ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags37a15 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_192099.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1005 Score = 335 bits (169), Expect = 9e-89 Identities = 346/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 996 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 937 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 936 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 877 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 876 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccagatcttgat 817 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 816 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 757 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 756 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 697 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 696 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 637 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 636 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 592
>dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037K24, full insert sequence Length = 1358 Score = 335 bits (169), Expect = 9e-89 Identities = 346/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 1094 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 1035 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 1034 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 975 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 974 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccagatcttgat 915 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 914 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 855 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 854 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 795 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 794 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 735 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 734 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 690
>dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N15, full insert sequence Length = 1256 Score = 335 bits (169), Expect = 9e-89 Identities = 346/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 1065 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 1006 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 1005 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 946 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 945 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccagatcttgat 886 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 885 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 826 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 825 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 766 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 765 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 706 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 705 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 661
>dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-A02, full insert sequence Length = 1351 Score = 335 bits (169), Expect = 9e-89 Identities = 346/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 1088 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 1029 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 1028 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 969 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 968 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccagatcttgat 909 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 908 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 849 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 848 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 789 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 788 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 729 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 728 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 684
>dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RWD mRNA for q group of receptor for activated C-kinase, complete cds Length = 1285 Score = 335 bits (169), Expect = 9e-89 Identities = 346/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 1022 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 963 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 962 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 903 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 902 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccagatcttgat 843 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 842 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 783 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 782 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 723 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 722 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 663 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 662 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 618
>dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E12, full insert sequence Length = 1326 Score = 327 bits (165), Expect = 2e-86 Identities = 345/405 (85%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 1082 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 1023 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctgtttgctggagac 286 ||||| ||||| ||||||||| |||||| ||||||||||||||||| || ||||||| Sbjct: 1022 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctggttcttggagac 963 Query: 287 tgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccagatcttgat 346 |||| ||||||| ||||||||||||| |||||||||||||||||| ||||||||||||| Sbjct: 962 agggatctcgggcttaaggtcctgcacaatgtgctttgactcaagaccccagatcttgat 903 Query: 347 ggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 || ||||| |||||||||||||||||||||||||| |||||||| || || |||| || Sbjct: 902 agagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcgagtgaat 843 Query: 407 aatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagt 466 ||||| ||||| || |||||||| || ||||||||||| | ||| |||||||||| || Sbjct: 842 gatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccacagcagggt 783 Query: 467 gacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaacggcact 526 |||||||| |||||||| || ||||| || |||||||| ||||||||||| || || | Sbjct: 782 aacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcgacagcgtt 723 Query: 527 aacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 || || || |||||||| || || ||||||| ||||||||||| Sbjct: 722 gacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 678
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 230 bits (116), Expect = 4e-57 Identities = 248/292 (84%) Strand = Plus / Minus Query: 280 tggagactgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccaga 339 ||||||| |||| ||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 28325037 tggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccaga 28324978 Query: 340 tcttgatggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtg 399 ||||||| || ||||| |||||||||||||||||||||||||| |||||||| || || | Sbjct: 28324977 tcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcg 28324918 Query: 400 agttgataatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccaca 459 ||| || ||||| ||||| || |||||||| || ||||||||||| | ||| ||||||| Sbjct: 28324917 agtgaatgatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccaca 28324858 Query: 460 gcaaagtgacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaa 519 ||| || |||||||| |||||||| || ||||| || |||||||| ||||||||||| | Sbjct: 28324857 gcagggtaacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcga 28324798 Query: 520 cggcactaacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 | || | || || || |||||||| || || ||||||| ||||||||||| Sbjct: 28324797 cagcgttgacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 28324746 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 28326312 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 28326253 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctg 274 ||||| ||||| ||||||||| |||||| ||||||||||||||||| Sbjct: 28326252 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctg 28326205 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 545 atcaagagtgcagcggagcttgca 568 |||||||| ||||||||||||||| Sbjct: 28783006 atcaagagagcagcggagcttgca 28782983
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0478H03 Length = 167560 Score = 230 bits (116), Expect = 4e-57 Identities = 248/292 (84%) Strand = Plus / Minus Query: 280 tggagactgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccaga 339 ||||||| |||| ||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 159544 tggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccaga 159485 Query: 340 tcttgatggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtg 399 ||||||| || ||||| |||||||||||||||||||||||||| |||||||| || || | Sbjct: 159484 tcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcg 159425 Query: 400 agttgataatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccaca 459 ||| || ||||| ||||| || |||||||| || ||||||||||| | ||| ||||||| Sbjct: 159424 agtgaatgatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccaca 159365 Query: 460 gcaaagtgacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaa 519 ||| || |||||||| |||||||| || ||||| || |||||||| ||||||||||| | Sbjct: 159364 gcagggtaacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcga 159305 Query: 520 cggcactaacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 | || | || || || |||||||| || || ||||||| ||||||||||| Sbjct: 159304 cagcgttgacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 159253 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 160819 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 160760 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctg 274 ||||| ||||| ||||||||| |||||| ||||||||||||||||| Sbjct: 160759 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctg 160712
>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0519D04 Length = 193068 Score = 230 bits (116), Expect = 4e-57 Identities = 248/292 (84%) Strand = Plus / Minus Query: 280 tggagactgggacctcgggcctaaggtcctgcacgatgtgctttgactcaagatcccaga 339 ||||||| |||| ||||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 40137 tggagacagggatctcgggcttaaggtcctgcacaatgtgctttgactcaagatcccaga 40078 Query: 340 tcttgatggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaaacaaagtg 399 ||||||| || ||||| |||||||||||||||||||||||||| |||||||| || || | Sbjct: 40077 tcttgatagagtcctgggtcgccgcgcagagccagtagcggttgggcgagaagcagagcg 40018 Query: 400 agttgataatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccaca 459 ||| || ||||| ||||| || |||||||| || ||||||||||| | ||| ||||||| Sbjct: 40017 agtgaatgatggaacccgcgtcaagcgagtacagcctcttgccctcagccaagtcccaca 39958 Query: 460 gcaaagtgacgccatccttgccaccagaggcgcagagtgaaccgtctgggctgaccgcaa 519 ||| || |||||||| |||||||| || ||||| || |||||||| ||||||||||| | Sbjct: 39957 gcagggtaacgccatctttgccaccggacgcgcacagagaaccgtcggggctgaccgcga 39898 Query: 520 cggcactaacatacccaccatggccatcaagagtgcagcggagcttgcagtt 571 | || | || || || |||||||| || || ||||||| ||||||||||| Sbjct: 39897 cagcgttgacgtagccgccatggccctcgaggttgcagcgcagcttgcagtt 39846 Score = 119 bits (60), Expect = 1e-23 Identities = 96/108 (88%) Strand = Plus / Minus Query: 167 gtagctgaacccagagatcttgtagatgcgaatggttccatcagtgtaaccagcatagag 226 ||||||||| || |||||||||||||| | ||||||||||| ||||||||||||||||| Sbjct: 41412 gtagctgaaacctgagatcttgtagatcctgatggttccatctgtgtaaccagcatagag 41353 Query: 227 agtgctgccatccgcgctccagctcaagcaagtgcagtagagcatctg 274 ||||| ||||| ||||||||| |||||| ||||||||||||||||| Sbjct: 41352 ggtgcttccatctgcgctccagttcaagcttgtgcagtagagcatctg 41305
>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence Length = 1254 Score = 222 bits (112), Expect = 1e-54 Identities = 304/368 (82%) Strand = Plus / Minus Query: 204 ccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtgcag 263 ||||| ||||| |||| ||||| ||||| ||||| |||||||||||||||| |||||| Sbjct: 1025 ccatcggtgtagccagtgtagagggtgcttccatcggcgctccagctcaagcttgtgcag 966 Query: 264 tagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgcttt 323 || || ||||| || |||||| ||| || ||| | ||||||||||||| |||||| Sbjct: 965 tacaggatctggttcttggagatctggatgtcaggcttgaggtcctgcacgacgtgcttc 906 Query: 324 gactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttc 383 |||||||| ||||||||||| | || ||||| ||||| |||||||||||||||||||| Sbjct: 905 gactcaaggtcccagatcttaacagagtcctgggtcgcagcgcagagccagtagcggttg 846 Query: 384 ggcgagaaacaaagtgagttgataatggatcccgcatccagcgagtagagtctcttgccc 443 |||||||| || || |||| ||| ||||| ||||||||||||||||| || ||||| ||| Sbjct: 845 ggcgagaagcagagggagtggatgatggagcccgcatccagcgagtacagcctcttcccc 786 Query: 444 tcggtcaaatcccacagcaaagtgacgccatccttgccaccagaggcgcagagtgaaccg 503 || | |||||||||||||| ||| || || ||||| || || ||||||||||| || || Sbjct: 785 tcagccaaatcccacagcagagtaacaccgtccttcccgccggaggcgcagagcgatcca 726 Query: 504 tctgggctgaccgcaacggcactaacatacccaccatggccatcaagagtgcagcggagc 563 || ||||| || || ||||| ||||||| || ||||| ||||| ||||||||||| ||| Sbjct: 725 tcggggctcacggcgacggcgttaacatatccgccatgaccatcgagagtgcagcgcagc 666 Query: 564 ttgcagtt 571 |||||||| Sbjct: 665 ttgcagtt 658
>gb|AY103919.1| Zea mays PCO099246 mRNA sequence Length = 1461 Score = 222 bits (112), Expect = 1e-54 Identities = 304/368 (82%) Strand = Plus / Minus Query: 204 ccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtgcag 263 ||||| ||||| |||| ||||| ||||| ||||| |||||||||||||||| |||||| Sbjct: 1182 ccatcggtgtagccagtgtagagggtgcttccatcggcgctccagctcaagcttgtgcag 1123 Query: 264 tagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgcttt 323 || || ||||| || |||||| ||| || ||| | ||||||||||||| |||||| Sbjct: 1122 tacaggatctggttcttggagatctggatgtcaggcttgaggtcctgcacgacgtgcttc 1063 Query: 324 gactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttc 383 |||||||| ||||||||||| | || ||||| ||||| |||||||||||||||||||| Sbjct: 1062 gactcaaggtcccagatcttaacagagtcctgggtcgcagcgcagagccagtagcggttg 1003 Query: 384 ggcgagaaacaaagtgagttgataatggatcccgcatccagcgagtagagtctcttgccc 443 |||||||| || || |||| ||| ||||| ||||||||||||||||| || ||||| ||| Sbjct: 1002 ggcgagaagcagagggagtggatgatggagcccgcatccagcgagtacagcctcttcccc 943 Query: 444 tcggtcaaatcccacagcaaagtgacgccatccttgccaccagaggcgcagagtgaaccg 503 || | |||||||||||||| ||| || || ||||| || || ||||||||||| || || Sbjct: 942 tcagccaaatcccacagcagagtaacaccgtccttcccgccggaggcgcagagcgatcca 883 Query: 504 tctgggctgaccgcaacggcactaacatacccaccatggccatcaagagtgcagcggagc 563 || ||||| || || ||||| ||||||| || ||||| ||||| ||||||||||| ||| Sbjct: 882 tcggggctcacggcgacggcgttaacatatccgccatgaccatcgagagtgcagcgcagc 823 Query: 564 ttgcagtt 571 |||||||| Sbjct: 822 ttgcagtt 815
>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence Length = 1281 Score = 214 bits (108), Expect = 2e-52 Identities = 303/368 (82%) Strand = Plus / Minus Query: 204 ccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtgcag 263 ||||| ||||| |||| ||||| | ||| ||||| |||||||||||||||| |||||| Sbjct: 1034 ccatcggtgtagccagtgtagagggggcttccatcggcgctccagctcaagcttgtgcag 975 Query: 264 tagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgcttt 323 || || ||||| || |||||| ||| || ||| | ||||||||||||| |||||| Sbjct: 974 tacaggatctggttcttggagatctggatgtcaggcttgaggtcctgcacgacgtgcttc 915 Query: 324 gactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttc 383 |||||||| ||||||||||| | || ||||| ||||| |||||||||||||||||||| Sbjct: 914 gactcaaggtcccagatcttaacagagtcctgggtcgcagcgcagagccagtagcggttg 855 Query: 384 ggcgagaaacaaagtgagttgataatggatcccgcatccagcgagtagagtctcttgccc 443 |||||||| || || |||| ||| ||||| ||||||||||||||||| || ||||| ||| Sbjct: 854 ggcgagaagcagagggagtggatgatggagcccgcatccagcgagtacagcctcttcccc 795 Query: 444 tcggtcaaatcccacagcaaagtgacgccatccttgccaccagaggcgcagagtgaaccg 503 || | |||||||||||||| ||| || || ||||| || || ||||||||||| || || Sbjct: 794 tcagccaaatcccacagcagagtaacaccgtccttcccgccggaggcgcagagcgatcca 735 Query: 504 tctgggctgaccgcaacggcactaacatacccaccatggccatcaagagtgcagcggagc 563 || ||||| || || ||||| ||||||| || ||||| ||||| ||||||||||| ||| Sbjct: 734 tcggggctcacggcgacggcgttaacatatccgccatgaccatcgagagtgcagcgcagc 675 Query: 564 ttgcagtt 571 |||||||| Sbjct: 674 ttgcagtt 667
>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence Length = 1265 Score = 198 bits (100), Expect = 1e-47 Identities = 301/368 (81%) Strand = Plus / Minus Query: 204 ccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtgcag 263 ||||| ||||| |||| ||||| ||||| || ||||| ||||||||||||| || ||| Sbjct: 1025 ccatcggtgtagccagtgtagagggtgcttccgtccgcactccagctcaagcttgtacag 966 Query: 264 tagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgcttt 323 || || ||||| || ||||||| ||| |||||| | ||||||||||| | |||||| Sbjct: 965 tacaggatctggttcttggagacctggatgtcgggcttgaggtcctgcacaacgtgcttc 906 Query: 324 gactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttc 383 ||||| || ||||||||||||| || ||||| ||||| |||||||||||||||||||| Sbjct: 905 gactcgaggtcccagatcttgacagagtcctgcgtcgcagcgcagagccagtagcggttg 846 Query: 384 ggcgagaaacaaagtgagttgataatggatcccgcatccagcgagtagagtctcttgccc 443 || ||||| || || |||| ||| ||||| ||||| ||||||||||| || ||||| ||| Sbjct: 845 ggtgagaagcagagagagtggatgatggagcccgcgtccagcgagtacagcctcttcccc 786 Query: 444 tcggtcaaatcccacagcaaagtgacgccatccttgccaccagaggcgcagagtgaaccg 503 || | |||||||||||||| ||| || || ||||| || || |||||||| || || ||| Sbjct: 785 tcagccaaatcccacagcagagtaacaccgtccttcccgccggaggcgcacagcgacccg 726 Query: 504 tctgggctgaccgcaacggcactaacatacccaccatggccatcaagagtgcagcggagc 563 || ||||| || || ||||| ||||||| ||||| || ||||| ||||||||||| ||| Sbjct: 725 tcggggctcacagcgacggcgttaacatagccaccgtgcccatccagagtgcagcgcagc 666 Query: 564 ttgcagtt 571 |||||||| Sbjct: 665 ttgcagtt 658
>ref|XM_475866.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1011 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Minus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 965 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 906 Query: 261 cagtagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgc 320 ||||| |||||||| | || || | |||| || ||| | |||||||||| || | || Sbjct: 905 cagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagc 846 Query: 321 tttgactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcgg 380 || ||||| || ||||||||||||| ||| |||| |||||| |||||||||||||||||| Sbjct: 845 ttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcgg 786 Query: 381 ttcggcgagaa 391 || |||||||| Sbjct: 785 ttgggcgagaa 775
>dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034P13, full insert sequence Length = 1385 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Minus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 1040 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 981 Query: 261 cagtagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgc 320 ||||| |||||||| | || || | |||| || ||| | |||||||||| || | || Sbjct: 980 cagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagc 921 Query: 321 tttgactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcgg 380 || ||||| || ||||||||||||| ||| |||| |||||| |||||||||||||||||| Sbjct: 920 ttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcgg 861 Query: 381 ttcggcgagaa 391 || |||||||| Sbjct: 860 ttgggcgagaa 850
>dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002L07, full insert sequence Length = 1227 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Minus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 1033 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 974 Query: 261 cagtagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgc 320 ||||| |||||||| | || || | |||| || ||| | |||||||||| || | || Sbjct: 973 cagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagc 914 Query: 321 tttgactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcgg 380 || ||||| || ||||||||||||| ||| |||| |||||| |||||||||||||||||| Sbjct: 913 ttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcgg 854 Query: 381 ttcggcgagaa 391 || |||||||| Sbjct: 853 ttgggcgagaa 843
>dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D07, full insert sequence Length = 1412 Score = 125 bits (63), Expect = 2e-25 Identities = 159/191 (83%) Strand = Plus / Minus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 1042 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 983 Query: 261 cagtagagcatctgtttgctggagactgggacctcgggcctaaggtcctgcacgatgtgc 320 ||||| |||||||| | || || | |||| || ||| | |||||||||| || | || Sbjct: 982 cagtacagcatctggctcttgaaggcctggacttctggcttgaggtcctgcatgacgagc 923 Query: 321 tttgactcaagatcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcgg 380 || ||||| || ||||||||||||| ||| |||| |||||| |||||||||||||||||| Sbjct: 922 ttggactcgaggtcccagatcttgacggagtcctctgtcgcggcgcagagccagtagcgg 863 Query: 381 ttcggcgagaa 391 || |||||||| Sbjct: 862 ttgggcgagaa 852
>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23, complete sequence Length = 191765 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Plus Query: 303 aggtcctgcacgatgtgctttgactcaagatcccagatcttgatggaatcctgtgtcgcc 362 |||||||||| || | |||| ||||| || ||||||||||||| ||| |||| |||||| Sbjct: 115569 aggtcctgcatgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcg 115628 Query: 363 gcgcagagccagtagcggttcggcgagaa 391 |||||||||||||||||||| |||||||| Sbjct: 115629 gcgcagagccagtagcggttgggcgagaa 115657 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 114376 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 114435 Query: 261 cagtagagcatct 273 ||||| ||||||| Sbjct: 114436 cagtacagcatct 114448
>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03, complete sequence Length = 177861 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Plus Query: 303 aggtcctgcacgatgtgctttgactcaagatcccagatcttgatggaatcctgtgtcgcc 362 |||||||||| || | |||| ||||| || ||||||||||||| ||| |||| |||||| Sbjct: 171997 aggtcctgcatgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcg 172056 Query: 363 gcgcagagccagtagcggttcggcgagaa 391 |||||||||||||||||||| |||||||| Sbjct: 172057 gcgcagagccagtagcggttgggcgagaa 172085 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 170804 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 170863 Query: 261 cagtagagcatct 273 ||||| ||||||| Sbjct: 170864 cagtacagcatct 170876
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 89.7 bits (45), Expect = 9e-15 Identities = 78/89 (87%) Strand = Plus / Plus Query: 303 aggtcctgcacgatgtgctttgactcaagatcccagatcttgatggaatcctgtgtcgcc 362 |||||||||| || | |||| ||||| || ||||||||||||| ||| |||| |||||| Sbjct: 27240601 aggtcctgcatgacgagcttggactcgaggtcccagatcttgacggagtcctctgtcgcg 27240660 Query: 363 gcgcagagccagtagcggttcggcgagaa 391 |||||||||||||||||||| |||||||| Sbjct: 27240661 gcgcagagccagtagcggttgggcgagaa 27240689 Score = 73.8 bits (37), Expect = 6e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 201 gttccatcagtgtaaccagcatagagagtgctgccatccgcgctccagctcaagcaagtg 260 |||||||||||||| ||||| |||| ||||||||||| |||||||||||||| | ||| Sbjct: 27239408 gttccatcagtgtagccagcgaagagggtgctgccatcagcgctccagctcaaacttgtg 27239467 Query: 261 cagtagagcatct 273 ||||| ||||||| Sbjct: 27239468 cagtacagcatct 27239480
>emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subunit-like protein (gbl gene) Length = 1259 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 405 ataatggatcccgcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaa 464 |||||||| || ||||| || ||||| |||||||| ||||| | |||||||||||||||| Sbjct: 753 ataatggaaccagcatcaagagagtaaagtctctttccctcagccaaatcccacagcaaa 694 Query: 465 gtgacgccatccttgccaccagaggcgcagagtgaacc 502 | || ||||| || |||||||| || ||||| ||||| Sbjct: 693 atcactccatctttcccaccagaagcacagagagaacc 656
>gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like mRNA, complete cds Length = 1098 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 417 gcatccagcgagtagagtctcttgccctcggtcaaatcccacagcaaagtgacgccatcc 476 ||||| |||||||||||| |||||||||| | ||||||||| |||||| | || |||||| Sbjct: 777 gcatcaagcgagtagagtttcttgccctcagccaaatcccagagcaaaataactccatcc 718 Query: 477 ttgcc 481 ||||| Sbjct: 717 ttgcc 713
>emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein beta subunit-like polypeptide Length = 2314 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 333 tcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaa 391 ||||||||||||||||| ||| || || ||||| |||||||||||||| |||||||| Sbjct: 1636 tcccagatcttgatggaggactgggtggcggcgcacagccagtagcggttgggcgagaa 1578
>gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like polypeptide (cblP) mRNA, partial cds Length = 843 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 333 tcccagatcttgatggaatcctgtgtcgccgcgcagagccagtagcggttcggcgagaa 391 ||||||||||||||||| ||| || || ||||| |||||||||||||| |||||||| Sbjct: 794 tcccagatcttgatggaggactgggtggcggcgcacagccagtagcggttgggcgagaa 736
>emb|BX067788.1|CNS09OGW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 230 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgataat 409 |||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 158 cgcacagccagtagcggttgggcgagaagcacagtgcgttgataat 203
>gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence Length = 1324 Score = 48.1 bits (24), Expect = 0.032 Identities = 51/60 (85%) Strand = Plus / Minus Query: 426 gagtagagtctcttgccctcggtcaaatcccacagcaaagtgacgccatccttgccacca 485 |||||||| |||| ||||| | ||||||||| |||||| | || ||||||||||||||| Sbjct: 770 gagtagagcttcttcccctcagccaaatcccagagcaaaataactccatccttgccacca 711
>emb|BX019636.1|CNS08NBC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 48.1 bits (24), Expect = 0.032 Identities = 39/44 (88%) Strand = Plus / Minus Query: 363 gcgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 ||||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 855 gcgcacagccagtagcggttgggcgagaagcacagtgcgttgat 812
>gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) gene, complete cds Length = 2925 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 473 atccttgccaccagaggcgcagag 496 |||||||||||||||||||||||| Sbjct: 1718 atccttgccaccagaggcgcagag 1695
>gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) mRNA, complete cds Length = 1427 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 473 atccttgccaccagaggcgcagag 496 |||||||||||||||||||||||| Sbjct: 728 atccttgccaccagaggcgcagag 705
>dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein, complete cds Length = 1115 Score = 48.1 bits (24), Expect = 0.032 Identities = 51/60 (85%) Strand = Plus / Minus Query: 426 gagtagagtctcttgccctcggtcaaatcccacagcaaagtgacgccatccttgccacca 485 |||||||| |||| ||||| | ||||||||| |||||| | || ||||||||||||||| Sbjct: 735 gagtagagcttcttcccctcagccaaatcccagagcaaaataactccatccttgccacca 676
>dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta like WD repeat protein, complete cds Length = 1796 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Minus Query: 474 tccttgccaccagaggcgcagagtgaaccgtc 505 |||||||||||||||||||| || |||||||| Sbjct: 1221 tccttgccaccagaggcgcacagagaaccgtc 1190
>gb|U49437.1|BGU49437 Biomphalaria glabrata RACK mRNA, complete cds Length = 1235 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 474 tccttgccaccagaggcgcagagtgaaccgtctgg 508 |||||||||||||||||||| || || |||||||| Sbjct: 699 tccttgccaccagaggcgcacagcgagccgtctgg 665
>emb|BX053466.1|CNS09DF2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 318 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 360
>emb|BX053465.1|CNS09DF1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 855 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 813
>emb|BX053355.1|CNS09DBZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX053354.1|CNS09DBY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 843 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 801
>emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX024636.1|CNS08R68 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 830 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 788
>emb|BX072073.1|CNS09RRX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 453 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 307 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 349
>emb|BX071929.1|CNS09RNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX071928.1|CNS09RNW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1065 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX071907.1|CNS09RNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 293 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 335
>emb|BX071775.1|CNS09RJN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 299 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 341
>emb|BX071774.1|CNS09RJM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 851 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 809
>emb|BX071717.1|CNS09RI1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX071716.1|CNS09RI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX071585.1|CNS09RED Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 308 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 350
>emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 287 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 329
>emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 840 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 798
>emb|BX071037.1|CNS09QZ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 839 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 797
>emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 303 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 345
>emb|BX070941.1|CNS09QWH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX070940.1|CNS09QWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 838 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 796
>emb|BX070678.1|CNS09QP6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 285 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 327
>emb|BX070378.1|CNS09QGU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 839 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 797
>emb|BX070186.1|CNS09QBI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 385 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 158 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 200
>emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 290 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 332
>emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 839 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 797
>emb|BX069810.1|CNS09Q12 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 286 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 328
>emb|BX069809.1|CNS09Q11 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 834 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 792
>emb|BX069778.1|CNS09Q06 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 328 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 158 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 200
>emb|BX069777.1|CNS09Q05 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 849 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 807
>emb|BX069457.1|CNS09PR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 860 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 818
>emb|BX069079.1|CNS09PGR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX069078.1|CNS09PGQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 874 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 832
>emb|BX068759.1|CNS09P7V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 318 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 360
>emb|BX068758.1|CNS09P7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 856 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 814
>emb|BX068670.1|CNS09P5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 867 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 837 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 795
>emb|BX068658.1|CNS09P52 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 312 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 354
>emb|BX068657.1|CNS09P51 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 852 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 810
>emb|BX068642.1|CNS09P4M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 298 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 340
>emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 851 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 809
>emb|BX068364.1|CNS09OWW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 263 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 305
>emb|BX068249.1|CNS09OTP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 713 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 235 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 277
>emb|BX068234.1|CNS09OTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 323 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 365
>emb|BX068233.1|CNS09OT9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 852 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 810
>emb|BX068228.1|CNS09OT4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 293 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 335
>emb|BX068198.1|CNS09OSA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 274 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 316
>emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 843 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 801
>emb|BX068108.1|CNS09OPS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX068107.1|CNS09OPR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX068050.1|CNS09OO6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 310 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 352
>emb|BX068049.1|CNS09OO5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 853 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 811
>emb|BX068035.1|CNS09ONR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 760 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 718
>emb|BX068018.1|CNS09ONA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 829 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 300 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 342
>emb|BX068017.1|CNS09ON9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 852 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 810
>emb|BX067955.1|CNS09OLJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 317 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 236 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 278
>emb|BX067894.1|CNS09OJU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 282 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 324
>emb|BX067874.1|CNS09OJA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 739 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 697
>emb|BX067850.1|CNS09OIM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 292 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 334
>emb|BX067849.1|CNS09OIL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX067804.1|CNS09OHC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 293 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 335
>emb|BX067803.1|CNS09OHB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 936 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 847 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 805
>emb|BX067787.1|CNS09OGV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 839 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 797
>emb|BX067705.1|CNS09OEL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX067646.1|CNS09OCY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX067645.1|CNS09OCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 838 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 796
>emb|BX067635.1|CNS09OCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX067585.1|CNS09OB9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 464 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 297 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 339
>emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 904 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 862
>emb|BX067492.1|CNS09O8O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX067491.1|CNS09O8N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 836 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 794
>emb|BX066978.1|CNS09NUE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 807 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 765
>emb|BX066951.1|CNS09NTN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 318 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 360
>emb|BX066950.1|CNS09NTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1026 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 866 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 824
>emb|BX066945.1|CNS09NTH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 425 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 302 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 344
>emb|BX066944.1|CNS09NTG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX066941.1|CNS09NTD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 877 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 306 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 348
>emb|BX066940.1|CNS09NTC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 551 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 509
>emb|BX066917.1|CNS09NSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 312 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 354
>emb|BX066916.1|CNS09NSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 844 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 802
>emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 852 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 810
>emb|BX066716.1|CNS09NN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 240 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 158 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 200
>emb|BX066638.1|CNS09NKY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 314 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 356
>emb|BX066637.1|CNS09NKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1056 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 851 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 809
>emb|BX066110.1|CNS09N6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 298 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 340
>emb|BX066109.1|CNS09N69 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1000 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 835 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 793
>emb|BX066047.1|CNS09N4J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 341 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 158 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 200
>emb|BX066046.1|CNS09N4I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX065996.1|CNS09N34 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 553 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 511
>emb|BX065949.1|CNS09N1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 295 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 337
>emb|BX065948.1|CNS09N1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 904 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 862
>emb|BX065904.1|CNS09N0K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 314 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 356
>emb|BX065815.1|CNS09MY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 305 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 347
>emb|BX065814.1|CNS09MY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX065711.1|CNS09MV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 633 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 289 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 331
>emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 838 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 796
>emb|BX065604.1|CNS09MS8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1041 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 835 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 793
>emb|BX065506.1|CNS09MPI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 309 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 351
>emb|BX065505.1|CNS09MPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 995 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 295 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 337
>emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 842 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 800
>emb|BX065353.1|CNS09ML9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 871 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 842 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 800
>emb|BX065157.1|CNS09MFT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 548 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 506
>emb|BX065023.1|CNS09MC3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 325 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 260 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 302
>emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 809 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 767
>emb|BX064965.1|CNS09MAH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 283 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 325
>emb|BX064964.1|CNS09MAG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 813 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 771
>emb|BX064854.1|CNS09M7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 201 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 243
>emb|BX064853.1|CNS09M7D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 902 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 744 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 702
>emb|BX064529.1|CNS09LYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 287 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 329
>emb|BX064405.1|CNS09LUX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 321 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 363
>emb|BX064360.1|CNS09LTO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 858 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 816
>emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 299 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 341
>emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1037 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX064233.1|CNS09LQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX064232.1|CNS09LQ4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 848 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 806
>emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 840 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 798
>emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 282 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 324
>emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX063936.1|CNS09LHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 839 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 797
>emb|BX063919.1|CNS09LHF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 324 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 366
>emb|BX063918.1|CNS09LHE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1040 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 858 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 816
>emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 851 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 809
>emb|BX063359.1|CNS09L1V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 285 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 327
>emb|BX063358.1|CNS09L1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 815 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 773
>emb|BX063357.1|CNS09L1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 274 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 316
>emb|BX063356.1|CNS09L1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 819 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 777
>emb|BX063204.1|CNS09KXK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 302 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 344
>emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX063052.1|CNS09KTC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX063051.1|CNS09KTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 774 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 732
>emb|BX063016.1|CNS09KSC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 589 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 316 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 358
>emb|BX063014.1|CNS09KSA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 530 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 316 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 358
>emb|BX062938.1|CNS09KQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 517 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 288 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 330
>emb|BX062802.1|CNS09KME Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 612 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 310 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 352
>emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 289 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 331
>emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 830 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 788
>emb|BX062775.1|CNS09KLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 291 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 333
>emb|BX062774.1|CNS09KLM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 840 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 798
>emb|BX062707.1|CNS09KJR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 293 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 335
>emb|BX062706.1|CNS09KJQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 741 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 699
>emb|BX062617.1|CNS09KH9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 294 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 336
>emb|BX062616.1|CNS09KH8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 831 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 789
>emb|BX062615.1|CNS09KH7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 298 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 340
>emb|BX062614.1|CNS09KH6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1062 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 830 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 788
>emb|BX062265.1|CNS09K7H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 291 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 333
>emb|BX062264.1|CNS09K7G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 801 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 759
>emb|BX062196.1|CNS09K5K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 289 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 331
>emb|BX062195.1|CNS09K5J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1076 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 837 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 795
>emb|BX062152.1|CNS09K4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1028 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX062151.1|CNS09K4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1094 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 835 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 793
>emb|BX062132.1|CNS09K3S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 300 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 342
>emb|BX062131.1|CNS09K3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1080 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 835 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 793
>emb|BX062052.1|CNS09K1K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 418 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 287 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 329
>emb|BX061984.1|CNS09JZO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 703 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 305 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 347
>emb|BX061983.1|CNS09JZN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX061962.1|CNS09JZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX061961.1|CNS09JZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 831 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 789
>emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 288 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 330
>emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 834 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 792
>emb|BX061867.1|CNS09JWF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 297 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 339
>emb|BX061866.1|CNS09JWE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 834 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 792
>emb|BX061808.1|CNS09JUS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 283 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 325
>emb|BX061807.1|CNS09JUR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 832 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 790
>emb|BX061804.1|CNS09JUO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 286 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 328
>emb|BX061803.1|CNS09JUN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 841 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 799
>emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 290 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 332
>emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 832 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 790
>emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1013 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 861 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 819
>emb|BX061589.1|CNS09JOP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 298 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 340
>emb|BX061588.1|CNS09JOO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 837 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 795
>emb|BX061562.1|CNS09JNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 301 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 343
>emb|BX061561.1|CNS09JNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 845 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 803
>emb|BX061522.1|CNS09JMU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX061521.1|CNS09JMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 830 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 788
>emb|BX061174.1|CNS09JD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 261 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 303
>emb|BX061173.1|CNS09JD5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 731 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 689
>emb|BX060748.1|CNS09J1C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 277 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 319
>emb|BX060747.1|CNS09J1B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 818 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 776
>emb|BX060414.1|CNS09IS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 291 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 333
>emb|BX060410.1|CNS09IRY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 306 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 348
>emb|BX060409.1|CNS09IRX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1056 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 852 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 810
>emb|BX060393.1|CNS09IRH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 288 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 330
>emb|BX060392.1|CNS09IRG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 829 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 787
>emb|BX060282.1|CNS09IOE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 605 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 298 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 340
>emb|BX060281.1|CNS09IOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 810 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 768
>emb|BX060076.1|CNS09IIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 757 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 715
>emb|BX060049.1|CNS09IHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 291 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 333
>emb|BX060048.1|CNS09IHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 832 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 790
>emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 815 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 773
>emb|BX059637.1|CNS09I6H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX059608.1|CNS09I5O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 560 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 517 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 475
>emb|BX059419.1|CNS09I0F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 294 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 336
>emb|BX059418.1|CNS09I0E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 846 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 804
>emb|BX059402.1|CNS09HZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX059401.1|CNS09HZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 888 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 846
>emb|BX059380.1|CNS09HZC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 308 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 350
>emb|BX059379.1|CNS09HZB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 842 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 800
>emb|BX059205.1|CNS09HUH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 285 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 327
>emb|BX059204.1|CNS09HUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 838 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 796
>emb|BX059163.1|CNS09HTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 289 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 331
>emb|BX059162.1|CNS09HTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 836 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 794
>emb|BX059100.1|CNS09HRK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 300 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 342
>emb|BX059099.1|CNS09HRJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 848 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 806
>emb|BX059084.1|CNS09HR4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 296 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 338
>emb|BX059083.1|CNS09HR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX058995.1|CNS09HON Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 286 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 328
>emb|BX058994.1|CNS09HOM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 837 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 833 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 791
>emb|BX058960.1|CNS09HNO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 285 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 327
>emb|BX058959.1|CNS09HNN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 830 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 788
>emb|BX058601.1|CNS09HDP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 828 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 786
>emb|BX058573.1|CNS09HCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 697 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 256 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 298
>emb|BX058506.1|CNS09HB2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 671 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 304 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 346
>emb|BX058489.1|CNS09HAL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 299 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 341
>emb|BX058488.1|CNS09HAK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 860 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 818
>emb|BX058259.1|CNS09H47 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 364 cgcagagccagtagcggttcggcgagaaacaaagtgagttgat 406 |||| |||||||||||||| |||||||| || |||| |||||| Sbjct: 820 cgcacagccagtagcggttgggcgagaagcacagtgcgttgat 778 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,784,755 Number of Sequences: 3902068 Number of extensions: 3784755 Number of successful extensions: 151065 Number of sequences better than 10.0: 1233 Number of HSP's better than 10.0 without gapping: 1233 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 148500 Number of HSP's gapped (non-prelim): 2556 length of query: 571 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 548 effective length of database: 17,143,297,704 effective search space: 9394527141792 effective search space used: 9394527141792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
