNS09E71 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 769 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 357 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 313
>emb|BX054408.1|CNS09E58 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 733 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 358 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 314
>emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537
>emb|BX054218.1|CNS09DZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 712 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421
>emb|BX053917.1|CNS09DRL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 482 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386
>emb|BX053763.1|CNS09DNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430
>emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392
>emb|BX053531.1|CNS09DGV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514
>emb|BX053530.1|CNS09DGU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398
>emb|BX052795.1|CNS09CWF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 509 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 553
>emb|BX052794.1|CNS09CWE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 426
>emb|BX052608.1|CNS09CR8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 481 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 525
>emb|BX052607.1|CNS09CR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386
>emb|BX052579.1|CNS09CQF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 144 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 188 ||||| |||||||| |||||||||| ||||||||||||||||| Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,726,558 Number of Sequences: 3902068 Number of extensions: 4726558 Number of successful extensions: 99176 Number of sequences better than 10.0: 643 Number of HSP's better than 10.0 without gapping: 645 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 96798 Number of HSP's gapped (non-prelim): 2341 length of query: 611 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 588 effective length of database: 17,143,297,704 effective search space: 10080259049952 effective search space used: 10080259049952 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)