ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags36e10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL662968.3|OSJN00168 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035M09, complete sequence Length = 152732 Score = 50.1 bits (25), Expect = 0.006 Identities = 87/105 (82%), Gaps = 2/105 (1%) Strand = Plus / Plus Query: 88 aaactttcatggggctgctgatcttcggtt-atactctcaaggttcagcatgccccagat 146 |||||||||||||| | || |||||| || ||||||| ||| |||| ||||||||| Sbjct: 59079 aaactttcatggggttattggtcttcgatttatactctgaagtttcaatgtgccccagaa 59138 Query: 147 tatc-catcatgctctacctacaattgtgttgcctaaatagccta 190 |||| |||| ||||||||||| |||| |||||||||| |||||| Sbjct: 59139 tatctcatcgtgctctacctataattccgttgcctaaacagccta 59183
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 50.1 bits (25), Expect = 0.006 Identities = 87/105 (82%), Gaps = 2/105 (1%) Strand = Plus / Plus Query: 88 aaactttcatggggctgctgatcttcggtt-atactctcaaggttcagcatgccccagat 146 |||||||||||||| | || |||||| || ||||||| ||| |||| ||||||||| Sbjct: 30655348 aaactttcatggggttattggtcttcgatttatactctgaagtttcaatgtgccccagaa 30655407 Query: 147 tatc-catcatgctctacctacaattgtgttgcctaaatagccta 190 |||| |||| ||||||||||| |||| |||||||||| |||||| Sbjct: 30655408 tatctcatcgtgctctacctataattccgttgcctaaacagccta 30655452
>dbj|AK102588.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033098F09, full insert sequence Length = 2276 Score = 50.1 bits (25), Expect = 0.006 Identities = 87/105 (82%), Gaps = 2/105 (1%) Strand = Plus / Minus Query: 88 aaactttcatggggctgctgatcttcggtt-atactctcaaggttcagcatgccccagat 146 |||||||||||||| | || |||||| || ||||||| ||| |||| ||||||||| Sbjct: 2099 aaactttcatggggttattggtcttcgatttatactctgaagtttcaatgtgccccagaa 2040 Query: 147 tatc-catcatgctctacctacaattgtgttgcctaaatagccta 190 |||| |||| ||||||||||| |||| |||||||||| |||||| Sbjct: 2039 tatctcatcgtgctctacctataattccgttgcctaaacagccta 1995
>dbj|AK060852.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E10, full insert sequence Length = 1797 Score = 50.1 bits (25), Expect = 0.006 Identities = 87/105 (82%), Gaps = 2/105 (1%) Strand = Plus / Minus Query: 88 aaactttcatggggctgctgatcttcggtt-atactctcaaggttcagcatgccccagat 146 |||||||||||||| | || |||||| || ||||||| ||| |||| ||||||||| Sbjct: 1623 aaactttcatggggttattggtcttcgatttatactctgaagtttcaatgtgccccagaa 1564 Query: 147 tatc-catcatgctctacctacaattgtgttgcctaaatagccta 190 |||| |||| ||||||||||| |||| |||||||||| |||||| Sbjct: 1563 tatctcatcgtgctctacctataattccgttgcctaaacagccta 1519
>emb|Y15484.1|CFY15484 Canis familiaris gene encoding retinal guanylate cyclase E Length = 14515 Score = 44.1 bits (22), Expect = 0.38 Identities = 22/22 (100%) Strand = Plus / Minus Query: 313 acccctgtttcccttgcttcct 334 |||||||||||||||||||||| Sbjct: 264 acccctgtttcccttgcttcct 243
>emb|AL365496.15| Human DNA sequence from clone RP11-449J3 on chromosome 10 Contains the 3' end of the PCDH15 gene for protocadherin 15 and a novel gene, complete sequence Length = 173728 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 280 atgcaaaaatcctctgatctg 300 ||||||||||||||||||||| Sbjct: 12842 atgcaaaaatcctctgatctg 12822
>emb|AL807761.8| Human DNA sequence from clone RP11-196I18 on chromosome 9 Contains the 5' end of a novel gene (FLJ40387), a novel pseudogene, a MMRP19 pseudogene and a novel gene, complete sequence Length = 103861 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 tctcaaggttcagcatgccccaga 145 ||||||| |||||||||||||||| Sbjct: 9229 tctcaagtttcagcatgccccaga 9252
>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 Length = 2039961 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 274 cggcggatgcaaaaatcctc 293 |||||||||||||||||||| Sbjct: 1726223 cggcggatgcaaaaatcctc 1726204
>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 Length = 4170692 Score = 40.1 bits (20), Expect = 5.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 129 gttcagcatgccccagattatcca 152 ||||| |||||||||||||||||| Sbjct: 3870001 gttcaccatgccccagattatcca 3869978
>gb|AY107358.1| Zea mays PCO097235 mRNA sequence Length = 810 Score = 40.1 bits (20), Expect = 5.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 aaagcaacaacatatggaca 27 |||||||||||||||||||| Sbjct: 785 aaagcaacaacatatggaca 766 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,897,773 Number of Sequences: 3902068 Number of extensions: 2897773 Number of successful extensions: 84597 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 84546 Number of HSP's gapped (non-prelim): 47 length of query: 441 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 419 effective length of database: 17,147,199,772 effective search space: 7184676704468 effective search space used: 7184676704468 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
