ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags37a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY103621.1| Zea mays PCO154872 mRNA sequence 543 e-151
2dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clon... 480 e-132
3gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence 476 e-131
4gb|AY103768.1| Zea mays PCO155588 mRNA sequence 464 e-127
5gb|BT016199.1| Zea mays clone Contig32 mRNA sequence 440 e-120
6gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence 402 e-109
7ref|NM_191253.1| Oryza sativa (japonica cultivar-group), predic... 351 2e-93
8dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clon... 351 2e-93
9ref|NM_191921.1| Oryza sativa (japonica cultivar-group), predic... 325 1e-85
10gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site fla... 293 4e-76
11ref|NM_129000.2| Arabidopsis thaliana structural constituent of ... 274 3e-70
12gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (... 274 3e-70
13gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (... 274 3e-70
14emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Co... 274 3e-70
15emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Co... 274 3e-70
16gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome... 272 1e-69
17dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 272 1e-69
18gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds 268 2e-68
19gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, comple... 268 2e-68
20dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal prot... 262 1e-66
21ref|NM_112321.2| Arabidopsis thaliana structural constituent of ... 254 3e-64
22gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, comp... 254 3e-64
23gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, comp... 254 3e-64
24emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Co... 240 5e-60
25dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 228 2e-56
26dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic D... 228 2e-56
27gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete se... 222 1e-54
28gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL... 198 2e-47
29gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA 186 6e-44
30dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic D... 182 9e-43
31dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic D... 182 9e-43
32gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA 178 1e-41
33gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA 178 1e-41
34ref|NM_179398.1| Arabidopsis thaliana structural constituent of ... 168 1e-38
35gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, ... 168 1e-38
36gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, ... 168 1e-38
37emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Co... 168 1e-38
38dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 165 2e-37
39gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence 157 5e-35
40gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 139 1e-29
41gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 139 1e-29
42gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA... 129 1e-26
43dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
44gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, comp... 107 4e-20
45gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 103 7e-19
46emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Co... 88 4e-14
47gb|BT016634.1| Zea mays clone Contig467 mRNA sequence 86 2e-13
48gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRN... 76 2e-10
49gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete seq... 66 2e-07
50emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-38... 66 2e-07
51ref|XM_505817.1| Yarrowia lipolytica CLIB122, YALI0F24123g predi... 60 9e-06
52emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 60 9e-06
53gb|AY961480.1| Phytophthora infestans clone MY-22-C-06 ribosomal... 58 4e-05
54ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal... 56 1e-04
55ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA 56 1e-04
56gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, ... 56 1e-04
57gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Ca... 56 1e-04
58gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNI... 56 1e-04
59gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNI... 56 1e-04
60gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNI... 56 1e-04
61gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA c... 56 1e-04
62gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA c... 56 1e-04
63emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (... 56 1e-04
64emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta ... 56 1e-04
65emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liv... 56 1e-04
66emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta ... 56 1e-04
67emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (... 56 1e-04
68emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblas... 56 1e-04
69emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblas... 56 1e-04
70emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblas... 56 1e-04
71emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblas... 56 1e-04
72emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblas... 56 1e-04
73emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta ... 56 1e-04
74ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a;... 56 1e-04
75ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
76ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
77ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
78ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
79ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
80ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
81ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
82ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal pr... 56 1e-04
83dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a var... 56 1e-04
84gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complet... 56 1e-04
85gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA,... 56 1e-04
86dbj|AB180445.1| Plutella xylostella mRNA for Ribosomal protein L... 56 1e-04
87gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA c... 56 1e-04
88gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, ... 56 1e-04
89emb|X80822.1|HSPLORF H.sapiens mRNA for ORF 56 1e-04
90gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence 54 6e-04
91gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence 54 6e-04
92gb|AY048752.1| Blastocystis hominis RAPD fragment 54 6e-04
93emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-... 54 6e-04
94emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-... 54 6e-04
95emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-... 54 6e-04
96emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-... 54 6e-04
97emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-... 54 6e-04
98emb|BX071198.1|CNS09R3M Single read from an extremity of a full-... 54 6e-04
99emb|BX071197.1|CNS09R3L Single read from an extremity of a full-... 54 6e-04
100emb|BX071326.1|CNS09R76 Single read from an extremity of a full-... 54 6e-04
101emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-... 54 6e-04
102emb|BX071021.1|CNS09QYP Single read from an extremity of a full-... 54 6e-04
103emb|BX070958.1|CNS09QWY Single read from an extremity of a full-... 54 6e-04
104emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-... 54 6e-04
105emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-... 54 6e-04
106emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-... 54 6e-04
107emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-... 54 6e-04
108emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-... 54 6e-04
109emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-... 54 6e-04
110emb|BX060940.1|CNS09J6O Single read from an extremity of a full-... 54 6e-04
111emb|BX060939.1|CNS09J6N Single read from an extremity of a full-... 54 6e-04
112emb|BX069369.1|CNS09POT Single read from an extremity of a full-... 54 6e-04
113emb|BX069368.1|CNS09POS Single read from an extremity of a full-... 54 6e-04
114emb|BX069214.1|CNS09PKI Single read from an extremity of a full-... 54 6e-04
115emb|BX069213.1|CNS09PKH Single read from an extremity of a full-... 54 6e-04
116emb|BX068918.1|CNS09PCA Single read from an extremity of a full-... 54 6e-04
117emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-... 54 6e-04
118emb|BX068781.1|CNS09P8H Single read from an extremity of a full-... 54 6e-04
119emb|BX068780.1|CNS09P8G Single read from an extremity of a full-... 54 6e-04
120emb|BX068699.1|CNS09P67 Single read from an extremity of a full-... 54 6e-04
121emb|BX068698.1|CNS09P66 Single read from an extremity of a full-... 54 6e-04
122emb|BX068685.1|CNS09P5T Single read from an extremity of a full-... 54 6e-04
123emb|BX068632.1|CNS09P4C Single read from an extremity of a full-... 54 6e-04
124emb|BX068631.1|CNS09P4B Single read from an extremity of a full-... 54 6e-04
125emb|BX068389.1|CNS09OXL Single read from an extremity of a full-... 54 6e-04
126emb|BX068343.1|CNS09OWB Single read from an extremity of a full-... 54 6e-04
127emb|BX068342.1|CNS09OWA Single read from an extremity of a full-... 54 6e-04
128emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-... 54 6e-04
129emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-... 54 6e-04
130emb|BX068271.1|CNS09OUB Single read from an extremity of a full-... 54 6e-04
131emb|BX068270.1|CNS09OUA Single read from an extremity of a full-... 54 6e-04
132emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-... 54 6e-04
133emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-... 54 6e-04
134emb|BX068004.1|CNS09OMW Single read from an extremity of a full-... 54 6e-04
135emb|BX068003.1|CNS09OMV Single read from an extremity of a full-... 54 6e-04
136emb|BX067731.1|CNS09OFB Single read from an extremity of a full-... 54 6e-04
137emb|BX067730.1|CNS09OFA Single read from an extremity of a full-... 54 6e-04
138emb|BX067102.1|CNS09NXU Single read from an extremity of a full-... 54 6e-04
139emb|BX067101.1|CNS09NXT Single read from an extremity of a full-... 54 6e-04
140emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-... 54 6e-04
141emb|BX066998.1|CNS09NUY Single read from an extremity of a full-... 54 6e-04
142emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-... 54 6e-04
143emb|BX066843.1|CNS09NQN Single read from an extremity of a full-... 54 6e-04
144emb|BX066842.1|CNS09NQM Single read from an extremity of a full-... 54 6e-04
145emb|BX066697.1|CNS09NML Single read from an extremity of a full-... 54 6e-04
146emb|BX066444.1|CNS09NFK Single read from an extremity of a full-... 54 6e-04
147emb|BX065769.1|CNS09MWT Single read from an extremity of a full-... 54 6e-04
148emb|BX065768.1|CNS09MWS Single read from an extremity of a full-... 54 6e-04
149emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-... 54 6e-04
150emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-... 54 6e-04
151emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-... 54 6e-04
152emb|BX065287.1|CNS09MJF Single read from an extremity of a full-... 54 6e-04
153emb|BX065286.1|CNS09MJE Single read from an extremity of a full-... 54 6e-04
154emb|BX065104.1|CNS09MEC Single read from an extremity of a full-... 54 6e-04
155emb|BX065103.1|CNS09MEB Single read from an extremity of a full-... 54 6e-04
156emb|BX065085.1|CNS09MDT Single read from an extremity of a full-... 54 6e-04
157emb|BX065080.1|CNS09MDO Single read from an extremity of a full-... 54 6e-04
158emb|BX065079.1|CNS09MDN Single read from an extremity of a full-... 54 6e-04
159emb|BX065033.1|CNS09MCD Single read from an extremity of a full-... 54 6e-04
160emb|BX065032.1|CNS09MCC Single read from an extremity of a full-... 54 6e-04
161emb|BX064042.1|CNS09LKU Single read from an extremity of a full-... 54 6e-04
162emb|BX064041.1|CNS09LKT Single read from an extremity of a full-... 54 6e-04
163emb|BX063680.1|CNS09LAS Single read from an extremity of a full-... 54 6e-04
164emb|BX063679.1|CNS09LAR Single read from an extremity of a full-... 54 6e-04
165emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-... 54 6e-04
166emb|BX063630.1|CNS09L9E Single read from an extremity of a full-... 54 6e-04
167emb|BX063629.1|CNS09L9D Single read from an extremity of a full-... 54 6e-04
168emb|BX063028.1|CNS09KSO Single read from an extremity of a full-... 54 6e-04
169emb|BX063027.1|CNS09KSN Single read from an extremity of a full-... 54 6e-04
170emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-... 54 6e-04
171emb|BX062913.1|CNS09KPH Single read from an extremity of a full-... 54 6e-04
172emb|BX062912.1|CNS09KPG Single read from an extremity of a full-... 54 6e-04
173emb|BX062805.1|CNS09KMH Single read from an extremity of a full-... 54 6e-04
174emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-... 54 6e-04
175emb|BX062625.1|CNS09KHH Single read from an extremity of a full-... 54 6e-04
176emb|BX062624.1|CNS09KHG Single read from an extremity of a full-... 54 6e-04
177emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-... 54 6e-04
178emb|BX062165.1|CNS09K4P Single read from an extremity of a full-... 54 6e-04
179emb|BX062118.1|CNS09K3E Single read from an extremity of a full-... 54 6e-04
180emb|BX062090.1|CNS09K2M Single read from an extremity of a full-... 54 6e-04
181emb|BX061845.1|CNS09JVT Single read from an extremity of a full-... 54 6e-04
182emb|BX061844.1|CNS09JVS Single read from an extremity of a full-... 54 6e-04
183emb|BX061453.1|CNS09JKX Single read from an extremity of a full-... 54 6e-04
184emb|BX061452.1|CNS09JKW Single read from an extremity of a full-... 54 6e-04
185emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-... 54 6e-04
186emb|BX061292.1|CNS09JGG Single read from an extremity of a full-... 54 6e-04
187emb|BX061291.1|CNS09JGF Single read from an extremity of a full-... 54 6e-04
188emb|BX061184.1|CNS09JDG Single read from an extremity of a full-... 54 6e-04
189emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-... 54 6e-04
190emb|BX060315.1|CNS09IPB Single read from an extremity of a full-... 54 6e-04
191emb|BX060314.1|CNS09IPA Single read from an extremity of a full-... 54 6e-04
192emb|BX060072.1|CNS09IIK Single read from an extremity of a full-... 54 6e-04
193emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-... 54 6e-04
194emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-... 54 6e-04
195emb|BX059598.1|CNS09I5E Single read from an extremity of a full-... 54 6e-04
196emb|BX059597.1|CNS09I5D Single read from an extremity of a full-... 54 6e-04
197emb|BX059276.1|CNS09HWG Single read from an extremity of a full-... 54 6e-04
198emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-... 54 6e-04
199emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-... 54 6e-04
200emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-... 54 6e-04
201emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-... 54 6e-04
202emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-... 54 6e-04
203emb|BX058808.1|CNS09HJG Single read from an extremity of a full-... 54 6e-04
204emb|BX058807.1|CNS09HJF Single read from an extremity of a full-... 54 6e-04
205emb|BX058560.1|CNS09HCK Single read from an extremity of a full-... 54 6e-04
206emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-... 54 6e-04
207emb|BX058281.1|CNS09H4T Single read from an extremity of a full-... 54 6e-04
208emb|BX058280.1|CNS09H4S Single read from an extremity of a full-... 54 6e-04
209emb|BX058269.1|CNS09H4H Single read from an extremity of a full-... 54 6e-04
210emb|BX056753.1|CNS09FYD Single read from an extremity of a full-... 54 6e-04
211emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-... 54 6e-04
212emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-... 54 6e-04
213emb|BX057958.1|CNS09GVU Single read from an extremity of a full-... 54 6e-04
214emb|BX056891.1|CNS09G27 Single read from an extremity of a full-... 54 6e-04
215emb|BX056571.1|CNS09FTB Single read from an extremity of a full-... 54 6e-04
216emb|BX056553.1|CNS09FST Single read from an extremity of a full-... 54 6e-04
217emb|BX056552.1|CNS09FSS Single read from an extremity of a full-... 54 6e-04
218emb|BX056479.1|CNS09FQR Single read from an extremity of a full-... 54 6e-04
219emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-... 54 6e-04
220emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-... 54 6e-04
221emb|BX056040.1|CNS09FEK Single read from an extremity of a full-... 54 6e-04
222emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-... 54 6e-04
223emb|BX055724.1|CNS09F5S Single read from an extremity of a full-... 54 6e-04
224emb|BX055723.1|CNS09F5R Single read from an extremity of a full-... 54 6e-04
225emb|BX055717.1|CNS09F5L Single read from an extremity of a full-... 54 6e-04
226emb|BX055643.1|CNS09F3J Single read from an extremity of a full-... 54 6e-04
227emb|BX055642.1|CNS09F3I Single read from an extremity of a full-... 54 6e-04
228emb|BX055566.1|CNS09F1E Single read from an extremity of a full-... 54 6e-04
229emb|BX055565.1|CNS09F1D Single read from an extremity of a full-... 54 6e-04
230emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-... 54 6e-04
231emb|BX055541.1|CNS09F0P Single read from an extremity of a full-... 54 6e-04
232emb|BX055478.1|CNS09EYY Single read from an extremity of a full-... 54 6e-04
233emb|BX055405.1|CNS09EWX Single read from an extremity of a full-... 54 6e-04
234emb|BX055404.1|CNS09EWW Single read from an extremity of a full-... 54 6e-04
235emb|BX055221.1|CNS09ERT Single read from an extremity of a full-... 54 6e-04
236emb|BX053165.1|CNS09D6P Single read from an extremity of a full-... 54 6e-04
237emb|BX055118.1|CNS09EOY Single read from an extremity of a full-... 54 6e-04
238emb|BX054551.1|CNS09E97 Single read from an extremity of a full-... 54 6e-04
239emb|BX054550.1|CNS09E96 Single read from an extremity of a full-... 54 6e-04
240emb|BX054490.1|CNS09E7I Single read from an extremity of a full-... 54 6e-04
241emb|BX054489.1|CNS09E7H Single read from an extremity of a full-... 54 6e-04
242emb|BX054096.1|CNS09DWK Single read from an extremity of a full-... 54 6e-04
243emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-... 54 6e-04
244emb|BX053786.1|CNS09DNY Single read from an extremity of a full-... 54 6e-04
245emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-... 54 6e-04
246emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-... 54 6e-04
247emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-... 54 6e-04
248emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-... 54 6e-04
249emb|BX052629.1|CNS09CRT Single read from an extremity of a full-... 54 6e-04
250emb|BX052628.1|CNS09CRS Single read from an extremity of a full-... 54 6e-04
251emb|BX052573.1|CNS09CQ9 Single read from an extremity of a full-... 54 6e-04
252emb|BX052572.1|CNS09CQ8 Single read from an extremity of a full-... 54 6e-04
253emb|BX052510.1|CNS09COI Single read from an extremity of a full-... 54 6e-04
254emb|BX052509.1|CNS09COH Single read from an extremity of a full-... 54 6e-04
255emb|BX052467.1|CNS09CNB Single read from an extremity of a full-... 54 6e-04
256emb|BX052466.1|CNS09CNA Single read from an extremity of a full-... 54 6e-04
257emb|BX052004.1|CNS09CAG Single read from an extremity of a full-... 54 6e-04
258emb|BX051855.1|CNS09C6B Single read from an extremity of a full-... 54 6e-04
259emb|BX051854.1|CNS09C6A Single read from an extremity of a full-... 54 6e-04
260emb|BX050971.1|CNS09BHR Single read from an extremity of a full-... 54 6e-04
261emb|BX050970.1|CNS09BHQ Single read from an extremity of a full-... 54 6e-04
262emb|BX050606.1|CNS09B7M Single read from an extremity of a full-... 54 6e-04
263emb|BX050495.1|CNS09B4J Single read from an extremity of a full-... 54 6e-04
264emb|BX050494.1|CNS09B4I Single read from an extremity of a full-... 54 6e-04
265emb|BX049990.1|CNS09AQI Single read from an extremity of a full-... 54 6e-04
266emb|BX049989.1|CNS09AQH Single read from an extremity of a full-... 54 6e-04
267emb|BX049718.1|CNS09AIY Single read from an extremity of a full-... 54 6e-04
268emb|BX049717.1|CNS09AIX Single read from an extremity of a full-... 54 6e-04
269emb|BX031004.1|CNS08W34 Single read from an extremity of a full-... 54 6e-04
270emb|BX031003.1|CNS08W33 Single read from an extremity of a full-... 54 6e-04
271emb|BX049059.1|CNS09A0N Single read from an extremity of a full-... 54 6e-04
272emb|BX049058.1|CNS09A0M Single read from an extremity of a full-... 54 6e-04
273emb|BX048922.1|CNS099WU Single read from an extremity of a full-... 54 6e-04
274emb|BX048811.1|CNS099TR Single read from an extremity of a full-... 54 6e-04
275emb|BX048769.1|CNS099SL Single read from an extremity of a full-... 54 6e-04
276emb|BX048695.1|CNS099QJ Single read from an extremity of a full-... 54 6e-04
277emb|BX048134.1|CNS099AY Single read from an extremity of a full-... 54 6e-04
278emb|BX048132.1|CNS099AW Single read from an extremity of a full-... 54 6e-04
279emb|BX048121.1|CNS099AL Single read from an extremity of a full-... 54 6e-04
280emb|BX048120.1|CNS099AK Single read from an extremity of a full-... 54 6e-04
281emb|BX047754.1|CNS0990E Single read from an extremity of a full-... 54 6e-04
282emb|BX047478.1|CNS098SQ Single read from an extremity of a full-... 54 6e-04
283emb|BX047279.1|CNS098N7 Single read from an extremity of a full-... 54 6e-04
284emb|BX047217.1|CNS098LH Single read from an extremity of a full-... 54 6e-04
285emb|BX047216.1|CNS098LG Single read from an extremity of a full-... 54 6e-04
286emb|BX047156.1|CNS098JS Single read from an extremity of a full-... 54 6e-04
287emb|BX047155.1|CNS098JR Single read from an extremity of a full-... 54 6e-04
288emb|BX047001.1|CNS098FH Single read from an extremity of a full-... 54 6e-04
289emb|BX047000.1|CNS098FG Single read from an extremity of a full-... 54 6e-04
290emb|BX046876.1|CNS098C0 Single read from an extremity of a full-... 54 6e-04
291emb|BX046875.1|CNS098BZ Single read from an extremity of a full-... 54 6e-04
292emb|BX046690.1|CNS0986U Single read from an extremity of a full-... 54 6e-04
293emb|BX046325.1|CNS097WP Single read from an extremity of a full-... 54 6e-04
294emb|BX046324.1|CNS097WO Single read from an extremity of a full-... 54 6e-04
295emb|BX045863.1|CNS097JV Single read from an extremity of a full-... 54 6e-04
296emb|BX045862.1|CNS097JU Single read from an extremity of a full-... 54 6e-04
297emb|BX045772.1|CNS097HC Single read from an extremity of a full-... 54 6e-04
298emb|BX045771.1|CNS097HB Single read from an extremity of a full-... 54 6e-04
299emb|BX045647.1|CNS097DV Single read from an extremity of a full-... 54 6e-04
300emb|BX045057.1|CNS096XH Single read from an extremity of a full-... 54 6e-04
301emb|BX045056.1|CNS096XG Single read from an extremity of a full-... 54 6e-04
302emb|BX045304.1|CNS0974C Single read from an extremity of a full-... 54 6e-04
303emb|BX043086.1|CNS095EQ Single read from an extremity of a full-... 54 6e-04
304emb|BX042914.1|CNS0959Y Single read from an extremity of a full-... 54 6e-04
305emb|BX042913.1|CNS0959X Single read from an extremity of a full-... 54 6e-04
306emb|BX044674.1|CNS096MU Single read from an extremity of a full-... 54 6e-04
307emb|BX044233.1|CNS096AL Single read from an extremity of a full-... 54 6e-04
308emb|BX044205.1|CNS0969T Single read from an extremity of a full-... 54 6e-04
309emb|BX044023.1|CNS0964R Single read from an extremity of a full-... 54 6e-04
310emb|BX044022.1|CNS0964Q Single read from an extremity of a full-... 54 6e-04
311emb|BX043402.1|CNS095NI Single read from an extremity of a full-... 54 6e-04
312emb|BX043401.1|CNS095NH Single read from an extremity of a full-... 54 6e-04
313emb|BX043362.1|CNS095ME Single read from an extremity of a full-... 54 6e-04
314emb|BX043361.1|CNS095MD Single read from an extremity of a full-... 54 6e-04
315emb|BX043340.1|CNS095LS Single read from an extremity of a full-... 54 6e-04
316emb|BX043586.1|CNS095SM Single read from an extremity of a full-... 54 6e-04
317emb|BX043158.1|CNS095GQ Single read from an extremity of a full-... 54 6e-04
318emb|BX042813.1|CNS09575 Single read from an extremity of a full-... 54 6e-04
319emb|BX042812.1|CNS09574 Single read from an extremity of a full-... 54 6e-04
320emb|BX042751.1|CNS0955F Single read from an extremity of a full-... 54 6e-04
321emb|BX042750.1|CNS0955E Single read from an extremity of a full-... 54 6e-04
322emb|BX042566.1|CNS0950A Single read from an extremity of a full-... 54 6e-04
323emb|BX042373.1|CNS094UX Single read from an extremity of a full-... 54 6e-04
324emb|BX042372.1|CNS094UW Single read from an extremity of a full-... 54 6e-04
325emb|BX042192.1|CNS094PW Single read from an extremity of a full-... 54 6e-04
326emb|BX042191.1|CNS094PV Single read from an extremity of a full-... 54 6e-04
327emb|BX042165.1|CNS094P5 Single read from an extremity of a full-... 54 6e-04
328emb|BX041829.1|CNS094FT Single read from an extremity of a full-... 54 6e-04
329emb|BX041828.1|CNS094FS Single read from an extremity of a full-... 54 6e-04
330emb|BX041998.1|CNS094KI Single read from an extremity of a full-... 54 6e-04
331emb|BX041997.1|CNS094KH Single read from an extremity of a full-... 54 6e-04
332emb|BX041981.1|CNS094K1 Single read from an extremity of a full-... 54 6e-04
333emb|BX041980.1|CNS094K0 Single read from an extremity of a full-... 54 6e-04
334emb|BX041897.1|CNS094HP Single read from an extremity of a full-... 54 6e-04
335emb|BX041495.1|CNS0946J Single read from an extremity of a full-... 54 6e-04
336emb|BX041494.1|CNS0946I Single read from an extremity of a full-... 54 6e-04
337emb|BX041371.1|CNS09433 Single read from an extremity of a full-... 54 6e-04
338emb|BX041184.1|CNS093XW Single read from an extremity of a full-... 54 6e-04
339emb|BX041092.1|CNS093VC Single read from an extremity of a full-... 54 6e-04
340emb|BX041066.1|CNS093UM Single read from an extremity of a full-... 54 6e-04
341emb|BX041065.1|CNS093UL Single read from an extremity of a full-... 54 6e-04
342emb|BX040893.1|CNS093PT Single read from an extremity of a full-... 54 6e-04
343emb|BX040892.1|CNS093PS Single read from an extremity of a full-... 54 6e-04
344emb|BX040441.1|CNS093D9 Single read from an extremity of a full-... 54 6e-04
345emb|BX040440.1|CNS093D8 Single read from an extremity of a full-... 54 6e-04
346emb|BX040328.1|CNS093A4 Single read from an extremity of a full-... 54 6e-04
347emb|BX040164.1|CNS0935K Single read from an extremity of a full-... 54 6e-04
348emb|BX039306.1|CNS092HQ Single read from an extremity of a full-... 54 6e-04
349emb|BX039245.1|CNS092G1 Single read from an extremity of a full-... 54 6e-04
350emb|BX039244.1|CNS092G0 Single read from an extremity of a full-... 54 6e-04
351emb|BX037982.1|CNS091GY Single read from an extremity of a full-... 54 6e-04
352emb|BX037981.1|CNS091GX Single read from an extremity of a full-... 54 6e-04
353emb|BX037573.1|CNS0915L Single read from an extremity of a full-... 54 6e-04
354emb|BX037572.1|CNS0915K Single read from an extremity of a full-... 54 6e-04
355emb|BX037476.1|CNS0912W Single read from an extremity of a full-... 54 6e-04
356emb|BX037438.1|CNS0911U Single read from an extremity of a full-... 54 6e-04
357emb|BX037437.1|CNS0911T Single read from an extremity of a full-... 54 6e-04
358emb|BX036707.1|CNS090HJ Single read from an extremity of a full-... 54 6e-04
359emb|BX036706.1|CNS090HI Single read from an extremity of a full-... 54 6e-04
360emb|BX034834.1|CNS08Z1I Single read from an extremity of a full-... 54 6e-04
361emb|BX034833.1|CNS08Z1H Single read from an extremity of a full-... 54 6e-04
362emb|BX034965.1|CNS08Z55 Single read from an extremity of a full-... 54 6e-04
363emb|BX034964.1|CNS08Z54 Single read from an extremity of a full-... 54 6e-04
364emb|BX033572.1|CNS08Y2G Single read from an extremity of a full-... 54 6e-04
365emb|BX033571.1|CNS08Y2F Single read from an extremity of a full-... 54 6e-04
366emb|BX029790.1|CNS08V5E Single read from an extremity of a full-... 54 6e-04
367emb|BX029758.1|CNS08V4I Single read from an extremity of a full-... 54 6e-04
368emb|BX026727.1|CNS08SSB Single read from an extremity of a full-... 54 6e-04
369emb|BX026454.1|CNS08SKQ Single read from an extremity of a full-... 54 6e-04
370emb|BX026453.1|CNS08SKP Single read from an extremity of a full-... 54 6e-04
371emb|BX026346.1|CNS08SHQ Single read from an extremity of a full-... 54 6e-04
372emb|BX024700.1|CNS08R80 Single read from an extremity of a full-... 54 6e-04
373emb|BX022475.1|CNS08PI7 Single read from an extremity of a full-... 54 6e-04
374emb|BX022474.1|CNS08PI6 Single read from an extremity of a full-... 54 6e-04
375emb|BX019551.1|CNS08N8Z Single read from an extremity of a full-... 54 6e-04
376emb|BX019550.1|CNS08N8Y Single read from an extremity of a full-... 54 6e-04
377emb|BX021913.1|CNS08P2L Single read from an extremity of a full-... 54 6e-04
378emb|BX021912.1|CNS08P2K Single read from an extremity of a full-... 54 6e-04
379emb|BX016523.1|CNS08KWV Single read from an extremity of a full-... 54 6e-04
380emb|BX016522.1|CNS08KWU Single read from an extremity of a full-... 54 6e-04
381emb|BX015088.1|CNS08JT0 Single read from an extremity of a full-... 54 6e-04
382emb|BX015087.1|CNS08JSZ Single read from an extremity of a full-... 54 6e-04
383emb|BX014828.1|CNS08JLS Single read from an extremity of a full-... 54 6e-04
384emb|BX014827.1|CNS08JLR Single read from an extremity of a full-... 54 6e-04
385emb|BX013943.1|CNS08IX7 Single read from an extremity of a full-... 54 6e-04
386emb|BX013942.1|CNS08IX6 Single read from an extremity of a full-... 54 6e-04
387emb|BX013919.1|CNS08IWJ Single read from an extremity of a full-... 54 6e-04
388emb|BX013918.1|CNS08IWI Single read from an extremity of a full-... 54 6e-04
389emb|BX013895.1|CNS08IVV Single read from an extremity of a full-... 54 6e-04
390emb|BX012162.1|CNS08HJQ Single read from an extremity of a full-... 54 6e-04
391emb|BX012161.1|CNS08HJP Single read from an extremity of a full-... 54 6e-04
392emb|BX009966.1|CNS08FUQ Single read from an extremity of a full-... 54 6e-04
393emb|BX009965.1|CNS08FUP Single read from an extremity of a full-... 54 6e-04
394emb|BX006466.1|CNS08D5I Single read from an extremity of a full-... 54 6e-04
395ref|XM_320252.2| Anopheles gambiae str. PEST ENSANGP00000016619 ... 54 6e-04
396emb|BX055477.1|CNS09EYX Single read from an extremity of a full-... 52 0.002
397emb|BX047755.1|CNS0990F Single read from an extremity of a full-... 52 0.002
398emb|BX060047.1|CNS09IHV Single read from an extremity of a full-... 50 0.009
399emb|BX060046.1|CNS09IHU Single read from an extremity of a full-... 50 0.009
400emb|BX045305.1|CNS0974D Single read from an extremity of a full-... 50 0.009
401emb|BX029759.1|CNS08V4J Single read from an extremity of a full-... 50 0.009
402gb|AC016180.14| Homo sapiens chromosome , clone RP11-553E24, com... 50 0.009
403ref|XM_938219.1| PREDICTED: Homo sapiens similar to ribosomal pr... 50 0.009
404ref|XM_926392.1| PREDICTED: Homo sapiens similar to ribosomal pr... 50 0.009
405ref|XM_520487.1| PREDICTED: Pan troglodytes similar to ribosomal... 48 0.036
406ref|XM_515461.1| PREDICTED: Pan troglodytes LOC459217 (LOC459217... 48 0.036
407ref|NM_001016690.2| Xenopus tropicalis hypothetical protein LOC5... 48 0.036
408gb|AY190708.1| Pagrus major ribosomal protein L18a mRNA, partial... 48 0.036
409ref|XM_958843.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.036
410ref|XM_881581.1| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.036
411ref|XM_881547.1| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.036
412ref|XM_581579.2| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.036
413ref|XM_881521.1| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.036
414ref|XM_329434.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.036
415ref|XM_864838.1| PREDICTED: Bos taurus similar to ribosomal prot... 48 0.036
416ref|NM_001033619.1| Bos taurus similar to ribosomal protein L18a... 48 0.036
417gb|BC042256.1| Xenopus laevis similar to ribosomal protein L18a,... 48 0.036
418ref|XM_860467.1| PREDICTED: Canis familiaris similar to ribosoma... 48 0.036
419ref|XM_533877.2| PREDICTED: Canis familiaris similar to ribosoma... 48 0.036
420ref|XM_533842.2| PREDICTED: Canis familiaris similar to ribosoma... 48 0.036
421gb|AC121781.3| Mus musculus BAC clone RP23-363D24 from chromosom... 48 0.036
422emb|CR734984.2|CNS0GTW7 Tetraodon nigroviridis full-length cDNA 48 0.036
423emb|CR734787.2|CNS0GTQQ Tetraodon nigroviridis full-length cDNA 48 0.036
424emb|CR734404.2|CNS0GTG3 Tetraodon nigroviridis full-length cDNA 48 0.036
425emb|CR733930.2|CNS0GT2X Tetraodon nigroviridis full-length cDNA 48 0.036
426emb|CR733929.2|CNS0GT2W Tetraodon nigroviridis full-length cDNA 48 0.036
427emb|CR733735.2|CNS0GSXI Tetraodon nigroviridis full-length cDNA 48 0.036
428emb|CR733734.2|CNS0GSXH Tetraodon nigroviridis full-length cDNA 48 0.036
429emb|CR733720.2|CNS0GSX3 Tetraodon nigroviridis full-length cDNA 48 0.036
430emb|CR733692.2|CNS0GSWB Tetraodon nigroviridis full-length cDNA 48 0.036
431emb|CR732797.2|CNS0GSD2 Tetraodon nigroviridis full-length cDNA 48 0.036
432emb|CR730027.2|CNS0GQ8H Tetraodon nigroviridis full-length cDNA 48 0.036
433emb|CR724944.3|CNS0GMBA Tetraodon nigroviridis full-length cDNA 48 0.036
434emb|CR724423.2|CNS0GLWT Tetraodon nigroviridis full-length cDNA 48 0.036
435emb|CR723073.2|CNS0GKVB Tetraodon nigroviridis full-length cDNA 48 0.036
436emb|CR720538.2|CNS0GIWW Tetraodon nigroviridis full-length cDNA 48 0.036
437emb|CR719126.2|CNS0GHTO Tetraodon nigroviridis full-length cDNA 48 0.036
438emb|CR718016.2|CNS0GGYU Tetraodon nigroviridis full-length cDNA 48 0.036
439emb|CR717902.2|CNS0GGVO Tetraodon nigroviridis full-length cDNA 48 0.036
440emb|CR707962.2|CNS0G97Q Tetraodon nigroviridis full-length cDNA 48 0.036
441emb|CR706795.2|CNS0G8BB Tetraodon nigroviridis full-length cDNA 48 0.036
442emb|CR706096.2|CNS0G7RW Tetraodon nigroviridis full-length cDNA 48 0.036
443emb|CR703601.2|CNS0G5UL Tetraodon nigroviridis full-length cDNA 48 0.036
444emb|CR697423.2|CNS0G12Z Tetraodon nigroviridis full-length cDNA 48 0.036
445emb|CR696636.2|CNS0G0H4 Tetraodon nigroviridis full-length cDNA 48 0.036
446emb|CR695615.2|CNS0FZOR Tetraodon nigroviridis full-length cDNA 48 0.036
447emb|CR685828.2|CNS0FS4W Tetraodon nigroviridis full-length cDNA 48 0.036
448emb|CR688470.2|CNS0FU6A Tetraodon nigroviridis full-length cDNA 48 0.036
449emb|CR687228.2|CNS0FT7S Tetraodon nigroviridis full-length cDNA 48 0.036
450emb|CR684968.2|CNS0FRH0 Tetraodon nigroviridis full-length cDNA 48 0.036
451emb|CR683572.2|CNS0FQE8 Tetraodon nigroviridis full-length cDNA 48 0.036
452emb|CR680258.2|CNS0FNU6 Tetraodon nigroviridis full-length cDNA 48 0.036
453emb|CR677039.2|CNS0FLD7 Tetraodon nigroviridis full-length cDNA 48 0.036
454emb|CR672902.2|CNS0FI6K Tetraodon nigroviridis full-length cDNA 48 0.036
455emb|CR671291.2|CNS0FGXT Tetraodon nigroviridis full-length cDNA 48 0.036
456emb|CR666969.2|CNS0FDLR Tetraodon nigroviridis full-length cDNA 48 0.036
457emb|CR660236.2|CNS0F8EQ Tetraodon nigroviridis full-length cDNA 48 0.036
458emb|CR655020.2|CNS0F4DU Tetraodon nigroviridis full-length cDNA 48 0.036
459emb|CR653062.2|CNS0F2VG Tetraodon nigroviridis full-length cDNA 48 0.036
460emb|CR652436.2|CNS0F2E2 Tetraodon nigroviridis full-length cDNA 48 0.036
461emb|CR650724.2|CNS0F12I Tetraodon nigroviridis full-length cDNA 48 0.036
462emb|CR649137.2|CNS0EZUF Tetraodon nigroviridis full-length cDNA 48 0.036
463emb|CR648353.2|CNS0EZ8N Tetraodon nigroviridis full-length cDNA 48 0.036
464emb|CR646910.2|CNS0EY4K Tetraodon nigroviridis full-length cDNA 48 0.036
465emb|CR644204.2|CNS0EW1E Tetraodon nigroviridis full-length cDNA 48 0.036
466emb|CR644108.2|CNS0EVYQ Tetraodon nigroviridis full-length cDNA 48 0.036
467emb|CR642680.2|CNS0EUV2 Tetraodon nigroviridis full-length cDNA 48 0.036
468emb|CR642616.2|CNS0EUTA Tetraodon nigroviridis full-length cDNA 48 0.036
469emb|CR642452.2|CNS0EUOQ Tetraodon nigroviridis full-length cDNA 48 0.036
470emb|CR638692.2|CNS0ERSA Tetraodon nigroviridis full-length cDNA 48 0.036
471emb|CR638181.2|CNS0ERE3 Tetraodon nigroviridis full-length cDNA 48 0.036
472emb|CR637544.2|CNS0EQWE Tetraodon nigroviridis full-length cDNA 48 0.036
473emb|CR633797.2|CNS0EO0B Tetraodon nigroviridis full-length cDNA 48 0.036
474emb|AL583805.7| Human DNA sequence from clone RP11-134K1 on chro... 48 0.036
475emb|AL096764.11|HSJ298J18 Human DNA sequence from clone RP1-298J... 48 0.036
476emb|BX068390.1|CNS09OXM Single read from an extremity of a full-... 48 0.036
477emb|BX068305.1|CNS09OV9 Single read from an extremity of a full-... 48 0.036
478emb|BX065399.1|CNS09MMJ Single read from an extremity of a full-... 48 0.036
479emb|BX065398.1|CNS09MMI Single read from an extremity of a full-... 48 0.036
480emb|BX062119.1|CNS09K3F Single read from an extremity of a full-... 48 0.036
481emb|BX055716.1|CNS09F5K Single read from an extremity of a full-... 48 0.036
482emb|BX046825.1|CNS098AL Single read from an extremity of a full-... 48 0.036
483emb|BX044673.1|CNS096MT Single read from an extremity of a full-... 48 0.036
484emb|BX044585.1|CNS096KD Single read from an extremity of a full-... 48 0.036
485emb|BX036673.1|CNS090GL Single read from an extremity of a full-... 48 0.036
486emb|BX032691.1|CNS08XDZ Single read from an extremity of a full-... 48 0.036
487ref|NM_212510.1| Rattus norvegicus similar to 60S ribosomal prot... 48 0.036
488gb|BC058498.1| Rattus norvegicus similar to 60S ribosomal protei... 48 0.036
489gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, compl... 48 0.036
490gb|AY779046.1| Homo sapiens ribosomal protein L18a-like protein ... 48 0.036
491gb|AC097638.2| Homo sapiens chromosome 3 clone RP11-353H3, compl... 48 0.036
492gb|BC102624.1| Bos taurus similar to ribosomal protein L18a, mRN... 48 0.036
493gb|AC008079.24| Homo sapiens chromosome 22 clone bac519d21 map 2... 48 0.036
494gb|AC016830.5| Homo sapiens chromosome 22 clone b81b3 map 22q11,... 48 0.036
495gb|AC008101.16| Homo sapiens chromosome 22 clone b677f7 map 22q1... 48 0.036
496gb|AC016027.15| Homo sapiens chromosome 22 clone b476c20 map 22q... 48 0.036
497emb|X14181.1|RRRPL18A Rat mRNA for ribosomal protein L18a 48 0.036
498emb|CR760185.2| Xenopus tropicalis finished cDNA, clone TNeu035i09 48 0.036
499dbj|AB098916.1| Bos taurus mRNA for similar to ribosomal protein... 48 0.036
500emb|BX005240.7| Mouse DNA sequence from clone RP23-185M16 on chr... 48 0.036

>gb|AY103621.1| Zea mays PCO154872 mRNA sequence
          Length = 805

 Score =  543 bits (274), Expect = e-151
 Identities = 370/402 (92%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| ||||||||||||||||  ||||||||||||||||| ||||||||||||||||
Sbjct: 533 ggtacacaagcgggaacttgatctcggagttgtggaactgcttggtgttgtccctcttgc 474

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           ||||||||||||  |||||||| |||||||||||||| ||||| ||||| | ||||||||
Sbjct: 473 acagcttgaagtggaccgtcgctgtcttgatgatctgtatgcagggggacctcacgcggt 414

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || ||||||||  ||||||||||||||||  |||||||||| || ||||||||||
Sbjct: 413 ggcgggaggccatctcgttgtacatctgctccactgcgccgttcagggtggtgtcgcggt 354

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 353 actccttgtacatgttgtggtaaccagtcctgctctggtagcgcagccagatgccatagt 294

                                                                       
Query: 474 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 533
           |||||||||||||||||||   ||||||||||||||||||||| ||||||||||| ||| 
Sbjct: 293 tcttgatggtggtcgggttgcgctcaaagatctcgttgatggcaagcatctggccattgc 234

                                                                       
Query: 534 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 593
            ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 233 tcttcttcaccttcttgagctttctcaggaagtaccagaacttggacttggcgcgaacct 174

                                                     
Query: 594 cgttggtggcccagagcttcatgcggtagatcttgggctgct 635
           ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 173 cgttggtggcccagagcttcatgcggtagatcttggggtgct 132



to top

>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full
           insert sequence
          Length = 966

 Score =  480 bits (242), Expect = e-132
 Identities = 362/402 (90%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 531 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 472

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           | ||||||||||  || || || |||||||||||||| ||||| ||| | | ||| ||||
Sbjct: 471 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 412

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || |||||||| |||||||||||||||||| | || |||||||| ||||| ||||
Sbjct: 411 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 352

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           | ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||
Sbjct: 351 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 292

                                                                       
Query: 474 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 533
           ||||||| || || |||||   |||||||||||||||||||||||||||||| || ||| 
Sbjct: 291 tcttgatcgttgtagggttacgctcaaagatctcgttgatggcgagcatctgtccattgc 232

                                                                       
Query: 534 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 593
            ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231 tcttcttcaccttcttcagcttcctcaggaagtaccagaacttggacttggcgcggacct 172

                                                     
Query: 594 cgttggtggcccagagcttcatgcggtagatcttgggctgct 635
           ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 171 cgttggtggcccagagcttcatgcggtagatcttggggtgct 130



to top

>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence
          Length = 791

 Score =  476 bits (240), Expect = e-131
 Identities = 351/388 (90%)
 Strand = Plus / Minus

                                                                       
Query: 242 agcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttg 301
           ||||||||||||||||    ||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 503 agcgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgcagagcttg 444

                                                                       
Query: 302 aagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgac 361
           |||| |||||||||||||||||||||||||||||| ||||| | ||||||||| || || 
Sbjct: 443 aagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggtggcgagag 384

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           ||||||||  ||||||||||||||||| |||| ||||| || ||||||||||||||||||
Sbjct: 383 gccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggtactccttg 324

                                                                       
Query: 422 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 481
           |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| 
Sbjct: 323 tacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagttcttgatt 264

                                                                       
Query: 482 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 541
           || ||||||||   ||||||||||||||||||||| || | ||||||||||  |||||| 
Sbjct: 263 gtcgtcgggttacgctcaaagatctcgttgatggccaggacctggccgttgctcttctta 204

                                                                       
Query: 542 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 601
           |||||||| | |||||||| ||||||||||||||||  ||||||||||||||||||||||
Sbjct: 203 accttcttcaacttcctcaagaagtaccagaacttgctcttggcgcggacctcgttggtg 144

                                       
Query: 602 gcccagagcttcatgcggtagatcttgg 629
           ||||||||||||||||||||||||||||
Sbjct: 143 gcccagagcttcatgcggtagatcttgg 116



to top

>gb|AY103768.1| Zea mays PCO155588 mRNA sequence
          Length = 818

 Score =  464 bits (234), Expect = e-127
 Identities = 360/402 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| || |||||||||||||    ||||||||||||||| ||||||||||||||||
Sbjct: 529 ggtacacgagtgggaacttgatctcactgttgtggaactgcttagtgttgtccctcttgc 470

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           | |||||||||| |||||||||||||||||||||||||||||| ||||| | ||||||||
Sbjct: 469 agagcttgaagtgcaccgtcgcagtcttgatgatctggatgcagggggacctcacgcggt 410

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || ||||||||  ||||||||||||||||| |||| ||||| || ||||||||||
Sbjct: 409 ggcgagaagccatctcgttgtacatctgctccacagcgccattcagggttgtgtcgcggt 350

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 349 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 290

                                                                       
Query: 474 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 533
           ||||||| || ||||||||   ||| ||||||||||||||||| || | ||| |||||| 
Sbjct: 289 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 230

                                                                       
Query: 534 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 593
            |||||| |||||||| | |||||||||||||||||||||||||  |||||||||||| |
Sbjct: 229 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 170

                                                     
Query: 594 cgttggtggcccagagcttcatgcggtagatcttgggctgct 635
           ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 169 cgttggtggcccagagcttcatgcggtagatcttggggtgct 128



to top

>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence
          Length = 732

 Score =  440 bits (222), Expect = e-120
 Identities = 357/402 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| || |||||||||||||    |||||| |||||||| ||||||||||||||||
Sbjct: 536 ggtacacgagtgggaacttgatctcactgttgtgaaactgcttggtgttgtccctcttgc 477

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           |||||||||||| ||| || || |||||||||||||||||||| ||||| | ||||||||
Sbjct: 476 acagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacctcacgcggt 417

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || ||||||||  ||||||||||||| ||| |||||||||| || ||||||||||
Sbjct: 416 ggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttgtgtcgcggt 357

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 356 actccttgtacatgttgtggtagccggttctgctctggtagcgcagccagatgccgtagt 297

                                                                       
Query: 474 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 533
           ||||||| || ||||||||   ||| ||||||||||||||||| || | ||| |||||| 
Sbjct: 296 tcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacctgaccgttgc 237

                                                                       
Query: 534 ccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacct 593
            |||||| |||||||| | |||||||||||||||||||||||||  |||||||||||| |
Sbjct: 236 tcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttggcgcggactt 177

                                                     
Query: 594 cgttggtggcccagagcttcatgcggtagatcttgggctgct 635
           ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 176 cgttggtggcccagagcttcatgcggtagatcttggggtgct 135



to top

>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence
          Length = 834

 Score =  402 bits (203), Expect = e-109
 Identities = 314/351 (89%)
 Strand = Plus / Minus

                                                                       
Query: 285 ccctcttgcacagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaac 344
           ||||||||||||||||||||| ||| || || |||||||||||||||||||| ||||| |
Sbjct: 465 ccctcttgcacagcttgaagtgcactgtggcggtcttgatgatctggatgcatggggacc 406

                                                                       
Query: 345 gcacgcggtgccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcg 404
            ||||||||| || || ||||||||  ||||||||||||| ||| |||||||||| || |
Sbjct: 405 tcacgcggtggcgagaagccatctcattgtacatctgctctacagcgccgttcagggttg 346

                                                                       
Query: 405 tgtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccaga 464
           ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 345 tgtcgcggtactccttgtacatgttgtggtagccggttctgctctggtagcgcagccaga 286

                                                                       
Query: 465 tgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatct 524
           |||||||||||||||| || ||||||||   ||| ||||||||||||||||| || | ||
Sbjct: 285 tgccgtagttcttgatcgtcgtcgggttacgctcgaagatctcgttgatggccaggacct 226

                                                                       
Query: 525 ggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttgg 584
           | ||||||  |||||| |||||||| | |||||||||||||||||||||||||  |||||
Sbjct: 225 gaccgttgctcttcttaaccttcttcaacttcctcaggaagtaccagaacttgctcttgg 166

                                                              
Query: 585 cgcggacctcgttggtggcccagagcttcatgcggtagatcttgggctgct 635
           ||||||| |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 165 cgcggacttcgttggtggcccagagcttcatgcggtagatcttggggtgct 115



to top

>ref|NM_191253.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 537

 Score =  351 bits (177), Expect = 2e-93
 Identities = 345/401 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 465 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 406

                                                                       
Query: 295 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 354
            || || ||||  || || ||||||||||||||||| ||||| ||| | |  || |||||
Sbjct: 405 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 346

                                                                       
Query: 355 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 414
            || || |||||||| |||||||||||||| ||  | || || || || || || |||||
Sbjct: 345 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 286

                                                                       
Query: 415 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 474
           ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 285 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 226

                                                                       
Query: 475 cttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 534
           |||||| || || |||||||||||||| |||||||||||||| || ||||| ||||||  
Sbjct: 225 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 166

                                                                       
Query: 535 cttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctc 594
           ||||||||||||||| ||||| |  |||||||||||||||||||||||||||||||||||
Sbjct: 165 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 106

                                                    
Query: 595 gttggtggcccagagcttcatgcggtagatcttgggctgct 635
           |||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 105 gttggtagcccagagcttcatgcggtagatcttggggtgct 65



to top

>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full
           insert sequence
          Length = 910

 Score =  351 bits (177), Expect = 2e-93
 Identities = 345/401 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 582 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 523

                                                                       
Query: 295 cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 354
            || || ||||  || || ||||||||||||||||| ||||| ||| | |  || |||||
Sbjct: 522 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 463

                                                                       
Query: 355 ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 414
            || || |||||||| |||||||||||||| ||  | || || || || || || |||||
Sbjct: 462 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 403

                                                                       
Query: 415 ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 474
           ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 402 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 343

                                                                       
Query: 475 cttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggc 534
           |||||| || || |||||||||||||| |||||||||||||| || ||||| ||||||  
Sbjct: 342 cttgatagttgttgggttcttctcaaaaatctcgttgatggcaaggatctgcccgttgct 283

                                                                       
Query: 535 cttcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctc 594
           ||||||||||||||| ||||| |  |||||||||||||||||||||||||||||||||||
Sbjct: 282 cttcttcaccttcttcagcttgcggaggaagtaccagaacttggacttggcgcggacctc 223

                                                    
Query: 595 gttggtggcccagagcttcatgcggtagatcttgggctgct 635
           |||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 222 gttggtagcccagagcttcatgcggtagatcttggggtgct 182



to top

>ref|NM_191921.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 588

 Score =  325 bits (164), Expect = 1e-85
 Identities = 293/336 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| || |||||||||||  ||  ||||||||||||||| ||||||||||||||||
Sbjct: 517 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 458

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           | ||||||||||  || || || |||||||||||||||||||| ||| | | ||| ||||
Sbjct: 457 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 398

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || |||||||| ||||||||||| |||||  | || ||||  || ||||| ||||
Sbjct: 397 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 338

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 337 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 278

                                                                       
Query: 474 tcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttgg 533
           ||||||| ||||| |||||   ||| ||||||||||||||||||||||||||||||||| 
Sbjct: 277 tcttgatcgtggttgggttgcgctcgaagatctcgttgatggcgagcatctggccgttgc 218

                                               
Query: 534 ccttcttcaccttcttgagcttcctcaggaagtacc 569
            ||||||||||||||| |||||||||||||||||||
Sbjct: 217 tcttcttcaccttcttcagcttcctcaggaagtacc 182



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 62/67 (92%)
 Strand = Plus / Minus

                                                                       
Query: 569 cagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatcttg 628
           |||||||||  ||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 131 cagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatcttg 72

                  
Query: 629 ggctgct 635
           || ||||
Sbjct: 71  gggtgct 65



to top

>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region
           genomic sequence
          Length = 556

 Score =  293 bits (148), Expect = 4e-76
 Identities = 148/148 (100%)
 Strand = Plus / Plus

                                                                       
Query: 8   ctcattactaatacgaaacaaagtcaagagttgcatcaacgcagcagcatcctcagtgcc 67
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   ctcattactaatacgaaacaaagtcaagagttgcatcaacgcagcagcatcctcagtgcc 61

                                                                       
Query: 68  aactgaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactct 127
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62  aactgaaaacattctcaaagtgcataaccaaaacttccacatgcaaaacattcaaactct 121

                                       
Query: 128 tacacacgctaaaacagtaggcagtggg 155
           ||||||||||||||||||||||||||||
Sbjct: 122 tacacacgctaaaacagtaggcagtggg 149



 Score =  145 bits (73), Expect = 2e-31
 Identities = 84/87 (96%), Gaps = 3/87 (3%)
 Strand = Plus / Plus

                                                                       
Query: 488 gggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcaccttc 547
           |||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||
Sbjct: 472 gggttcttctcaaagatctcgttgatggcgagcatctgg---ttggccttcttcaccttc 528

                                      
Query: 548 ttgagcttcctcaggaagtaccagaac 574
           |||||||||||||||||||||||||||
Sbjct: 529 ttgagcttcctcaggaagtaccagaac 555



to top

>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome AT2G34480
           mRNA, complete cds
          Length = 785

 Score =  274 bits (138), Expect = 3e-70
 Identities = 327/390 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 495 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 436

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 435 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 376

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 375 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 316

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 315 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 256

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 255 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 196

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 195 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 136

                                         
Query: 605 cagagcttcatgcggtagatcttgggctgc 634
           ||||||||||| | ||| ||||| ||||||
Sbjct: 135 cagagcttcatcctgtaaatcttaggctgc 106



to top

>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA,
           complete cds
          Length = 672

 Score =  274 bits (138), Expect = 3e-70
 Identities = 327/390 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96

                                         
Query: 605 cagagcttcatgcggtagatcttgggctgc 634
           ||||||||||| | ||| ||||| ||||||
Sbjct: 95  cagagcttcatcctgtaaatcttaggctgc 66



to top

>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA,
           complete cds
          Length = 734

 Score =  274 bits (138), Expect = 3e-70
 Identities = 327/390 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131

                                         
Query: 605 cagagcttcatgcggtagatcttgggctgc 634
           ||||||||||| | ||| ||||| ||||||
Sbjct: 130 cagagcttcatcctgtaaatcttaggctgc 101



to top

>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB32ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 752

 Score =  274 bits (138), Expect = 3e-70
 Identities = 327/390 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 489 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 430

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 429 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 370

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 369 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 310

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 309 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 250

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 249 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 190

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 189 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 130

                                         
Query: 605 cagagcttcatgcggtagatcttgggctgc 634
           ||||||||||| | ||| ||||| ||||||
Sbjct: 129 cagagcttcatcctgtaaatcttaggctgc 100



to top

>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB25ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 704

 Score =  274 bits (138), Expect = 3e-70
 Identities = 327/390 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 441 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 382

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 381 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 322

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 321 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 262

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 261 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 202

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 201 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 142

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 141 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 82

                                         
Query: 605 cagagcttcatgcggtagatcttgggctgc 634
           ||||||||||| | ||| ||||| ||||||
Sbjct: 81  cagagcttcatcctgtaaatcttaggctgc 52



to top

>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02,
              complete sequence
          Length = 157106

 Score =  272 bits (137), Expect = 1e-69
 Identities = 239/273 (87%)
 Strand = Plus / Minus

                                                                          
Query: 234    ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
              ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 130137 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 130078

                                                                          
Query: 294    acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
              | ||||||||||  || || || |||||||||||||| ||||| ||| | | ||| ||||
Sbjct: 130077 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 130018

                                                                          
Query: 354    gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
              | || || |||||||| |||||||||||||||||| | || |||||||| ||||| ||||
Sbjct: 130017 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 129958

                                                                          
Query: 414    actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
              | ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||
Sbjct: 129957 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 129898

                                               
Query: 474    tcttgatggtggtcgggttcttctcaaagatct 506
              ||||||| || || |||||   |||||||||||
Sbjct: 129897 tcttgatcgttgtagggttacgctcaaagatct 129865



 Score =  129 bits (65), Expect = 1e-26
 Identities = 68/69 (98%)
 Strand = Plus / Minus

                                                                          
Query: 567    accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128693 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 128634

                       
Query: 627    tgggctgct 635
              |||| ||||
Sbjct: 128633 tggggtgct 128625



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                          
Query: 505    ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
              ||||||||||||||||||||| || |||  ||||||||||||||| ||||||||||||||
Sbjct: 128841 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 128782

                   
Query: 565    gtacc 569
              |||||
Sbjct: 128781 gtacc 128777



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  272 bits (137), Expect = 1e-69
 Identities = 239/273 (87%)
 Strand = Plus / Minus

                                                                            
Query: 234      ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
                ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 27899720 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 27899661

                                                                            
Query: 294      acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
                | ||||||||||  || || || |||||||||||||| ||||| ||| | | ||| ||||
Sbjct: 27899660 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 27899601

                                                                            
Query: 354      gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
                | || || |||||||| |||||||||||||||||| | || |||||||| ||||| ||||
Sbjct: 27899600 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 27899541

                                                                            
Query: 414      actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
                | ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||
Sbjct: 27899540 attccttgtacatgttgtggtaacctgttctgctctggtaacgcagccagatgccgtagt 27899481

                                                 
Query: 474      tcttgatggtggtcgggttcttctcaaagatct 506
                ||||||| || || |||||   |||||||||||
Sbjct: 27899480 tcttgatcgttgtagggttacgctcaaagatct 27899448



 Score =  129 bits (65), Expect = 1e-26
 Identities = 68/69 (98%)
 Strand = Plus / Minus

                                                                            
Query: 567      accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27898276 accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 27898217

                         
Query: 627      tgggctgct 635
                |||| ||||
Sbjct: 27898216 tggggtgct 27898208



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                            
Query: 505      ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
                ||||||||||||||||||||| || |||  ||||||||||||||| ||||||||||||||
Sbjct: 27898424 ctcgttgatggcgagcatctgtccattgctcttcttcaccttcttcagcttcctcaggaa 27898365

                     
Query: 565      gtacc 569
                |||||
Sbjct: 27898364 gtacc 27898360



to top

>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds
          Length = 537

 Score =  268 bits (135), Expect = 2e-68
 Identities = 312/371 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 455 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 396

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 395 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 336

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 335 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 276

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 275 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 216

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 215 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 156

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 155 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 96

                      
Query: 605 cagagcttcat 615
           |||||||||||
Sbjct: 95  cagagcttcat 85



to top

>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 755

 Score =  268 bits (135), Expect = 2e-68
 Identities = 312/371 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
           ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 490 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 431

                                                                       
Query: 305 tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
              || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 430 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 371

                                                                       
Query: 365 atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
           ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 370 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 311

                                                                       
Query: 425 atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
           ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 310 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 251

                                                                       
Query: 485 gtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacc 544
           || |||||||||||| ||||||||||||||||||||||||| || ||   ||||||||||
Sbjct: 250 gttgggttcttctcatagatctcgttgatggcgagcatctgtccattactcttcttcacc 191

                                                                       
Query: 545 ttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcc 604
           |||||||||||||||| ||| |||||||||||||||||||| || |||||||| || |||
Sbjct: 190 ttcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagcc 131

                      
Query: 605 cagagcttcat 615
           |||||||||||
Sbjct: 130 cagagcttcat 120



to top

>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial
           sequence
          Length = 380

 Score =  262 bits (132), Expect = 1e-66
 Identities = 218/247 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
           ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 262 ggtacacgagcgggaacttgatattcgagttgtggaactgcttagtgttgtccctcttgc 203

                                                                       
Query: 294 acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
           | ||||||||||  || || || |||||||||||||| ||||| ||| | | ||| ||||
Sbjct: 202 agagcttgaagtgaactgttgcggtcttgatgatctgaatgcaggggaacctcacacggt 143

                                                                       
Query: 354 gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
           | || || |||||||| |||||||||||||||||| | || |||||||| ||||| ||||
Sbjct: 142 gacgagaggccatctcggtgtacatctgctccacagcaccattcagagtagtgtcacggt 83

                                                                       
Query: 414 actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
           | ||||||||||||||||||||||| || ||||||||||| |||| ||||||||||||||
Sbjct: 82  attccttgtacatgttgtggtaacctgttctgctctggtaacgcanccagatgccgtagt 23

                  
Query: 474 tcttgat 480
           |||||||
Sbjct: 22  tcttgat 16



to top

>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome AT3G14600
           mRNA, complete cds
          Length = 853

 Score =  254 bits (128), Expect = 3e-64
 Identities = 292/344 (84%), Gaps = 2/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 303
           |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | |
Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472

                                                                       
Query: 304 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 363
           |   || |||||||||||||||||||| ||||| ||| | | ||| |  || || || ||
Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413

                                                                       
Query: 364 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 423
           |||||| ||||||||||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 412 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353

                                                                       
Query: 424 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 483
           |||||||||||| || || | |||||| || |||| |||||| |||||||||||||||||
Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 293

                                                                       
Query: 484 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 543
            || ||||||||||| || ||||| |||||||| |||||||| ||||||   ||||||||
Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 233

                                                       
Query: 544 cttcttgagcttcctcaggaagtaccagaacttggacttggcgc 587
           |||||| || ||||||| ||||||||||||||||||||||||||
Sbjct: 232 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 189



to top

>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds
          Length = 537

 Score =  254 bits (128), Expect = 3e-64
 Identities = 292/344 (84%), Gaps = 2/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 303
           |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | |
Sbjct: 455 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 396

                                                                       
Query: 304 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 363
           |   || |||||||||||||||||||| ||||| ||| | | ||| |  || || || ||
Sbjct: 395 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 337

                                                                       
Query: 364 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 423
           |||||| ||||||||||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 336 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 277

                                                                       
Query: 424 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 483
           |||||||||||| || || | |||||| || |||| |||||| |||||||||||||||||
Sbjct: 276 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 217

                                                                       
Query: 484 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 543
            || ||||||||||| || ||||| |||||||| |||||||| ||||||   ||||||||
Sbjct: 216 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 157

                                                       
Query: 544 cttcttgagcttcctcaggaagtaccagaacttggacttggcgc 587
           |||||| || ||||||| ||||||||||||||||||||||||||
Sbjct: 156 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 113



to top

>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds
          Length = 829

 Score =  254 bits (128), Expect = 3e-64
 Identities = 292/344 (84%), Gaps = 2/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 303
           |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | |
Sbjct: 506 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 447

                                                                       
Query: 304 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 363
           |   || |||||||||||||||||||| ||||| ||| | | ||| |  || || || ||
Sbjct: 446 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 388

                                                                       
Query: 364 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 423
           |||||| ||||||||||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 387 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 328

                                                                       
Query: 424 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 483
           |||||||||||| || || | |||||| || |||| |||||| |||||||||||||||||
Sbjct: 327 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 268

                                                                       
Query: 484 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 543
            || ||||||||||| || ||||| |||||||| |||||||| ||||||   ||||||||
Sbjct: 267 cgttgggttcttctcgaaaatctcattgatggcaagcatctgtccgttgcttttcttcac 208

                                                       
Query: 544 cttcttgagcttcctcaggaagtaccagaacttggacttggcgc 587
           |||||| || ||||||| ||||||||||||||||||||||||||
Sbjct: 207 cttcttcagtttcctcatgaagtaccagaacttggacttggcgc 164



to top

>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 711

 Score =  240 bits (121), Expect = 5e-60
 Identities = 322/389 (82%)
 Strand = Plus / Minus

                                                                       
Query: 246 ggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagt 305
           |||||||||||||   |||||||||||| || ||| | || |||||||||||||||    
Sbjct: 490 ggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggctg 431

                                                                       
Query: 306 ccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcca 365
             || || || |||||||||||||| ||||| ||| | |  ||  |||| || || ||||
Sbjct: 430 ggacagttgctgtcttgatgatctgaatgcaagggaatcttacaaggtgacgggatgcca 371

                                                                       
Query: 366 tctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtaca 425
           |||| || ||||||||||| ||| | ||||| ||||| ||||  ||||||||||||||||
Sbjct: 370 tctcagtatacatctgctcaacagcaccgttaagagtggtgtaacggtactccttgtaca 311

                                                                       
Query: 426 tgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtgg 485
           |||||||||| || || || |||||||| | || ||| || ||| |||||||||| || |
Sbjct: 310 tgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgttg 251

                                                                       
Query: 486 tcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacct 545
           | |||||||||||| ||||||||||||||||||||||||  || ||   |||||||||||
Sbjct: 250 ttgggttcttctcatagatctcgttgatggcgagcatctttccattactcttcttcacct 191

                                                                       
Query: 546 tcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccc 605
           ||||||||||||||| ||| |||||||||||||||||||| || |||||||| || ||||
Sbjct: 190 tcttgagcttcctcaagaaataccagaacttggacttggcacgaacctcgttcgtagccc 131

                                        
Query: 606 agagcttcatgcggtagatcttgggctgc 634
           |||||||||| | ||| ||||| ||||||
Sbjct: 130 agagcttcatcctgtaaatcttaggctgc 102



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  228 bits (115), Expect = 2e-56
 Identities = 223/259 (86%)
 Strand = Plus / Plus

                                                                            
Query: 234      ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
                ||||||| || |||||||||||  ||  ||||||||||||||| ||||||||||||||||
Sbjct: 27260170 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 27260229

                                                                            
Query: 294      acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
                | ||||||||||  || || || |||||||||||||||||||| ||| | | ||| ||||
Sbjct: 27260230 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 27260289

                                                                            
Query: 354      gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
                | || || |||||||| ||||||||||| |||||  | || ||||  || ||||| ||||
Sbjct: 27260290 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 27260349

                                                                            
Query: 414      actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
                |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 27260350 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 27260409

                                   
Query: 474      tcttgatggtggtcgggtt 492
                ||||||| ||||| |||||
Sbjct: 27260410 tcttgatcgtggttgggtt 27260428



 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                            
Query: 235      gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
                ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 31552819 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 31552878

                                                                            
Query: 295      cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 354
                 || || ||||  || || ||||||||||||||||| ||||| ||| | |  || |||||
Sbjct: 31552879 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 31552938

                                                                            
Query: 355      ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 414
                 || || |||||||| |||||||||||||| ||  | || || || || || || |||||
Sbjct: 31552939 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 31552998

                                                                            
Query: 415      ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 474
                ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 31552999 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 31553058

                                                
Query: 475      cttgatggtggtcgggttcttctcaaagatct 506
                |||||| || || |||||||||||||| ||||
Sbjct: 31553059 cttgatagttgttgggttcttctcaaaaatct 31553090



 Score =  121 bits (61), Expect = 3e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                            
Query: 567      accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 31553741 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 31553800

                         
Query: 627      tgggctgct 635
                |||| ||||
Sbjct: 31553801 tggggtgct 31553809



 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                            
Query: 505      ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
                ||||||||||||||||||||||||||||  ||||||||||||||| ||||||||||||||
Sbjct: 27261236 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 27261295

                     
Query: 565      gtacc 569
                |||||
Sbjct: 27261296 gtacc 27261300



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 64/69 (92%)
 Strand = Plus / Plus

                                                                            
Query: 567      accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
                |||||||||||  ||||||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 27261401 accagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatct 27261460

                         
Query: 627      tgggctgct 635
                |||| ||||
Sbjct: 27261461 tggggtgct 27261469



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                            
Query: 505      ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
                |||||||||||| || ||||| ||||||  ||||||||||||||| ||||| |  |||||
Sbjct: 31553583 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 31553642

                     
Query: 565      gtacc 569
                |||||
Sbjct: 31553643 gtacc 31553647



to top

>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0063G05
          Length = 182681

 Score =  228 bits (115), Expect = 2e-56
 Identities = 223/259 (86%)
 Strand = Plus / Plus

                                                                         
Query: 234   ggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgc 293
             ||||||| || |||||||||||  ||  ||||||||||||||| ||||||||||||||||
Sbjct: 40687 ggtacacaagggggaacttgatgctcccgttgtggaactgcttggtgttgtccctcttgc 40746

                                                                         
Query: 294   acagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggt 353
             | ||||||||||  || || || |||||||||||||||||||| ||| | | ||| ||||
Sbjct: 40747 agagcttgaagtggacagtggcggtcttgatgatctggatgcaagggaatctcacacggt 40806

                                                                         
Query: 354   gccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggt 413
             | || || |||||||| ||||||||||| |||||  | || ||||  || ||||| ||||
Sbjct: 40807 ggcgagaagccatctcggtgtacatctgttccacggcaccattcaatgtagtgtcacggt 40866

                                                                         
Query: 414   actccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagt 473
             |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 40867 actccttgtacatgttgtggtaaccggttctgctctggtaacgcagccagatgccatagt 40926

                                
Query: 474   tcttgatggtggtcgggtt 492
             ||||||| ||||| |||||
Sbjct: 40927 tcttgatcgtggttgggtt 40945



 Score =  105 bits (53), Expect = 2e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                         
Query: 505   ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
             ||||||||||||||||||||||||||||  ||||||||||||||| ||||||||||||||
Sbjct: 41753 ctcgttgatggcgagcatctggccgttgctcttcttcaccttcttcagcttcctcaggaa 41812

                  
Query: 565   gtacc 569
             |||||
Sbjct: 41813 gtacc 41817



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 64/69 (92%)
 Strand = Plus / Plus

                                                                         
Query: 567   accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
             |||||||||||  ||||||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 41918 accagaacttgctcttggcgcggacctcattggtggcccagagcttcatccggtagatct 41977

                      
Query: 627   tgggctgct 635
             |||| ||||
Sbjct: 41978 tggggtgct 41986



to top

>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence
          Length = 767

 Score =  222 bits (112), Expect = 1e-54
 Identities = 288/344 (83%), Gaps = 2/344 (0%)
 Strand = Plus / Minus

                                                                       
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 303
           |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | |
Sbjct: 531 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 472

                                                                       
Query: 304 gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 363
           |   || |||||||||||||||||||| ||||| ||| | | ||| |  || || || ||
Sbjct: 471 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 413

                                                                       
Query: 364 catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 423
            ||||| ||||||||||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 412 aatctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 353

                                                                       
Query: 424 catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 483
           |||||||||||| || || | |||||| || |||| |||||| ||||| |||||||| ||
Sbjct: 352 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtaattcttgattgt 293

                                                                       
Query: 484 ggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 543
            || ||||||||||| || ||||| |||||||| |||||||| ||||||   ||||||||
Sbjct: 292 cgttgggttcttctcgaaaatctcattgatggcaagcatctgcccgttgcttttcttcac 233

                                                       
Query: 544 cttcttgagcttcctcaggaagtaccagaacttggacttggcgc 587
           |||||| || || |||| ||||||||||||||||||||||||||
Sbjct: 232 cttcttcagttttctcatgaagtaccagaacttggacttggcgc 189



to top

>gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL18) mRNA, complete
           cds
          Length = 710

 Score =  198 bits (100), Expect = 2e-47
 Identities = 356/441 (80%), Gaps = 2/441 (0%)
 Strand = Plus / Minus

                                                                       
Query: 188 gccttgtaggtggtcttgagcttgcgggtnnnnnnncgcaccttctggtacaccagcggg 247
           |||||| |||||||||||||||| | |||       || ||||||| | |||| || |||
Sbjct: 518 gccttgaaggtggtcttgagcttcctggtgggcggccggaccttcttgaacacgaggggg 459

                                                                       
Query: 248 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 307
           || |||||||||||||  ||||||||||| ||| | || | |||||| ||||||  |   
Sbjct: 458 aatttgatcttcgagtcatggaactgcttggtgctctcgcgcttgcagagcttggcgggg 399

                                                                       
Query: 308 accgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatc 367
           |  || || |||||||||||||||||||| ||| | |  || | ||| || || ||||| 
Sbjct: 398 atggtggccgtcttgatgatctggatgcatgggaacctaaccctgtggcgtgatgccatt 339

                                                                       
Query: 368 tccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatg 427
           || ||||||||||||||||| || || ||||| || ||||| | ||||||||||||||||
Sbjct: 338 tcagtgtacatctgctccactcctccattcagggtggtgtccctgtactccttgtacatg 279

                                                                       
Query: 428 ttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttct-tgatggtggt 486
           |  || || ||||| ||||||||||| | |||||| ||||||||||||| | ||  ||||
Sbjct: 278 ta-tgatagccggttctgctctggtacctcagccatatgccgtagttctattattttggt 220

                                                                       
Query: 487 cgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttcacctt 546
            |||||||||||||| ||||||||||| || || |  ||||| ||   ||||||||| ||
Sbjct: 219 ggggttcttctcaaatatctcgttgatagcaagaacttggccattactcttcttcacttt 160

                                                                       
Query: 547 cttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccca 606
           ||| |||||||||||||| ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 159 cttcagcttcctcaggaaataccaaaacttggacttggcccgaacttcgttggttgccca 100

                                
Query: 607 gagcttcatgcggtagatctt 627
            |||||||||||| |||||||
Sbjct: 99  aagcttcatgcggaagatctt 79



to top

>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA
          Length = 722

 Score =  186 bits (94), Expect = 6e-44
 Identities = 223/266 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           ||||| || ||||||||||| || ||||| || ||||  || ||||| ||||||||||||
Sbjct: 356 gccatttcagtgtacatctgttctacaccaccattcaatgtggtgtcacggtactccttg 297

                                                                       
Query: 422 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 481
           |||||||| || || || ||||| || ||||| |||||||| || || ||||||||||| 
Sbjct: 296 tacatgttatgatacccagtcctactttggtaacgcagccaaataccatagttcttgatt 237

                                                                       
Query: 482 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 541
            | || ||||  |||||||| ||||| ||||| || |||||||| || |||  |||||||
Sbjct: 236 tttgttgggtatttctcaaaaatctcattgatagctagcatctgaccattgctcttcttc 177

                                                                       
Query: 542 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 601
           |||||||| |||||||||| |||||||||||||||||||||||| |||||||| || || 
Sbjct: 176 accttctttagcttcctcaagaagtaccagaacttggacttggcacggacctcatttgta 117

                                     
Query: 602 gcccagagcttcatgcggtagatctt 627
           |||||||| ||||| ||||| |||||
Sbjct: 116 gcccagagtttcatacggtaaatctt 91



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 296
           |||||| |||||||||||| || ||||  ||||||||||| ||| | |||| |||||| |
Sbjct: 481 acaccaacgggaacttgattttggagtcatggaactgctttgtgctctcccgcttgcaga 422

               
Query: 297 gctt 300
           ||||
Sbjct: 421 gctt 418



to top

>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0435B05
          Length = 150997

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                         
Query: 235   gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
             ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 65842 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 65901

                                                                         
Query: 295   cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 354
              || || ||||  || || ||||||||||||||||| ||||| ||| | |  || |||||
Sbjct: 65902 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 65961

                                                                         
Query: 355   ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 414
              || || |||||||| |||||||||||||| ||  | || || || || || || |||||
Sbjct: 65962 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 66021

                                                                         
Query: 415   ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 474
             ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 66022 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 66081

                                             
Query: 475   cttgatggtggtcgggttcttctcaaagatct 506
             |||||| || || |||||||||||||| ||||
Sbjct: 66082 cttgatagttgttgggttcttctcaaaaatct 66113



 Score =  121 bits (61), Expect = 3e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                         
Query: 567   accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 66764 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 66823

                      
Query: 627   tgggctgct 635
             |||| ||||
Sbjct: 66824 tggggtgct 66832



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                         
Query: 505   ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
             |||||||||||| || ||||| ||||||  ||||||||||||||| ||||| |  |||||
Sbjct: 66606 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 66665

                  
Query: 565   gtacc 569
             |||||
Sbjct: 66666 gtacc 66670



to top

>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0046E05
          Length = 162776

 Score =  182 bits (92), Expect = 9e-43
 Identities = 227/272 (83%)
 Strand = Plus / Plus

                                                                          
Query: 235    gtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
              ||||||||| ||||||||||| |  || |||||||||||||| |||||||| | ||||||
Sbjct: 146883 gtacaccagtgggaacttgatatctgacttgtggaactgcttagtgttgtcacgcttgca 146942

                                                                          
Query: 295    cagcttgaagtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtg 354
               || || ||||  || || ||||||||||||||||| ||||| ||| | |  || |||||
Sbjct: 146943 gagtttaaagtggacagtagcagtcttgatgatctgaatgcaagggaatctgacacggtg 147002

                                                                          
Query: 355    ccgcgacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggta 414
               || || |||||||| |||||||||||||| ||  | || || || || || || |||||
Sbjct: 147003 gcgggaagccatctcagtgtacatctgctcaacggcaccattgagggtggtatcacggta 147062

                                                                          
Query: 415    ctccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagtt 474
              ||||||||||||||||||||| || ||||| |||||||| |||||||||||||| |||||
Sbjct: 147063 ctccttgtacatgttgtggtagccagtcctactctggtaacgcagccagatgccatagtt 147122

                                              
Query: 475    cttgatggtggtcgggttcttctcaaagatct 506
              |||||| || || |||||||||||||| ||||
Sbjct: 147123 cttgatagttgttgggttcttctcaaaaatct 147154



 Score =  121 bits (61), Expect = 3e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                          
Query: 567    accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 147805 accagaacttggacttggcgcggacctcgttggtagcccagagcttcatgcggtagatct 147864

                       
Query: 627    tgggctgct 635
              |||| ||||
Sbjct: 147865 tggggtgct 147873



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                          
Query: 505    ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
              |||||||||||| || ||||| ||||||  ||||||||||||||| ||||| |  |||||
Sbjct: 147647 ctcgttgatggcaaggatctgcccgttgctcttcttcaccttcttcagcttgcggaggaa 147706

                   
Query: 565    gtacc 569
              |||||
Sbjct: 147707 gtacc 147711



to top

>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA
          Length = 904

 Score =  178 bits (90), Expect = 1e-41
 Identities = 222/266 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           |||||||| ||||||||||| || ||| | || ||||  || || || ||||||||||||
Sbjct: 383 gccatctctgtgtacatctgttctacagctccattcaatgtggtatcacggtactccttg 324

                                                                       
Query: 422 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 481
           |||||||||||||| || || |  ||||| || |||| ||| ||||||||||||||||| 
Sbjct: 323 tacatgttgtggtacccagtgcgactctgataacgcaaccaaatgccgtagttcttgatt 264

                                                                       
Query: 482 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 541
            | || |||| ||||||||||||||| || || || |||||||| ||||||  |||||| 
Sbjct: 263 ttagtagggtacttctcaaagatctcattaatagcaagcatctgcccgttgctcttctta 204

                                                                       
Query: 542 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 601
           |||||||| ||||||||||  ||||||||||||||||| || || |||||||| ||||| 
Sbjct: 203 accttcttcagcttcctcaaaaagtaccagaacttggatttcgcacggacctcattggta 144

                                     
Query: 602 gcccagagcttcatgcggtagatctt 627
           ||||| || |||||||| ||||||||
Sbjct: 143 gcccaaagtttcatgcgatagatctt 118



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacag 297
           ||||||||||| || ||||  ||||||||||| ||| | ||||||||||||||
Sbjct: 500 gggaacttgattttggagtcatggaactgcttggtgctctccctcttgcacag 448



to top

>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA
          Length = 779

 Score =  178 bits (90), Expect = 1e-41
 Identities = 228/274 (83%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           |||||||| |||||||||||||||||||| || ||||  || ||||| ||||||||||||
Sbjct: 356 gccatctcagtgtacatctgctccacaccaccattcaatgtggtgtcacggtactccttg 297

                                                                       
Query: 422 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 481
           |||||||||||||| || || || || ||||| || ||||| || || || |||||||| 
Sbjct: 296 tacatgttgtggtatccagttctactttggtaacggagccaaataccataattcttgatt 237

                                                                       
Query: 482 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 541
           || || ||||||||||| |||||||| || || || |||||||| ||||||  |||||||
Sbjct: 236 gttgttgggttcttctcgaagatctcattaatagccagcatctgaccgttgctcttcttc 177

                                                                       
Query: 542 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 601
           |||||||| |||||||||| ||| |||||||| |||||||| || || || || || || 
Sbjct: 176 accttcttaagcttcctcaagaaataccagaatttggacttagcacgaacttcatttgta 117

                                             
Query: 602 gcccagagcttcatgcggtagatcttgggctgct 635
           ||||| | |||||| || || |||||||| ||||
Sbjct: 116 gcccacaacttcatacgataaatcttgggatgct 83



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 237 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 296
           |||||| ||||||||||||||| ||||  ||||||||||| ||| | |||||||||||||
Sbjct: 481 acaccaacgggaacttgatcttggagtcatggaactgcttagtgctctccctcttgcaca 422

               
Query: 297 gctt 300
           ||||
Sbjct: 421 gctt 418



to top

>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome AT1G29965
           mRNA, complete cds
          Length = 774

 Score =  168 bits (85), Expect = 1e-38
 Identities = 214/257 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 418
           ||||||||||| |||||||| ||||||||  | || |||| ||| ||||| |||||||| 
Sbjct: 430 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 371

                                                                       
Query: 419 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 478
           ||||||||||| |||||||| || | ||||||||| | || |||||| ||  | ||||||
Sbjct: 370 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 311

                                                                       
Query: 479 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 538
           || || || ||||||||||||||||||||||||||||| |||||||| || ||   ||||
Sbjct: 310 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 251

                                                                       
Query: 539 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 598
           |||||||||||  || |||| | | |||||||||||||||| |||||  | |||||||| 
Sbjct: 250 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 191

                            
Query: 599 gtggcccagagcttcat 615
           || ||||| ||||||||
Sbjct: 190 gttgcccatagcttcat 174



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           |||| |||||||||||||||   |||||| |||||||||||| | |||||||||||
Sbjct: 550 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 495



to top

>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative
           (At1g29970) mRNA, complete cds
          Length = 633

 Score =  168 bits (85), Expect = 1e-38
 Identities = 214/257 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 418
           ||||||||||| |||||||| ||||||||  | || |||| ||| ||||| |||||||| 
Sbjct: 341 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 282

                                                                       
Query: 419 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 478
           ||||||||||| |||||||| || | ||||||||| | || |||||| ||  | ||||||
Sbjct: 281 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 222

                                                                       
Query: 479 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 538
           || || || ||||||||||||||||||||||||||||| |||||||| || ||   ||||
Sbjct: 221 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 162

                                                                       
Query: 539 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 598
           |||||||||||  || |||| | | |||||||||||||||| |||||  | |||||||| 
Sbjct: 161 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 102

                            
Query: 599 gtggcccagagcttcat 615
           || ||||| ||||||||
Sbjct: 101 gttgcccatagcttcat 85



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           |||| |||||||||||||||   |||||| |||||||||||| | |||||||||||
Sbjct: 461 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 406



to top

>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative
           (At1g29970) mRNA, complete cds
          Length = 758

 Score =  168 bits (85), Expect = 1e-38
 Identities = 214/257 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 418
           ||||||||||| |||||||| ||||||||  | || |||| ||| ||||| |||||||| 
Sbjct: 418 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 359

                                                                       
Query: 419 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 478
           ||||||||||| |||||||| || | ||||||||| | || |||||| ||  | ||||||
Sbjct: 358 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 299

                                                                       
Query: 479 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 538
           || || || ||||||||||||||||||||||||||||| |||||||| || ||   ||||
Sbjct: 298 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 239

                                                                       
Query: 539 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 598
           |||||||||||  || |||| | | |||||||||||||||| |||||  | |||||||| 
Sbjct: 238 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 179

                            
Query: 599 gtggcccagagcttcat 615
           || ||||| ||||||||
Sbjct: 178 gttgcccatagcttcat 162



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           |||| |||||||||||||||   |||||| |||||||||||| | |||||||||||
Sbjct: 538 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 483



to top

>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1162

 Score =  168 bits (85), Expect = 1e-38
 Identities = 214/257 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 418
           ||||||||||| |||||||| ||||||||  | || |||| ||| ||||| |||||||| 
Sbjct: 859 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 800

                                                                       
Query: 419 ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 478
           ||||||||||| |||||||| || | ||||||||| | || |||||| ||  | ||||||
Sbjct: 799 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 740

                                                                       
Query: 479 atggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttc 538
           || || || ||||||||||||||||||||||||||||| |||||||| || ||   ||||
Sbjct: 739 atcgttgttgggttcttctcaaagatctcgttgatggctagcatctgtccattactcttc 680

                                                                       
Query: 539 ttcaccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttg 598
           |||||||||||  || |||| | | |||||||||||||||| |||||  | |||||||| 
Sbjct: 679 ttcaccttcttttgcctccttaagtagtaccagaacttggatttggcaagaacctcgttc 620

                            
Query: 599 gtggcccagagcttcat 615
           || ||||| ||||||||
Sbjct: 619 gttgcccatagcttcat 603



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           |||| |||||||||||||||   |||||| |||||||||||| | |||||||||||
Sbjct: 979 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 924



to top

>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1
          Length = 84462

 Score =  165 bits (83), Expect = 2e-37
 Identities = 214/255 (83%), Gaps = 2/255 (0%)
 Strand = Plus / Minus

                                                                         
Query: 245   gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt-gaa 303
             |||||||||||||||||||| ||||||||||| ||| | || |||||||| ||||| | |
Sbjct: 39811 gggaacttgatcttcgagttatggaactgcttggtgatctctctcttgcaaagctttgca 39752

                                                                         
Query: 304   gtccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgc 363
             |   || |||||||||||||||||||| ||||| ||| | | ||| |  || || || ||
Sbjct: 39751 ggg-acagtcgcagtcttgatgatctgaatgcaagggaacctcactctatgacgagaagc 39693

                                                                         
Query: 364   catctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgta 423
             |||||| ||||||||||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 39692 catctcagtgtacatctgctccactccaccattgagtgttgtgtcacggtactccttgta 39633

                                                                         
Query: 424   catgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggt 483
             |||||||||||| || || | |||||| || |||| |||||| |||||||||||||||||
Sbjct: 39632 catgttgtggtacccagttcggctctgataacgcaaccagatcccgtagttcttgatggt 39573

                            
Query: 484   ggtcgggttcttctc 498
              || |||||||||||
Sbjct: 39572 cgttgggttcttctc 39558



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                         
Query: 509   ttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaagtac 568
             |||||||| |||||||| ||||||   |||||||||||||| || ||||||| |||||||
Sbjct: 39462 ttgatggcaagcatctgtccgttgcttttcttcaccttcttcagtttcctcatgaagtac 39403

              
Query: 569   c 569
             |
Sbjct: 39402 c 39402



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 567   accagaacttggacttggcgc 587
             |||||||||||||||||||||
Sbjct: 39310 accagaacttggacttggcgc 39290



to top

>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence
          Length = 810

 Score =  157 bits (79), Expect = 5e-35
 Identities = 253/311 (81%)
 Strand = Plus / Minus

                                                                       
Query: 317 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 376
           ||||||||||||||||||||  |   ||| || | ||| || || ||||| || ||||||
Sbjct: 419 gtcttgatgatctggatgcagtgatgacggaccctgtggcgagaagccatttcagtgtac 360

                                                                       
Query: 377 atctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaa 436
           ||||| || ||||| || ||||  || || || |||||||||||||||||||| || || 
Sbjct: 359 atctgttctacaccaccattcaatgttgtatcacggtactccttgtacatgttatgatac 300

                                                                       
Query: 437 ccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttc 496
           || ||||| || ||||| |||||||| || || |||||||||||  | || ||||  |||
Sbjct: 299 ccagtcctactttggtaacgcagccaaataccatagttcttgatttttgttgggtatttc 240

                                                                       
Query: 497 tcaaagatctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttc 556
           ||||| ||||| || || || |||||||| || |||  ||||||||||||||| ||||||
Sbjct: 239 tcaaaaatctcattaatagctagcatctgaccattgctcttcttcaccttctttagcttc 180

                                                                       
Query: 557 ctcaggaagtaccagaacttggacttggcgcggacctcgttggtggcccagagcttcatg 616
           |||| ||||||||| ||||||||||| || |||||||| || || |||||||| ||||| 
Sbjct: 179 ctcaagaagtaccaaaacttggacttagcacggacctcattcgtagcccagagtttcata 120

                      
Query: 617 cggtagatctt 627
           ||||| |||||
Sbjct: 119 cggtaaatctt 109



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 237 acaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcaca 296
           |||||| |||||||||||| || |||| |||||||||||| ||| | |||| |||||| |
Sbjct: 499 acaccaacgggaacttgattttggagtcgtggaactgctttgtgctctcccgcttgcaga 440

               
Query: 297 gctt 300
           ||||
Sbjct: 439 gctt 436



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
              sequence
          Length = 112763

 Score =  139 bits (70), Expect = 1e-29
 Identities = 214/262 (81%)
 Strand = Plus / Plus

                                                                          
Query: 245    gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
              ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 103485 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 103544

                                                                          
Query: 305    tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
                 || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 103545 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 103604

                                                                          
Query: 365    atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
              ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 103605 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 103664

                                                                          
Query: 425    atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
              ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 103665 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 103724

                                    
Query: 485    gtcgggttcttctcaaagatct 506
              || |||||||||||| ||||||
Sbjct: 103725 gttgggttcttctcatagatct 103746



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                          
Query: 505    ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
              ||||||||||||||||||||| || ||   |||||||||||||||||||||||||| |||
Sbjct: 104248 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcctcaagaa 104307

                   
Query: 565    gtacc 569
               ||||
Sbjct: 104308 atacc 104312



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                          
Query: 567    accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
              ||||||||||||||||||| || |||||||| || |||||||||||||| | ||| ||||
Sbjct: 104408 accagaacttggacttggcacgaacctcgttcgtagcccagagcttcatcctgtaaatct 104467

                      
Query: 627    tgggctgc 634
              | ||||||
Sbjct: 104468 taggctgc 104475



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  139 bits (70), Expect = 1e-29
 Identities = 214/262 (81%)
 Strand = Plus / Minus

                                                                         
Query: 245   gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaag 304
             ||||||||||||||   |||||||||||| || ||| | || |||||||||||||||   
Sbjct: 70717 gggaacttgatcttgctgttgtggaactgtttagtgctctctctcttgcacagcttggct 70658

                                                                         
Query: 305   tccaccgtcgcagtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgcc 364
                || || || |||||||||||||| ||||| ||| | |  || ||||| || || |||
Sbjct: 70657 gggacagtggctgtcttgatgatctgaatgcaagggaatctgacacggtgacgggatgcc 70598

                                                                         
Query: 365   atctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtac 424
             ||||| |||||||||||||| ||| | ||||| ||||| ||||| |||||||||||||||
Sbjct: 70597 atctcagtgtacatctgctcaacagctccgttaagagtggtgtcacggtactccttgtac 70538

                                                                         
Query: 425   atgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtg 484
             ||||||||||| || || || |||||||| | || ||| || ||| |||||||||| || 
Sbjct: 70537 atgttgtggtacccagttctactctggtacctcaaccaaataccgaagttcttgatcgtt 70478

                                   
Query: 485   gtcgggttcttctcaaagatct 506
             || |||||||||||| ||||||
Sbjct: 70477 gttgggttcttctcatagatct 70456



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 505   ctcgttgatggcgagcatctggccgttggccttcttcaccttcttgagcttcctcaggaa 564
             ||||||||||||||||||||| || ||   |||||||||||||||||||||||||| |||
Sbjct: 69954 ctcgttgatggcgagcatctgtccattactcttcttcaccttcttgagcttcctcaagaa 69895

                  
Query: 565   gtacc 569
              ||||
Sbjct: 69894 atacc 69890



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                         
Query: 567   accagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatct 626
             ||||||||||||||||||| || |||||||| || |||||||||||||| | ||| ||||
Sbjct: 69794 accagaacttggacttggcacgaacctcgttcgtagcccagagcttcatcctgtaaatct 69735

                     
Query: 627   tgggctgc 634
             | ||||||
Sbjct: 69734 taggctgc 69727



to top

>gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA sequence
          Length = 312

 Score =  129 bits (65), Expect = 1e-26
 Identities = 170/205 (82%)
 Strand = Plus / Plus

                                                                       
Query: 423 acatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatgg 482
           ||||||| ||||| || || | |||||| || ||||||||||| || || |||||||| |
Sbjct: 1   acatgttatggtatccagttcggctctgataacgcagccagataccataattcttgattg 60

                                                                       
Query: 483 tggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttca 542
           | |||||||||||||| || ||||| |||||||| |||||||| || |||   |||||||
Sbjct: 61  tcgtcgggttcttctcgaaaatctcattgatggcaagcatctgcccattgcttttcttca 120

                                                                       
Query: 543 ccttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtgg 602
           ||||||| || ||||||| ||| ||||| ||||||||||||||||  || || || ||| 
Sbjct: 121 ccttcttcagtttcctcatgaaataccaaaacttggacttggcgcatacttcatttgtgc 180

                                    
Query: 603 cccagagcttcatgcggtagatctt 627
           |||| |||||||| | |||||||||
Sbjct: 181 cccatagcttcatcctgtagatctt 205



to top

>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full
           insert sequence
          Length = 885

 Score =  125 bits (63), Expect = 2e-25
 Identities = 186/227 (81%)
 Strand = Plus / Minus

                                                                       
Query: 317 gtcttgatgatctggatgcacggggaacgcacgcggtgccgcgacgccatctccgtgtac 376
           |||||||||||||||||||| ||| | ||||||||||| || || ||||||||  |||||
Sbjct: 431 gtcttgatgatctggatgcaagggaagcgcacgcggtggcgtgatgccatctcgctgtac 372

                                                                       
Query: 377 atctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaa 436
           ||||| |||||  | ||||| || || ||||| |||||||||||||||||||||||||| 
Sbjct: 371 atctggtccactgcaccgttgagggtggtgtcacggtactccttgtacatgttgtggtag 312

                                                                       
Query: 437 ccggtcctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttc 496
           || || |    ||||||||||| |||||||||  ||||||| |  || || || ||   |
Sbjct: 311 cctgtgcgtgactggtagcgcacccagatgccaaagttcttcacagttgtgggcttgcgc 252

                                                          
Query: 497 tcaaagatctcgttgatggcgagcatctggccgttggccttcttcac 543
           ||||| |||||||| |  ||||  |||||||||||||||||||||||
Sbjct: 251 tcaaaaatctcgttcactgcgatgatctggccgttggccttcttcac 205



to top

>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds
          Length = 775

 Score =  107 bits (54), Expect = 4e-20
 Identities = 204/254 (80%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           ||||||||  ||||||| || |||||| | || || ||||| ||||| || |||||||| 
Sbjct: 421 gccatctcaatgtacatttgttccacagcaccatttagagtggtgtctcgatactcctta 362

                                                                       
Query: 422 tacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttgatg 481
           ||||||||||| || || || | ||| || || ||||||||||| || || ||||| || 
Sbjct: 361 tacatgttgtgatacccagttcggctttgataccgcagccagataccataattcttaatc 302

                                                                       
Query: 482 gtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgttggccttcttc 541
            | || || ||||||||||| ||||| ||||| || | |||||| || |||  |||||| 
Sbjct: 301 tttgtaggattcttctcaaaaatctcattgatagctaacatctgcccattgctcttctta 242

                                                                       
Query: 542 accttcttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtg 601
           || ||||| ||||||||||  |||||||||||||| |||||||| |||||||| || || 
Sbjct: 241 actttcttcagcttcctcaaaaagtaccagaacttcgacttggcacggacctcatttgta 182

                         
Query: 602 gcccagagcttcat 615
           ||||| || |||||
Sbjct: 181 gcccaaagtttcat 168



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
           ||||| ||||||||||| || || |||||||||||||| | | | |||||||||||
Sbjct: 544 accagagggaacttgattttggaattgtggaactgcttagagctctccctcttgca 489



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete
             sequence
          Length = 82053

 Score =  103 bits (52), Expect = 7e-19
 Identities = 124/148 (83%)
 Strand = Plus / Plus

                                                                         
Query: 359   gacgccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactcc 418
             ||||||||||| |||||||| ||||||||  | || |||| ||| ||||| |||||||| 
Sbjct: 20530 gacgccatctcagtgtacatttgctccactgctccattcaaagtagtgtcacggtactct 20589

                                                                         
Query: 419   ttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccgtagttcttg 478
             ||||||||||| |||||||| || | ||||||||| | || |||||| ||  | ||||||
Sbjct: 20590 ttgtacatgttatggtaacctgtacggctctggtatctcaaccagattccaaaattcttg 20649

                                         
Query: 479   atggtggtcgggttcttctcaaagatct 506
             || || || |||||||||||||||||||
Sbjct: 20650 atcgttgttgggttcttctcaaagatct 20677



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 239   accagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgca 294
             |||| |||||||||||||||   |||||| |||||||||||| | |||||||||||
Sbjct: 20410 accaacgggaacttgatcttgctgttgtgaaactgcttcgtgctttccctcttgca 20465



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                              
Query: 567   accagaacttggacttggcgcggacctcgttggtggcccagagcttcat 615
             ||||||||||||| |||||  | |||||||| || ||||| ||||||||
Sbjct: 21003 accagaacttggatttggcaagaacctcgttcgttgcccatagcttcat 21051



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 505   ctcgttgatggcgagcatctggccgttggccttcttcaccttctt 549
             |||||||||||| |||||||| || ||   |||||||||||||||
Sbjct: 20846 ctcgttgatggctagcatctgtccattactcttcttcaccttctt 20890



to top

>emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZB06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 705

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 99/116 (85%), Gaps = 1/116 (0%)
 Strand = Plus / Minus

                                                                       
Query: 471 agttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccgt 530
           |||| ||||| || || |||||||||||| |||||| |||||||||||||||||| || |
Sbjct: 216 agttattgatcgttgttgggttcttctcatagatcttgttgatggcgagcatctgtccat 157

                                                                   
Query: 531 tggcct-tcttcaccttcttgagcttcctcaggaagtaccagaacttggacttggc 585
           |   || |||||||||||||||| ||||||| ||| |||||||| ||||| |||||
Sbjct: 156 tactctgtcttcaccttcttgagtttcctcaagaaataccagaaattggatttggc 101



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           |||||||| ||||||||||| || ||| | | ||| ||||| ||||| ||||||||||||
Sbjct: 325 gccatctcagtgtacatctgttcaacagctctgttaagagtggtgtcacggtactccttg 266

                         
Query: 422 tacatgttgtggta 435
           ||||||||||||||
Sbjct: 265 tacatgttgtggta 252



to top

>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence
          Length = 859

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Plus

                                                                       
Query: 410 cggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagatgccg 469
           ||||||||||||| || || ||||||||| ||||||| |||||| | |||||||||||| 
Sbjct: 537 cggtactccttgtgcaggtcgtggtaacctgtcctgcactggtaacacagccagatgcca 596

                                                                       
Query: 470 tagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgagcatctggccg 529
            |||||||||| || || |||||   |||||| |||||||  |||||||| ||||| |||
Sbjct: 597 cagttcttgattgttgtagggttacactcaaatatctcgtctatggcgagaatctgaccg 656

              
Query: 530 ttg 532
           |||
Sbjct: 657 ttg 659



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 77/89 (86%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 547 cttgagcttcctcaggaagtaccagaacttggacttggcgcggacctcgttggtggccca 606
           |||||||||||||||  |||||||||  ||||| |||| || |||||||||||| || ||
Sbjct: 679 cttgagcttcctcagatagtaccagagattggatttggagcagacctcgttggtagcgca 738

                                        
Query: 607 gagcttcatgcggtagatcttgggctgct 635
            |||| |||||||||||||||||| ||||
Sbjct: 739 -agctccatgcggtagatcttggggtgct 766



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 248 aacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagcttgaagtcc 307
           ||||||| ||| || |||||||||||||| ||||||||||||||||| ||||| ||||  
Sbjct: 377 aacttgaactttgaattgtggaactgcttggtgttgtccctcttgcaaagcttaaagttg 436

                                  
Query: 308 accgtcgcagtcttgatgatctg 330
           |  || || ||||||||||||||
Sbjct: 437 attgttgccgtcttgatgatctg 459



to top

>gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRNA, complete cds
          Length = 616

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 406 gtcgcggtactccttgtacatgttgtggtaaccggtcctgctctggtagcgcagccagat 465
           ||||||||||||| ||||||||||||||   ||| | |||   | |||||||||||||||
Sbjct: 311 gtcgcggtactccctgtacatgttgtgggttccgcttctggagtcgtagcgcagccagat 252

                                         
Query: 466 gccgtagttcttgatggtggtcgggttctt 495
           |||||||||||||||| | || ||||||||
Sbjct: 251 gccgtagttcttgatgctcgtggggttctt 222



to top

>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence
          Length = 117139

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                         
Query: 566   taccagaacttggacttggcgcggacctcgttggtggcccagagcttcatgcggtagatc 625
             |||||||||||||| ||||| || ||||||||||| ||||| || |||||||| || |||
Sbjct: 20577 taccagaacttggatttggcacgaacctcgttggttgcccaaagtttcatgcgataaatc 20636

                  
Query: 626   ttggg 630
             |||||
Sbjct: 20637 ttggg 20641



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                         
Query: 382   ctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtggtaaccggt 441
             ||||||| | ||||| ||||| || || ||||| ||||||||||| ||||| ||||| ||
Sbjct: 19689 ctccacagcaccgtttagagtagtatcacggtattccttgtacatattgtgataaccagt 19748

                                                                         
Query: 442   cctgctctggtagcgcagccagatgccgtagttcttgatggtggtcgggttcttctcaaa 501
              |  ||||| || |||||||| || ||||||||||| ||  |||| || || ||||||||
Sbjct: 19749 acgactctgataacgcagccaaattccgtagttcttaatcttggtaggatttttctcaaa 19808

                  
Query: 502   gatct 506
             |||||
Sbjct: 19809 gatct 19813



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                         
Query: 229   cttctggtacaccagcgggaacttgatcttcgagttgtggaactgcttcgtgttgtccct 288
             ||||| ||||||||  ||||||||||| || || |||||||||||||| ||| | |||||
Sbjct: 19536 cttcttgtacaccaaggggaacttgattttggaattgtggaactgcttagtgctctccct 19595

                      
Query: 289   cttgcacag 297
              ||||||||
Sbjct: 19596 tttgcacag 19604



to top

>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright
           Yellow 2
          Length = 320

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 362 gccatctccgtgtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttg 421
           |||||||| ||||||||||| |||||| | || |||| ||| || || ||||||||||||
Sbjct: 109 gccatctcagtgtacatctgttccacagctccattcaaagtggtatctcggtactccttg 50

                    
Query: 422 tacatgttg 430
           |||||||||
Sbjct: 49  tacatgttg 41



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 245 gggaacttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt 300
           ||||||||||| || ||||  ||||||||||| ||| | |||||||| || |||||
Sbjct: 226 gggaacttgattttggagtcatggaactgcttggtgctctccctcttacatagctt 171



to top

>ref|XM_505817.1| Yarrowia lipolytica CLIB122, YALI0F24123g predicted mRNA
          Length = 519

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Minus

                                                                       
Query: 460 ccagatgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgag 519
           |||||||||| |||||||||   | || ||| |||||||  |||||| ||||||||| | 
Sbjct: 234 ccagatgccgaagttcttgaccttagtgggggtcttctcggagatcttgttgatggcaac 175

                                                                 
Query: 520 catctggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaa 573
            ||||  ||| ||| |||||| |||||||||||||   ||||||||||||||||
Sbjct: 174 aatctcaccggtggacttcttgaccttcttgagctgggtcaggaagtaccagaa 121



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 410 cggtactccttgtacatgttgtg 432
           |||||||||||||||||||||||
Sbjct: 284 cggtactccttgtacatgttgtg 262



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                           
Query: 460     ccagatgccgtagttcttgatggtggtcgggttcttctcaaagatctcgttgatggcgag 519
               |||||||||| |||||||||   | || ||| |||||||  |||||| ||||||||| | 
Sbjct: 3153790 ccagatgccgaagttcttgaccttagtgggggtcttctcggagatcttgttgatggcaac 3153849

                                                                     
Query: 520     catctggccgttggccttcttcaccttcttgagcttcctcaggaagtaccagaa 573
                ||||  ||| ||| |||||| |||||||||||||   ||||||||||||||||
Sbjct: 3153850 aatctcaccggtggacttcttgaccttcttgagctgggtcaggaagtaccagaa 3153903



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 410     cggtactccttgtacatgttgtg 432
               |||||||||||||||||||||||
Sbjct: 3153740 cggtactccttgtacatgttgtg 3153762



to top

>gb|AY961480.1| Phytophthora infestans clone MY-22-C-06 ribosomal protein L18 mRNA,
           complete cds
          Length = 682

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 373 gtacatctgctccacaccgccgttcagagtcgtgtcgcggtactccttgtacatgttgtg 432
           |||||||||||||||| ||| |   ||||||  ||| |||||||||||||||||||||||
Sbjct: 335 gtacatctgctccacagcgctgcagagagtcaagtcacggtactccttgtacatgttgtg 276

            
Query: 433 g 433
           |
Sbjct: 275 g 275



to top

>ref|XM_524153.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a; 60S
           ribosomal protein L18a (LOC468766), mRNA
          Length = 390

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 321 cagcgggaacttgatcttggagtcgtggaactgctt 286



to top

>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA
          Length = 618

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462



to top

>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7,
             Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28,
             complete sequence
          Length = 247592

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                 
Query: 241   cagcgggaacttgatcttcgagttgtggaactgctt 276
             |||||||||||||||||| |||| ||||||||||||
Sbjct: 45832 cagcgggaacttgatcttggagtcgtggaactgctt 45797



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 452   tagcgcagccagatgccgtagttctt 477
             |||||||||||||||||| |||||||
Sbjct: 45621 tagcgcagccagatgccgaagttctt 45596



to top

>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 204505

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                  
Query: 241    cagcgggaacttgatcttcgagttgtggaactgctt 276
              |||||||||||||||||| |||| ||||||||||||
Sbjct: 168555 cagcgggaacttgatcttggagtcgtggaactgctt 168520



to top

>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone
            ****
          Length = 1360

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 241  cagcgggaacttgatcttcgagttgtggaactgctt 276
            |||||||||||||||||| |||| ||||||||||||
Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131



to top

>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone
            ****
          Length = 1785

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 241  cagcgggaacttgatcttcgagttgtggaactgctt 276
            |||||||||||||||||| |||| ||||||||||||
Sbjct: 1608 cagcgggaacttgatcttggagtcgtggaactgctt 1573



to top

>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone
            ****
          Length = 1360

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 241  cagcgggaacttgatcttcgagttgtggaactgctt 276
            |||||||||||||||||| |||| ||||||||||||
Sbjct: 1166 cagcgggaacttgatcttggagtcgtggaactgctt 1131



to top

>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208
           IMAGE:5286436), complete cds
          Length = 632

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466



to top

>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476
           IMAGE:2961519), complete cds
          Length = 616

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446



to top

>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 602

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446



to top

>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 612

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456



to top

>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens
            (human)
          Length = 1921

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 241  cagcgggaacttgatcttcgagttgtggaactgctt 276
            |||||||||||||||||| |||| ||||||||||||
Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767



to top

>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 241  cagcgggaacttgatcttcgagttgtggaactgctt 276
            |||||||||||||||||| |||| ||||||||||||
Sbjct: 1802 cagcgggaacttgatcttggagtcgtggaactgctt 1767



to top

>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 606

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449



to top

>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 604

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448



to top

>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 612

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 491 cagcgggaacttgatcttggagtcgtggaactgctt 456



to top

>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 605

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449



to top

>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 605

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 484 cagcgggaacttgatcttggagtcgtggaactgctt 449



to top

>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo
           sapiens (human)
          Length = 603

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 483 cagcgggaacttgatcttggagtcgtggaactgctt 448



to top

>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 601

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 482 cagcgggaacttgatcttggagtcgtggaactgctt 447



to top

>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal
           protein L18a (LOC390354) on chromosome 12
          Length = 616

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 501 cagcgggaacttgatcttggagtcgtggaactgctt 466



to top

>ref|XM_938382.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC347544), mRNA
          Length = 574

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 452 tagcgcagccagatgccgtagttctt 477
           |||||||||||||||||| |||||||
Sbjct: 251 tagcgcagccagatgccgaagttctt 226



to top

>ref|XM_293412.3| PREDICTED: Homo sapiens similar to ribosomal protein L18a
           (LOC347544), mRNA
          Length = 574

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 462 cagcgggaacttgatcttggagtcgtggaactgctt 427



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 452 tagcgcagccagatgccgtagttctt 477
           |||||||||||||||||| |||||||
Sbjct: 251 tagcgcagccagatgccgaagttctt 226



to top

>ref|XM_945469.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 6 (LOC285053), mRNA
          Length = 588

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430



to top

>ref|XM_945465.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 5 (LOC285053), mRNA
          Length = 557

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399



to top

>ref|XM_941835.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 4 (LOC285053), mRNA
          Length = 659

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476



to top

>ref|XM_934020.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 3 (LOC285053), mRNA
          Length = 588

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 465 cagcgggaacttgatcttggagtcgtggaactgctt 430



to top

>ref|XM_934018.1| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 2 (LOC285053), mRNA
          Length = 557

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 434 cagcgggaacttgatcttggagtcgtggaactgctt 399



to top

>ref|XM_208281.6| PREDICTED: Homo sapiens similar to ribosomal protein L18a,
           transcript variant 1 (LOC285053), mRNA
          Length = 659

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 511 cagcgggaacttgatcttggagtcgtggaactgctt 476



to top

>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone:
           CBL08590
          Length = 594

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 497 cagcgggaacttgatcttggagtcgtggaactgctt 462



to top

>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence
          Length = 82938

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 241   cagcgggaacttgatcttcgagttgtggaactgctt 276
             |||||||||||||||||| |||| ||||||||||||
Sbjct: 78637 cagcgggaacttgatcttggagtcgtggaactgctt 78672



to top

>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds
          Length = 602

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446



to top

>dbj|AB180445.1| Plutella xylostella mRNA for Ribosomal protein L18A, complete cds
          Length = 564

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 451 gtagcgcagccagatgccgtagttcttgatggtggtcgggttcttctc 498
           ||||||||||||||||||| ||||||||||  || ||||| |||||||
Sbjct: 257 gtagcgcagccagatgccgaagttcttgatcttgatcgggctcttctc 210



to top

>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602
           IMAGE:6293838), complete cds
          Length = 622

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 481 cagcgggaacttgatcttggagtcgtggaactgctt 446



to top

>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds
          Length = 607

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 245 gggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||||||||| ||||||||||||
Sbjct: 474 gggaacttgatcttcgagtcgtggaactgctt 443



to top

>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF
          Length = 657

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 241 cagcgggaacttgatcttcgagttgtggaactgctt 276
           |||||||||||||||||| |||| ||||||||||||
Sbjct: 487 cagcgggaacttgatcttggagtcgtggaactgctt 452



to top

>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence
          Length = 240

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttc 277
           ||||| ||||||||||||||||| | |||||||||||||
Sbjct: 173 accagagggaacttgatcttcgaatcgtggaactgcttc 135



to top

>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence
          Length = 528

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 239 accagcgggaacttgatcttcgagttgtggaactgcttc 277
           ||||| |||||||||||||| |||| |||||||||||||
Sbjct: 461 accagagggaacttgatcttggagtcgtggaactgcttc 423



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 455 cgcagccagatgccgtagttcttgat 480
           ||||||||||||||| ||||||||||
Sbjct: 245 cgcagccagatgccgaagttcttgat 220



to top

>gb|AY048752.1| Blastocystis hominis RAPD fragment
          Length = 1132

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 398 agagtcgtgtcgcggtactccttgtacatgttgtg 432
           |||| |||||| |||||||||||||||||||||||
Sbjct: 356 agagccgtgtcacggtactccttgtacatgttgtg 390



to top

>emb|BX053393.1|CNS09DD1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 165

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 111 caccagcgggaatcggatcttcgagttgtggaactgctt 149



to top

>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 434 caccagcgggaatcggatcttcgagttgtggaactgctt 472



to top

>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 506 caccagcgggaatcggatcttcgagttgtggaactgctt 468



to top

>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 414 caccagcgggaatcggatcttcgagttgtggaactgctt 452



to top

>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454



to top

>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445



to top

>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444



to top

>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 482 caccagcgggaatcggatcttcgagttgtggaactgctt 444



to top

>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460



to top

>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459



to top

>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458



to top

>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441



to top

>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 467 caccagcgggaatcggatcttcgagttgtggaactgctt 429



to top

>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 430



to top

>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438



to top

>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 392

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 348 caccagcgggaatcggatcttcgagttgtggaactgctt 386



to top

>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438



to top

>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 475



to top

>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 503 caccagcgggaatcggatcttcgagttgtggaactgctt 465



to top

>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 441 caccagcgggaatcggatcttcgagttgtggaactgctt 479



to top

>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455



to top

>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 443 caccagcgggaatcggatcttcgagttgtggaactgctt 481



to top

>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 516 caccagcgggaatcggatcttcgagttgtggaactgctt 478



to top

>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 514

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 447 caccagcgggaatcggatcttcgagttgtggaactgctt 485



to top

>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463



to top

>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473



to top

>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 271 caccagcgggaatcggatcttcgagttgtggaactgctt 309



to top

>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439



to top

>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456



to top

>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456



to top

>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 387 caccagcgggaatcggatcttcgagttgtggaactgctt 425



to top

>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433



to top

>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450



to top

>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462



to top

>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 347 caccagcgggaatcggatcttcgagttgtggaactgctt 385



to top

>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 483 caccagcgggaatcggatcttcgagttgtggaactgctt 445



to top

>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449



to top

>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452



to top

>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 400 caccagcgggaatcggatcttcgagttgtggaactgctt 438



to top

>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432



to top

>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460



to top

>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454



to top

>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 438 caccagcgggaatcggatcttcgagttgtggaactgctt 476



to top

>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 500 caccagcgggaatcggatcttcgagttgtggaactgctt 462



to top

>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 430 caccagcgggaatcggatcttcgagttgtggaactgctt 468



to top

>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456



to top

>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453



to top

>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 429 caccagcgggaatcggatcttcgagttgtggaactgctt 467



to top

>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461



to top

>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 613

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 495 caccagcgggaatcggatcttcgagttgtggaactgctt 457



to top

>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 419 caccagcgggaatcggatcttcgagttgtggaactgctt 457



to top

>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459



to top

>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439



to top

>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 522 caccagcgggaatcggatcttcgagttgtggaactgctt 484



to top

>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 425 caccagcgggaatcggatcttcgagttgtggaactgctt 463



to top

>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442



to top

>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445



to top

>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 479 caccagcgggaatcggatcttcgagttgtggaactgctt 441



to top

>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 311 caccagcgggaatcggatcttcgagttgtggaactgctt 273



to top

>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440



to top

>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 481 caccagcgggaatcggatcttcgagttgtggaactgctt 443



to top

>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 402 caccagcgggaatcggatcttcgagttgtggaactgctt 440



to top

>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 471 caccagcgggaatcggatcttcgagttgtggaactgctt 433



to top

>emb|BX064042.1|CNS09LKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 463

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 27  caccagcgggaatcggatcttcgagttgtggaactgctt 65



to top

>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459



to top

>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 361 caccagcgggaatcggatcttcgagttgtggaactgctt 323



to top

>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450



to top

>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438



to top

>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462



to top

>emb|BX063629.1|CNS09L9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 413 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 610 caccagcgggaatcggatcttcgagttgtggaactgctt 572



to top

>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 485

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 422 caccagcgggaatcggatcttcgagttgtggaactgctt 460



to top

>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 411 caccagcgggaatcggatcttcgagttgtggaactgctt 449



to top

>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446



to top

>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 350 caccagcgggaatcggatcttcgagttgtggaactgctt 312



to top

>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443



to top

>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442



to top

>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455



to top

>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452



to top

>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 455 caccagcgggaatcggatcttcgagttgtggaactgctt 417



to top

>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473



to top

>emb|BX061844.1|CNS09JVS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 475 caccagcgggaatcggatcttcgagttgtggaactgctt 437



to top

>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 305 caccagcgggaatcggatcttcgagttgtggaactgctt 343



to top

>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 392 caccagcgggaatcggatcttcgagttgtggaactgctt 354



to top

>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 473 caccagcgggaatcggatcttcgagttgtggaactgctt 435



to top

>emb|BX061292.1|CNS09JGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 416 caccagcgggaatcggatcttcgagttgtggaactgctt 454



to top

>emb|BX061291.1|CNS09JGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442



to top

>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442



to top

>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 501 caccagcgggaatcggatcttcgagttgtggaactgctt 463



to top

>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 353 caccagcgggaatcggatcttcgagttgtggaactgctt 391



to top

>emb|BX060314.1|CNS09IPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 489 caccagcgggaatcggatcttcgagttgtggaactgctt 451



to top

>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 736 caccagcgggaatcggatcttcgagttgtggaactgctt 698



to top

>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 464



to top

>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456



to top

>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 412 caccagcgggaatcggatcttcgagttgtggaactgctt 450



to top

>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 492 caccagcgggaatcggatcttcgagttgtggaactgctt 454



to top

>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 474 caccagcgggaatcggatcttcgagttgtggaactgctt 436



to top

>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 499 caccagcgggaatcggatcttcgagttgtggaactgctt 461



to top

>emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 437

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 19  caccagcgggaatcggatcttcgagttgtggaactgctt 57



to top

>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 480 caccagcgggaatcggatcttcgagttgtggaactgctt 442



to top

>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 384 caccagcgggaatcggatcttcgagttgtggaactgctt 422



to top

>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 463 caccagcgggaatcggatcttcgagttgtggaactgctt 425



to top

>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434



to top

>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 462 caccagcgggaatcggatcttcgagttgtggaactgctt 424



to top

>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 401 caccagcgggaatcggatcttcgagttgtggaactgctt 439



to top

>emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 478 caccagcgggaatcggatcttcgagttgtggaactgctt 440



to top

>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 420 caccagcgggaatcggatcttcgagttgtggaactgctt 458



to top

>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 497 caccagcgggaatcggatcttcgagttgtggaactgctt 459



to top

>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 426 caccagcgggaatcggatcttcgagttgtggaactgctt 388



to top

>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 417 caccagcgggaatcggatcttcgagttgtggaactgctt 455



to top

>emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 27  caccagcgggaatcggatcttcgagttgtggaactgctt 65



to top

>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 457 caccagcgggaatcggatcttcgagttgtggaactgctt 419



to top

>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432



to top

>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453



to top

>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 386



to top

>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 460 caccagcgggaatcggatcttcgagttgtggaactgctt 422



to top

>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444



to top

>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 470 caccagcgggaatcggatcttcgagttgtggaactgctt 432



to top

>emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 469 caccagcgggaatcggatcttcgagttgtggaactgctt 431



to top

>emb|BX056040.1|CNS09FEK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453



to top

>emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 488 caccagcgggaatcggatcttcgagttgtggaactgctt 450



to top

>emb|BX055724.1|CNS09F5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473



to top

>emb|BX055723.1|CNS09F5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 468 caccagcgggaatcggatcttcgagttgtggaactgctt 430



to top

>emb|BX055717.1|CNS09F5L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 544

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 433 caccagcgggaatcggatcttcgagttgtggaactgctt 471



to top

>emb|BX055643.1|CNS09F3J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 436 caccagcgggaatcggatcttcgagttgtggaactgctt 474



to top

>emb|BX055642.1|CNS09F3I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 486 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX055566.1|CNS09F1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 474

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 407 caccagcgggaatcggatcttcgagttgtggaactgctt 445



to top

>emb|BX055565.1|CNS09F1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 508 caccagcgggaatcggatcttcgagttgtggaactgctt 470



to top

>emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 415 caccagcgggaatcggatcttcgagttgtggaactgctt 453



to top

>emb|BX055541.1|CNS09F0P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 494 caccagcgggaatcggatcttcgagttgtggaactgctt 456



to top

>emb|BX055478.1|CNS09EYY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 396 caccagcgggaatcggatcttcgagttgtggaactgctt 434



to top

>emb|BX055405.1|CNS09EWX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 432

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 303 caccagcgggaatcggatcttcgagttgtggaactgctt 341



to top

>emb|BX055404.1|CNS09EWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 498 caccagcgggaatcggatcttcgagttgtggaactgctt 460



to top

>emb|BX055221.1|CNS09ERT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 484 caccagcgggaatcggatcttcgagttgtggaactgctt 446



to top

>emb|BX053165.1|CNS09D6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 450 caccagcgggaatcggatcttcgagttgtggaactgctt 412



to top

>emb|BX055118.1|CNS09EOY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 437 caccagcgggaatcggatcttcgagttgtggaactgctt 399



to top

>emb|BX054551.1|CNS09E97 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 565

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 399 caccagcgggaatcggatcttcgagttgtggaactgctt 437



to top

>emb|BX054550.1|CNS09E96 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 476 caccagcgggaatcggatcttcgagttgtggaactgctt 438



to top

>emb|BX054490.1|CNS09E7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 405 caccagcgggaatcggatcttcgagttgtggaactgctt 443



to top

>emb|BX054489.1|CNS09E7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 491 caccagcgggaatcggatcttcgagttgtggaactgctt 453



to top

>emb|BX054096.1|CNS09DWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 435 caccagcgggaatcggatcttcgagttgtggaactgctt 473



to top

>emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 490 caccagcgggaatcggatcttcgagttgtggaactgctt 452



to top

>emb|BX053786.1|CNS09DNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 716

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 338 caccagcgggaatcggatcttcgagttgtggaactgctt 300



to top

>emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 424 caccagcgggaatcggatcttcgagttgtggaactgctt 462



to top

>emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 493 caccagcgggaatcggatcttcgagttgtggaactgctt 455



to top

>emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 410 caccagcgggaatcggatcttcgagttgtggaactgctt 448



to top

>emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 328 caccagcgggaatcggatcttcgagttgtggaactgctt 290



to top

>emb|BX052629.1|CNS09CRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 406 caccagcgggaatcggatcttcgagttgtggaactgctt 444



to top

>emb|BX052628.1|CNS09CRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 238 caccagcgggaacttgatcttcgagttgtggaactgctt 276
           ||||||||||||   ||||||||||||||||||||||||
Sbjct: 330 caccagcgggaatcggatcttcgagttgtggaactgctt 292


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,676,217
Number of Sequences: 3902068
Number of extensions: 4676217
Number of successful extensions: 91852
Number of sequences better than 10.0: 664
Number of HSP's better than 10.0 without gapping: 664
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 89867
Number of HSP's gapped (non-prelim): 1956
length of query: 635
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 612
effective length of database: 17,143,297,704
effective search space: 10491698194848
effective search space used: 10491698194848
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top