>gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 209019

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    ctgttcatgtatgtatgatg 62
             ||||||||||||||||||||
Sbjct: 70339 ctgttcatgtatgtatgatg 70358

>gb|AC164970.2| Mus musculus BAC clone RP24-222P1 from chromosome 16, complete sequence
          Length = 202577

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   atggcaataagaacaaacac 142
             ||||||||||||||||||||
Sbjct: 24831 atggcaataagaacaaacac 24812

>gb|AC154700.2| Mus musculus BAC clone RP24-344E15 from chromosome 16, complete sequence
          Length = 199878

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    atggcaataagaacaaacac 142
              ||||||||||||||||||||
Sbjct: 162039 atggcaataagaacaaacac 162020

>gb|AC108053.3| Homo sapiens BAC clone RP11-342I1 from 4, complete sequence
          Length = 94040

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 101   tgagccatgccaagcgcattgaa 123
             ||||||||||||||| |||||||
Sbjct: 66010 tgagccatgccaagctcattgaa 65988

>gb|AC069548.6| Homo sapiens chromosome 10 clone RP11-522H2, complete sequence
          Length = 131909

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 96    gcctatgagccatgccaag 114
             |||||||||||||||||||
Sbjct: 49600 gcctatgagccatgccaag 49618

>gb|AC021203.5| Homo sapiens BAC clone RP11-143E9 from 4, complete sequence
          Length = 142218

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 44     tgttcatgtatgtatgatg 62
              |||||||||||||||||||
Sbjct: 110210 tgttcatgtatgtatgatg 110192

>emb|AL844482.6| Mouse DNA sequence from clone RP23-81A18 on chromosome X, complete
              sequence
          Length = 141997

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 120    tgaatggcaataagaacaaacacccat 146
              |||||||| || |||||||||||||||
Sbjct: 109233 tgaatggccatcagaacaaacacccat 109259

>emb|AL359332.2|CNS05TES Human chromosome 14 DNA sequence BAC R-403E10 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164486

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 43     ctgttcatgtatgtatgat 61
              |||||||||||||||||||
Sbjct: 123759 ctgttcatgtatgtatgat 123741

>emb|AL929258.15| Mouse DNA sequence from clone RP23-351N6 on chromosome 4, complete
             sequence
          Length = 68850

 Score = 38.2 bits (19), Expect = 7.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 33    caacacattnctgttcatgtat 54
             ||||||||| ||||||||||||
Sbjct: 11032 caacacattactgttcatgtat 11053


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,312,976
Number of Sequences: 3902068
Number of extensions: 1312976
Number of successful extensions: 77500
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77486
Number of HSP's gapped (non-prelim): 14
length of query: 151
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 130
effective length of database: 17,151,101,840
effective search space: 2229643239200
effective search space used: 2229643239200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)