Clone Information

BLAST Search Result

Clone Name	rbags35m20
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY596525.1\| Saccharum officinarum clone SCCCCL3001H07, comple...	70	7e-09
2	gb\|AC137924.3\| Oryza sativa (japonica cultivar-group) chromosome...	56	1e-04
3	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	56	1e-04
4	dbj\|AK102030.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	56	1e-04
5	dbj\|AK061179.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	56	1e-04
6	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	56	1e-04
7	gb\|BT016219.1\| Zea mays clone Contig52 mRNA sequence	54	4e-04
8	gb\|AY106129.1\| Zea mays PCO133134 mRNA sequence	54	4e-04
9	emb\|CR533430.7\| Zebrafish DNA sequence from clone DKEYP-87E3 in ...	46	0.11
10	emb\|AL133553.9\| Human DNA sequence from clone GS1-174L6 on chrom...	44	0.43
11	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.43
12	dbj\|AP004999.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.43
13	gb\|AY398398.1\| Danio rerio clone RK137A2F09 primase, polypeptide...	42	1.7
14	ref\|NM_214782.2\| Danio rerio zgc:110727 (zgc:110727), mRNA	42	1.7
15	gb\|CP000115.1\| Nitrobacter winogradskyi Nb-255, complete genome	42	1.7
16	emb\|AL589702.8\| Human DNA sequence from clone RP5-907A6 on chrom...	42	1.7
17	gb\|BC095387.1\| Danio rerio zgc:110727, mRNA (cDNA clone MGC:1107...	42	1.7
18	ref\|XM_697637.1\| PREDICTED: Danio rerio hypothetical protein LOC...	42	1.7
19	gb\|AC158478.2\| Postia placenta clone JGIACWS-9F3, complete sequence	42	1.7
20	gb\|CP000110.1\| Synechococcus sp. CC9605, complete genome	40	6.7
21	ref\|XM_984556.1\| PREDICTED: Mus musculus homeo box A13 (Hoxa13),...	40	6.7
22	emb\|AM085146.1\| Magnetospirillum gryphiswaldense magnetosome island	40	6.7
23	emb\|BX927336.18\| Zebrafish DNA sequence from clone CH211-215P11 ...	40	6.7
24	gb\|AC073094.11\| Homo sapiens BAC clone RP11-369D24 from 7, compl...	40	6.7
25	emb\|BX927085.4\| Human DNA sequence from clone CITF22-37A6 on chr...	40	6.7
26	emb\|AL392048.9\| Human DNA sequence from clone RP11-305D15 on chr...	40	6.7
27	emb\|AL121756.14\|HSDJ726C3 Human DNA sequence from clone RP4-726C...	40	6.7
28	emb\|AL031847.17\|HS120G22 Human DNA sequence from clone RP1-120G2...	40	6.7
29	emb\|BX284746.1\|NCB23I4 Neurospora crassa DNA linkage group II BA...	40	6.7
30	emb\|BX548067.34\| Zebrafish DNA sequence from clone DKEY-261O4 in...	40	6.7
31	emb\|CR388095.8\| Zebrafish DNA sequence from clone CH211-199M9 in...	40	6.7
32	gb\|AE017285.1\| Desulfovibrio vulgaris subsp. vulgaris str. Hilde...	40	6.7
33	gb\|AC104650.2\| Homo sapiens BAC clone RP11-117J13 from 4, comple...	40	6.7
34	gb\|AC064869.6\| Homo sapiens BAC clone RP11-534J18 from 2, comple...	40	6.7
35	gb\|AC093526.5\| Homo sapiens chromosome 16 clone RP11-213K2, comp...	40	6.7
36	gb\|AC131092.2\| Homo sapiens BAC clone RP11-112E5 from 2, complet...	40	6.7
37	emb\|BX321870.12\| Zebrafish DNA sequence from clone RP71-42A14 in...	40	6.7
38	emb\|CR394522.8\| Zebrafish DNA sequence from clone DKEY-159D6 in ...	40	6.7
39	gb\|AY902474.1\| Magnetospirillum gryphiswaldense putative sulfate...	40	6.7
40	gb\|AC002525.1\|AC002525 Human PAC clone 257C22A from 13q12-q13, c...	40	6.7
41	gb\|L11910.1\|HUMRETBLAS Human retinoblastoma susceptibility gene ...	40	6.7
42	gb\|AF551763.1\| Homo sapiens retinoblastoma 1 (including osteosar...	40	6.7

>gb|AY596525.1| Saccharum officinarum clone SCCCCL3001H07, complete sequence
          Length = 2720

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 38/39 (97%)
 Strand = Plus / Plus

                                                  
Query: 244 ccaaaattatatactctccgaagagcgcctccaggagag 282
           |||||||||||||||||||||||| ||||||||||||||
Sbjct: 267 ccaaaattatatactctccgaagatcgcctccaggagag 305

to top

>gb|AC137924.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0095K08,
              complete sequence
          Length = 180999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 244    ccaaaattatatactctccgaagagcgcctccaggagagt 283
              |||||||||||||||||||||| ||||||  |||||||||
Sbjct: 143251 ccaaaattatatactctccgaacagcgccagcaggagagt 143290

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 244     ccaaaattatatactctccgaagagcgcctccaggagagt 283
               |||||||||||||||||||||| ||||||  |||||||||
Sbjct: 7854697 ccaaaattatatactctccgaacagcgccagcaggagagt 7854658

to top

>dbj|AK102030.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033080P19, full
            insert sequence
          Length = 2128

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 244  ccaaaattatatactctccgaagagcgcctccaggagagt 283
            |||||||||||||||||||||| ||||||  |||||||||
Sbjct: 1945 ccaaaattatatactctccgaacagcgccagcaggagagt 1906

to top

>dbj|AK061179.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D03, full
           insert sequence
          Length = 1204

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 244 ccaaaattatatactctccgaagagcgcctccaggagagt 283
           |||||||||||||||||||||| ||||||  |||||||||
Sbjct: 971 ccaaaattatatactctccgaacagcgccagcaggagagt 932

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 244     ccaaaattatatactctccgaagagcgcctccaggagagt 283
               |||||||||||||||||||||| ||||||  |||||||||
Sbjct: 7924784 ccaaaattatatactctccgaacagcgccagcaggagagt 7924745

to top

>gb|BT016219.1| Zea mays clone Contig52 mRNA sequence
          Length = 683

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 248 aattatatactctccgaagagcgcctccaggagag 282
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 450 aattatatactctccgaagatcgcctgcaggagag 416

to top

>gb|AY106129.1| Zea mays PCO133134 mRNA sequence
          Length = 2072

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 248  aattatatactctccgaagagcgcctccaggagag 282
            |||||||||||||||||||| ||||| ||||||||
Sbjct: 1856 aattatatactctccgaagatcgcctgcaggagag 1822

to top

>emb|CR533430.7| Zebrafish DNA sequence from clone DKEYP-87E3 in linkage group 20 Contains
              two novel genes, complete sequence
          Length = 193255

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 465    aacgagaaaacgcgggaggtggt 487
              |||||||||||||||||||||||
Sbjct: 141716 aacgagaaaacgcgggaggtggt 141694



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    aacgagaaaacgcgggaggt 484
              ||||||||||||||||||||
Sbjct: 123366 aacgagaaaacgcgggaggt 123385

to top

>emb|AL133553.9| Human DNA sequence from clone GS1-174L6 on chromosome 1 Contains the 3'
              end of the gene for hemicentin, the PRG4 gene for
              proteoglycan 4 (megakaryocyte stimulating factor, articular
              superficial zone protein, amptodactyly, arthropathy, coxa
              vara, pericarditis syndrome), the 3' end of the TPR gene
              for translocated promoter region (to activated MET
              oncogene) and a novel gene, complete sequence
          Length = 190655

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 102    gaaaactggagaaacatgtttc 123
              ||||||||||||||||||||||
Sbjct: 102765 gaaaactggagaaacatgtttc 102744

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 55       atgtttcagtcacaactcacaa 76
                ||||||||||||||||||||||
Sbjct: 17429325 atgtttcagtcacaactcacaa 17429346

to top

>dbj|AP004999.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0040H05
          Length = 172623

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 55    atgtttcagtcacaactcacaa 76
             ||||||||||||||||||||||
Sbjct: 41322 atgtttcagtcacaactcacaa 41343

to top

>gb|AY398398.1| Danio rerio clone RK137A2F09 primase, polypeptide 2A, 58kDa (PRIM2A)
            mRNA, complete cds
          Length = 1751

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 16   atgtttgggaaggaaggcaag 36
            |||||||||||||||||||||
Sbjct: 1125 atgtttgggaaggaaggcaag 1145

to top

>ref|NM_214782.2| Danio rerio zgc:110727 (zgc:110727), mRNA
          Length = 2086

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 16   atgtttgggaaggaaggcaag 36
            |||||||||||||||||||||
Sbjct: 1447 atgtttgggaaggaaggcaag 1467

to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 120     tttctcaacgacgacgatgct 140
               |||||||||||||||||||||
Sbjct: 2820736 tttctcaacgacgacgatgct 2820756

to top

>emb|AL589702.8| Human DNA sequence from clone RP5-907A6 on chromosome 1, complete
             sequence
          Length = 107103

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 350   aagatggatggatggtgggtg 370
             |||||||||||||||||||||
Sbjct: 79605 aagatggatggatggtgggtg 79585



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 350   aagatggatggatggtgggtg 370
             |||||||||||||||||||||
Sbjct: 79547 aagatggatggatggtgggtg 79527



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 350   aagatggatggatggtgggtg 370
             |||||||||||||||||||||
Sbjct: 79466 aagatggatggatggtgggtg 79446



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 350   aagatggatggatggtgggtg 370
             |||||||||||||||||||||
Sbjct: 79396 aagatggatggatggtgggtg 79376

to top

>gb|BC095387.1| Danio rerio zgc:110727, mRNA (cDNA clone MGC:110727 IMAGE:7177190),
            complete cds
          Length = 2086

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 16   atgtttgggaaggaaggcaag 36
            |||||||||||||||||||||
Sbjct: 1447 atgtttgggaaggaaggcaag 1467

to top

>ref|XM_697637.1| PREDICTED: Danio rerio hypothetical protein LOC555151 (LOC555151),
           mRNA
          Length = 977

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 16  atgtttgggaaggaaggcaag 36
           |||||||||||||||||||||
Sbjct: 362 atgtttgggaaggaaggcaag 382

to top

>gb|AC158478.2| Postia placenta clone JGIACWS-9F3, complete sequence
          Length = 26907

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 348   tgaagatggatggatggtggg 368
             |||||||||||||||||||||
Sbjct: 15967 tgaagatggatggatggtggg 15947

to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 400     ccgatgaccgatgccgatgc 419
               ||||||||||||||||||||
Sbjct: 2497230 ccgatgaccgatgccgatgc 2497249

to top

>ref|XM_984556.1| PREDICTED: Mus musculus homeo box A13 (Hoxa13), mRNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 atgtttctcaacgacgacga 136
           ||||||||||||||||||||
Sbjct: 601 atgtttctcaacgacgacga 620

to top

>emb|AM085146.1| Magnetospirillum gryphiswaldense magnetosome island
          Length = 130000

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   atgcttatatcatctttttg 155
             ||||||||||||||||||||
Sbjct: 33929 atgcttatatcatctttttg 33948

to top

>emb|BX927336.18| Zebrafish DNA sequence from clone CH211-215P11 in linkage group 5,
              complete sequence
          Length = 200686

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    aacgagaaaacgcgggaggt 484
              ||||||||||||||||||||
Sbjct: 168402 aacgagaaaacgcgggaggt 168421

to top

>gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, complete sequence
          Length = 189126

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    agatggatggatggtgggtg 370
              ||||||||||||||||||||
Sbjct: 146395 agatggatggatggtgggtg 146376

to top

>emb|BX927085.4| Human DNA sequence from clone CITF22-37A6 on chromosome 22, complete
            sequence
          Length = 38134

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 351  agatggatggatggtgggtg 370
            ||||||||||||||||||||
Sbjct: 7864 agatggatggatggtgggtg 7845

to top

>emb|AL392048.9| Human DNA sequence from clone RP11-305D15 on chromosome 13 Contains the
             5' end of the RB1 gene for retinoblastoma 1 (including
             osteosarcoma), two novel genes, the gene for purinergic
             receptor (family A group 5) (P2Y5), a PEST-containing
             nuclear protein (PCNP) pseudogene, a KIAA0649 gene product
             pseudogene, the 3' end of a novel gene and three CpG
             islands, complete sequence
          Length = 137342

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 469   agaaaacgcgggaggtggtg 488
             ||||||||||||||||||||
Sbjct: 30221 agaaaacgcgggaggtggtg 30202

to top

>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the
             C20orf185 gene for the possible ortholog of potential
             ligand_binding protein RYA3 (Rat), the C20orf186 gene for
             the possible ortholog of potential ligand_binding protein
             RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm
             associated antigen 4-like, a novel gene, a FAM16AX (family
             with sequence similarity 16, member A, X-linked)
             pseudogene, the BPIL3 gene for
             bactericidal/permeability-increasing protein-like 3 and a
             CpG island, complete sequence
          Length = 129502

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 349   gaagatggatggatggtggg 368
             ||||||||||||||||||||
Sbjct: 92553 gaagatggatggatggtggg 92572

to top

>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
              Contains the 5' end of the CHD5 gene for  chromodomain
              helicase DNA binding protein 5, the RPL22 gene for
              ribosomal protein L22, eight novel genes, the ICMT gene for
              isoprenylcysteine carboxyl methyltransferase, possible
              ortholog of rodent transcription factor HES-3, the 3' end
              of the gene for brain acyl-CoA hydrolase (BACH) and seven
              CpG islands, complete sequence
          Length = 166518

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    agatggatggatggtgggtg 370
              ||||||||||||||||||||
Sbjct: 135367 agatggatggatggtgggtg 135348

to top

>emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BAC contig B23I4
          Length = 71047

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 346   gatgaagatggatggatggt 365
             ||||||||||||||||||||
Sbjct: 25823 gatgaagatggatggatggt 25842

to top

>emb|BX548067.34| Zebrafish DNA sequence from clone DKEY-261O4 in linkage group 5, complete
              sequence
          Length = 181547

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 465    aacgagaaaacgcgggaggt 484
              ||||||||||||||||||||
Sbjct: 112654 aacgagaaaacgcgggaggt 112673

to top

>emb|CR388095.8| Zebrafish DNA sequence from clone CH211-199M9 in linkage group 14,
             complete sequence
          Length = 208632

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 465   aacgagaaaacgcgggaggt 484
             ||||||||||||||||||||
Sbjct: 40907 aacgagaaaacgcgggaggt 40926

to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete
              genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 323    gcggatgtcgacaagcagggtacg 346
              |||| |||||||||||||||||||
Sbjct: 414293 gcggttgtcgacaagcagggtacg 414316

to top

>gb|AC104650.2| Homo sapiens BAC clone RP11-117J13 from 4, complete sequence
          Length = 163948

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 351   agatggatggatggtgggtg 370
             ||||||||||||||||||||
Sbjct: 67371 agatggatggatggtgggtg 67352

to top

>gb|AC064869.6| Homo sapiens BAC clone RP11-534J18 from 2, complete sequence
          Length = 169514

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 103 aaaactggagaaacatgtttctca 126
           |||||||||||||||| |||||||
Sbjct: 575 aaaactggagaaacatatttctca 598

to top

>gb|AC093526.5| Homo sapiens chromosome 16 clone RP11-213K2, complete sequence
          Length = 178734

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    agatggatggatggtgggtg 370
              ||||||||||||||||||||
Sbjct: 116078 agatggatggatggtgggtg 116059

to top

>gb|AC131092.2| Homo sapiens BAC clone RP11-112E5 from 2, complete sequence
          Length = 5680

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 103  aaaactggagaaacatgtttctca 126
            |||||||||||||||| |||||||
Sbjct: 4255 aaaactggagaaacatatttctca 4278

to top

>emb|BX321870.12| Zebrafish DNA sequence from clone RP71-42A14 in linkage group 22,
             complete sequence
          Length = 165445

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 465   aacgagaaaacgcgggaggt 484
             ||||||||||||||||||||
Sbjct: 64984 aacgagaaaacgcgggaggt 64965

to top

>emb|CR394522.8| Zebrafish DNA sequence from clone DKEY-159D6 in linkage group 22,
             complete sequence
          Length = 91897

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 347   atgaagatggatggatggtg 366
             ||||||||||||||||||||
Sbjct: 50201 atgaagatggatggatggtg 50182

to top

>gb|AY902474.1| Magnetospirillum gryphiswaldense putative sulfate permease,
           putative axonemal protein, putative transposases,
           putative Pi-transporter-like B1, and CheY-like receiver
           genes, complete cds
          Length = 5045

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 atgcttatatcatctttttg 155
           ||||||||||||||||||||
Sbjct: 634 atgcttatatcatctttttg 653

to top

>gb|AC002525.1|AC002525 Human PAC clone 257C22A from 13q12-q13, complete sequence
          Length = 140942

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 291   gtgagcctccatctcggggtggtg 314
             ||||| ||||||||||||||||||
Sbjct: 62414 gtgagactccatctcggggtggtg 62437

to top

>gb|L11910.1|HUMRETBLAS Human retinoblastoma susceptibility gene exons 1-27, complete cds
          Length = 180388

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 469   agaaaacgcgggaggtggtg 488
             ||||||||||||||||||||
Sbjct: 16789 agaaaacgcgggaggtggtg 16770

to top

>gb|AF551763.1| Homo sapiens retinoblastoma 1 (including osteosarcoma) (RB1) and
             purinergic receptor (family A group 5) (P2Y5) genes,
             complete cds
          Length = 180782

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 469   agaaaacgcgggaggtggtg 488
             ||||||||||||||||||||
Sbjct: 16771 agaaaacgcgggaggtggtg 16752


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,557,051
Number of Sequences: 3902068
Number of extensions: 3557051
Number of successful extensions: 86461
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86194
Number of HSP's gapped (non-prelim): 267
length of query: 492
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 470
effective length of database: 17,147,199,772
effective search space: 8059183892840
effective search space used: 8059183892840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result