ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags36c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) ... 92 5e-16
2gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, c... 92 5e-16
3gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) ... 88 8e-15
4gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, p... 88 8e-15
5gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) ... 84 1e-13
6gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, p... 84 1e-13
7gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, com... 44 0.11
8gb|AF512857.1| Synbranchid sp. VietNam-TC-2002 haplotype 1Uniden... 40 1.7
9emb|BX015829.1|CNS08KDL Single read from an extremity of a full-... 38 6.8
10gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 38 6.8
11ref|XM_311308.2| Anopheles gambiae str. PEST ENSANGP00000017680 ... 38 6.8
12gb|AF297306.1| Anyperodon leucogrammicus 16S ribosomal RNA gene,... 38 6.8

>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds
          Length = 845

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 67/73 (91%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| || ||| ||
Sbjct: 732 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggacaaggggaa 674

                        
Query: 89  gacacgacacgac 101
           |||||||||||||
Sbjct: 673 gacacgacacgac 661



to top

>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds
          Length = 781

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 67/73 (91%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| || ||| ||
Sbjct: 696 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggacaaggggaa 638

                        
Query: 89  gacacgacacgac 101
           |||||||||||||
Sbjct: 637 gacacgacacgac 625



to top

>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds
          Length = 869

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 96/111 (86%), Gaps = 4/111 (3%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| |  ||| ||
Sbjct: 736 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggaccaggggaa 678

                                                              
Query: 89  gacacg--acacgact-nnttatttagaccgacgncacgacaggggacaca 136
           ||||||  ||||||||   ||||||||| ||||| ||||||| ||||||||
Sbjct: 677 gacacgacacacgactctcttatttagatcgacgacacgacacgggacaca 627



to top

>gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, partial cds
          Length = 494

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 96/111 (86%), Gaps = 4/111 (3%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| |  ||| ||
Sbjct: 457 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggaccaggggaa 399

                                                              
Query: 89  gacacg--acacgact-nnttatttagaccgacgncacgacaggggacaca 136
           ||||||  ||||||||   ||||||||| ||||| ||||||| ||||||||
Sbjct: 398 gacacgacacacgactctcttatttagatcgacgacacgacacgggacaca 348



to top

>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds
          Length = 859

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/73 (90%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| |  ||| ||
Sbjct: 740 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggaccaggggaa 682

                        
Query: 89  gacacgacacgac 101
           |||||||||||||
Sbjct: 681 gacacgacacgac 669



to top

>gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, partial cds
          Length = 519

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/73 (90%), Gaps = 1/73 (1%)
 Strand = Plus / Minus

                                                                       
Query: 29  agtccacctaaaaccctnctaaaccaaccacggnagatctcatcgggcgggcaggggcaa 88
           ||||||||||||||||| ||||||||||||||| |||||||||||| ||| |  ||| ||
Sbjct: 470 agtccacctaaaaccctcctaaaccaaccacgg-agatctcatcggacggaccaggggaa 412

                        
Query: 89  gacacgacacgac 101
           |||||||||||||
Sbjct: 411 gacacgacacgac 399



to top

>gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, complete sequence
          Length = 224088

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 15    gcagacactaaagcagtccacc 36
             ||||||||||||||||||||||
Sbjct: 96757 gcagacactaaagcagtccacc 96778



to top

>gb|AF512857.1| Synbranchid sp. VietNam-TC-2002 haplotype 1Unidentified large
           subunit ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 574

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 16  cagacactaaagcagtccacctaaaacc 43
           ||||||||||||||| |||| |||||||
Sbjct: 232 cagacactaaagcagaccacataaaacc 259



to top

>emb|BX015829.1|CNS08KDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ggggcaagacacgacacga 100
           |||||||||||||||||||
Sbjct: 355 ggggcaagacacgacacga 337



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 68      tcatcgggcgggcaggggc 86
               |||||||||||||||||||
Sbjct: 1179749 tcatcgggcgggcaggggc 1179767



to top

>ref|XM_311308.2| Anopheles gambiae str. PEST ENSANGP00000017680
           (ENSANGG00000015191), partial mRNA
          Length = 860

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 82  ggggcaagacacgacacga 100
           |||||||||||||||||||
Sbjct: 390 ggggcaagacacgacacga 372



to top

>gb|AF297306.1| Anyperodon leucogrammicus 16S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 595

 Score = 38.2 bits (19), Expect = 6.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 16  cagacactaaagcagtcca 34
           |||||||||||||||||||
Sbjct: 237 cagacactaaagcagtcca 255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 440,660
Number of Sequences: 3902068
Number of extensions: 440660
Number of successful extensions: 26902
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26867
Number of HSP's gapped (non-prelim): 29
length of query: 142
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 121
effective length of database: 17,151,101,840
effective search space: 2075283322640
effective search space used: 2075283322640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top