>gb|AC084297.3| Homo sapiens BAC clone RP11-44H9 from 2, complete sequence
          Length = 112292

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 171   cctttttacatttttctttcag 192
             ||||||||||||||||||||||
Sbjct: 70296 cctttttacatttttctttcag 70317

>emb|AL031255.1|HS694E4 Human DNA sequence from clone RP4-694E4 on chromosome 22q12.1-12.3
             Contains the 5' end of the PISD gene for
             Phosphatidylserine decarboxylase, the 3' end of a novel
             gene (MGC50372) and two CpG islands, complete sequence
          Length = 69901

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 166   ctgttcctttttacatttttc 186
             |||||||||||||||||||||
Sbjct: 65378 ctgttcctttttacatttttc 65358

>gb|AC163750.4| Pan troglodytes BAC clone CH251-295N9 from chromosome unknown, complete
             sequence
          Length = 182445

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   ctgttcctttttacatttttc 186
             |||||||||||||||||||||
Sbjct: 82192 ctgttcctttttacatttttc 82212

>gb|AC133461.12| Mus musculus chromosome 15, clone RP23-52B2, complete sequence
          Length = 176450

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    tttttacatttttctttcag 192
              ||||||||||||||||||||
Sbjct: 155532 tttttacatttttctttcag 155513

>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence
          Length = 174746

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 171   cctttttacatttttctttc 190
             ||||||||||||||||||||
Sbjct: 74974 cctttttacatttttctttc 74993

>gb|AC102532.12| Mus musculus chromosome 12, clone RP23-49D23, complete sequence
          Length = 170606

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 174    ttttacatttttctttcagg 193
              ||||||||||||||||||||
Sbjct: 155634 ttttacatttttctttcagg 155615

>ref|XM_535858.2| PREDICTED: Canis familiaris similar to spermatogenesis associated 16
            (LOC478689), mRNA
          Length = 2024

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 169  ttcctttttacatttttctt 188
            ||||||||||||||||||||
Sbjct: 1917 ttcctttttacatttttctt 1898

>gb|AC102626.9| Mus musculus chromosome 12, clone RP23-456E21, complete sequence
          Length = 222905

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 174    ttttacatttttctttcagg 193
              ||||||||||||||||||||
Sbjct: 208359 ttttacatttttctttcagg 208378

>emb|AL354714.22| Human DNA sequence from clone RP11-312J18 on chromosome 1 Contains the
             3' end of the LY9 gene for lymphocyte antigen 9, the CD244
             gene for CD244 natural killer cell receptor 2B4, a
             peptidylprolyl isomerase A (cyclophilin A) (PPIA)
             pseudogene, the ITLN1 gene for intelectin 1
             (galactofuranose binding), a spermine synthase (SMS)
             pseudogene, a novel gene, a pseudogene similar to part of
             DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56), the 5'
             end of a novel gene and the 3' end of ITLN2 gene for
             intelectin 2, complete sequence
          Length = 141296

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 166   ctgttcctttttacatttttcttt 189
             |||||||| |||||||||||||||
Sbjct: 73047 ctgttcctgtttacatttttcttt 73070

>emb|AL606831.17| Mouse DNA sequence from clone RP23-432M23 on chromosome 11 Contains the
             5' end of Ntn1 gene for netrin 1, three genes for a novel
             proteins (F730038I15Rik), the 3' end of a novel gene
             (4930535C22Rik) and two CpG islands, complete sequence
          Length = 221455

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   aaacatatgaagctactttg 127
             ||||||||||||||||||||
Sbjct: 92366 aaacatatgaagctactttg 92385

>gb|AC106051.3| Homo sapiens BAC clone RP11-692K15 from 4, complete sequence
          Length = 112684

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   tttttacatttttctttcag 192
             ||||||||||||||||||||
Sbjct: 52920 tttttacatttttctttcag 52901

>gb|AC116634.5| Homo sapiens BAC clone RP11-462G13 from 4, complete sequence
          Length = 85439

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    cctaatgatattggggggaa 109
             ||||||||||||||||||||
Sbjct: 49830 cctaatgatattggggggaa 49811

>gb|AC159995.4| Mus musculus chromosome 1, clone RP24-81G13, complete sequence
          Length = 204097

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    tttttctttcagggttctac 200
              ||||||||||||||||||||
Sbjct: 199011 tttttctttcagggttctac 199030

>gb|AC136191.5| Rattus norvegicus  BAC CH230-52I17 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 221923

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 172    ctttttacatttttctttca 191
              ||||||||||||||||||||
Sbjct: 164121 ctttttacatttttctttca 164140

>gb|AC151296.4| Mus musculus BAC clone RP23-127M7 from chromosome 8, complete sequence
          Length = 210633

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    tcctttttacatttttcttt 189
              ||||||||||||||||||||
Sbjct: 137668 tcctttttacatttttcttt 137687

>gb|AC102163.14| Mus musculus chromosome 1, clone RP23-431N20, complete sequence
          Length = 218665

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    tttttctttcagggttctac 200
              ||||||||||||||||||||
Sbjct: 120340 tttttctttcagggttctac 120359

>gb|AF128224.1|AF128224 Coturnix coturnix japonica keratan sulfate proteoglycan mimecan mRNA,
            complete cds
          Length = 3066

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 172  ctttttacatttttctttca 191
            ||||||||||||||||||||
Sbjct: 1940 ctttttacatttttctttca 1959

>gb|AC155809.3| Mus musculus BAC clone RP24-249H19 from chromosome 8, complete sequence
          Length = 193277

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   tcctttttacatttttcttt 189
             ||||||||||||||||||||
Sbjct: 14754 tcctttttacatttttcttt 14773


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,518,863
Number of Sequences: 3902068
Number of extensions: 1518863
Number of successful extensions: 126443
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126402
Number of HSP's gapped (non-prelim): 41
length of query: 209
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 187
effective length of database: 17,147,199,772
effective search space: 3206526357364
effective search space used: 3206526357364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)