ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags36b05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474473.1| Oryza sativa (japonica cultivar-group), predic... 66 5e-08
2emb|AL606656.3|OSJN00099 Oryza sativa genomic DNA, chromosome 4,... 66 5e-08
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 66 5e-08
4dbj|AK099298.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 5e-08
5dbj|AK059422.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 5e-08
6gb|AF095707.1|AF095707 Oryza sativa clone LS273 30S ribosomal pr... 66 5e-08
7gb|BT016599.1| Zea mays clone Contig432 mRNA sequence 56 5e-05
8emb|Y19204.1|ZMA19204 Zea mays chloroplast mRNA for 30S ribosoma... 56 5e-05
9gb|AY105768.1| Zea mays PCO117196 mRNA sequence 56 5e-05
10gb|AF357202.1| Streptomyces nodosus amphotericin biosynthetic ge... 42 0.75
11ref|NM_172584.1| Mus musculus inositol 1,3,4-triphosphate 5/6 ki... 40 2.9
12gb|BC056464.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kina... 40 2.9
13gb|BC025917.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kina... 40 2.9
14gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, ex... 40 2.9
15gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, e... 40 2.9
16gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, e... 40 2.9
17gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, ex... 40 2.9
18gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, ex... 40 2.9
19gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene,... 40 2.9
20gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene,... 40 2.9
21gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, ... 40 2.9
22gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, ... 40 2.9
23gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, ex... 40 2.9
24gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene... 40 2.9
25gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, ... 40 2.9
26gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, ... 40 2.9
27gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, e... 40 2.9
28gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, e... 40 2.9
29gb|BC031182.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kina... 40 2.9
30gb|AC016588.9| Homo sapiens chromosome 19 clone CTD-3113P16, com... 40 2.9
31gb|AY044828.1| Sus scrofa tyrosine hydroxylase gene, partial cds... 40 2.9
32gb|AC010641.9| Homo sapiens chromosome 19 clone LLNLF19FOS22E10,... 40 2.9
33gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome... 40 2.9
34dbj|AK038913.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 2.9
35gb|AF263916.1|AF263916 Sus scrofa insulin gene, 5' flanking sequ... 40 2.9
36gb|AF000263.1| Caenorhabditis elegans cosmid T08B2, complete seq... 40 2.9
37gb|AC008126.9|AC008126 Homo sapiens 12 BAC RPCI11-90E9 (Roswell ... 40 2.9
38dbj|AK187570.1| Mus musculus cDNA, clone:Y0G0142E24, strand:minu... 40 2.9
39emb|Z96436.1|HS19PT009 H.sapiens telomeric DNA sequence, clone 1... 40 2.9
40emb|Z81107.1|CER07H5 Caenorhabditis elegans Cosmid R07H5, comple... 40 2.9
41gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons... 40 2.9
42gb|M81893.1|DOGIDUA Canis sp. alpha-L-iduronidase (IDUA) mRNA, c... 40 2.9 
>ref|XM_474473.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3234

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                        
Query: 138  ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
            |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 3183 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 3124

                     
Query: 198  ggggacggc 206
            |||||||||
Sbjct: 3123 ggggacggc 3115
to top
>emb|AL606656.3|OSJN00099 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0020J19,
             complete sequence
          Length = 123272

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                         
Query: 138   ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
             |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 41932 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 41873

                      
Query: 198   ggggacggc 206
             |||||||||
Sbjct: 41872 ggggacggc 41864
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                            
Query: 138      ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
                |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 35417129 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 35417070

                         
Query: 198      ggggacggc 206
                |||||||||
Sbjct: 35417069 ggggacggc 35417061
to top
>dbj|AK099298.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023135M11, full
           insert sequence
          Length = 631

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 138 ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
           |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 419 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 360

                    
Query: 198 ggggacggc 206
           |||||||||
Sbjct: 359 ggggacggc 351
to top
>dbj|AK059422.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-E01, full
           insert sequence
          Length = 596

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 138 ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
           |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 453 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 394

                    
Query: 198 ggggacggc 206
           |||||||||
Sbjct: 393 ggggacggc 385
to top
>gb|AF095707.1|AF095707 Oryza sativa clone LS273 30S ribosomal protein S17 (rps17) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 966

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 138 ggactgtgactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcgggac 197
           |||||| |||| ||| || || |||||||||| |||||||||||||||||| || |||| 
Sbjct: 440 ggactgggactggagaggcgggaggagctgggacttgcggcgggtgtcgcgcggggggag 381

                    
Query: 198 ggggacggc 206
           |||||||||
Sbjct: 380 ggggacggc 372
to top
>gb|BT016599.1| Zea mays clone Contig432 mRNA sequence
          Length = 656

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 145 gactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcggga 196
           |||| |||||| || |||||||| | ||||||||| ||||||||||||||||
Sbjct: 424 gactggagcggcggtaggagctgagacttgcggcgagtgtcgcggggcggga 373
to top
>emb|Y19204.1|ZMA19204 Zea mays chloroplast mRNA for 30S ribosomal protein S17
          Length = 643

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 145 gactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcggga 196
           |||| |||||| || |||||||| | ||||||||| ||||||||||||||||
Sbjct: 396 gactggagcggcggtaggagctgagacttgcggcgagtgtcgcggggcggga 345
to top
>gb|AY105768.1| Zea mays PCO117196 mRNA sequence
          Length = 695

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 145 gactcgagcggaggaaggagctgggccttgcggcgggtgtcgcggggcggga 196
           |||| |||||| || |||||||| | ||||||||| ||||||||||||||||
Sbjct: 422 gactggagcggcggtaggagctgagacttgcggcgagtgtcgcggggcggga 371
to top
>gb|AF357202.1| Streptomyces nodosus amphotericin biosynthetic gene cluster, complete
             sequence
          Length = 113193

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   gggccttgcggcgggtgtcgc 187
             |||||||||||||||||||||
Sbjct: 73936 gggccttgcggcgggtgtcgc 73916
to top
>ref|NM_172584.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kinase (Itpk1), mRNA
          Length = 2858

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  aggaaggagctgggccttgc 175
            ||||||||||||||||||||
Sbjct: 2353 aggaaggagctgggccttgc 2334
to top
>gb|BC056464.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kinase, mRNA (cDNA clone
            MGC:67230 IMAGE:5707377), complete cds
          Length = 2849

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  aggaaggagctgggccttgc 175
            ||||||||||||||||||||
Sbjct: 2332 aggaaggagctgggccttgc 2313
to top
>gb|BC025917.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kinase, mRNA (cDNA clone
            IMAGE:5026869), partial cds
          Length = 2162

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  aggaaggagctgggccttgc 175
            ||||||||||||||||||||
Sbjct: 1631 aggaaggagctgggccttgc 1612
to top
>gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28397

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1394 gcggaggaaggagctgggcc 1375
to top
>gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, exon 14;
            preproinsulin (INS) gene, complete cds; and insulin-like
            growth factor 2 preproprotein (IGF2) gene, complete cds,
            alternatively spliced
          Length = 28190

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1227 gcggaggaaggagctgggcc 1208
to top
>gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, exon 14;
            preproinsulin (INS) gene, complete cds; and insulin-like
            growth factor 2 preproprotein (IGF2) gene, complete cds,
            alternatively spliced
          Length = 28177

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1241 gcggaggaaggagctgggcc 1222
to top
>gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, exon 14; preproinsulin
            (INS) gene, complete cds; and insulin-like growth factor
            2 preproprotein (IGF2) gene, complete cds, alternatively
            spliced
          Length = 28188

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1253 gcggaggaaggagctgggcc 1234
to top
>gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28209

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1279 gcggaggaaggagctgggcc 1260
to top
>gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1477 gcggaggaaggagctgggcc 1458
to top
>gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28658

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1477 gcggaggaaggagctgggcc 1458
to top
>gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28267

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1306 gcggaggaaggagctgggcc 1287
to top
>gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28684

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1486 gcggaggaaggagctgggcc 1467
to top
>gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28376

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1379 gcggaggaaggagctgggcc 1360
to top
>gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene, exon 14 and
            partial cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28661

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1464 gcggaggaaggagctgggcc 1445
to top
>gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28659

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1477 gcggaggaaggagctgggcc 1458
to top
>gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28649

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1477 gcggaggaaggagctgggcc 1458
to top
>gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, exon 14;
            preproinsulin (INS) gene, complete cds; and insulin-like
            growth factor 2 preproprotein (IGF2) gene, complete cds,
            alternatively spliced
          Length = 28219

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1255 gcggaggaaggagctgggcc 1236
to top
>gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, exon 14 and partial
            cds; preproinsulin (INS) gene, complete cds; and
            insulin-like growth factor 2 preproprotein (IGF2) gene,
            complete cds, alternatively spliced
          Length = 28593

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 1463 gcggaggaaggagctgggcc 1444
to top
>gb|BC031182.1| Mus musculus inositol 1,3,4-triphosphate 5/6 kinase, mRNA (cDNA clone
            IMAGE:4988501), partial cds
          Length = 1932

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  aggaaggagctgggccttgc 175
            ||||||||||||||||||||
Sbjct: 1413 aggaaggagctgggccttgc 1394
to top
>gb|AC016588.9| Homo sapiens chromosome 19 clone CTD-3113P16, complete sequence
          Length = 144578

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     agtaatgagggaaagcaaaa 83
              ||||||||||||||||||||
Sbjct: 135840 agtaatgagggaaagcaaaa 135859
to top
>gb|AY044828.1| Sus scrofa tyrosine hydroxylase gene, partial cds; and preproinsulin
            (INS) and insulin-like-growth factor 2 preproprotein
            (IGF2) genes, complete cds, alternatively spliced
          Length = 32467

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  gcggaggaaggagctgggcc 171
            ||||||||||||||||||||
Sbjct: 3462 gcggaggaaggagctgggcc 3443
to top
>gb|AC010641.9| Homo sapiens chromosome 19 clone LLNLF19FOS22E10, complete sequence
          Length = 34877

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 64   agtaatgagggaaagcaaaa 83
            ||||||||||||||||||||
Sbjct: 3843 agtaatgagggaaagcaaaa 3862
to top
>gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome 12, complete sequence
          Length = 216718

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    aggaaggagctgggccttgc 175
              ||||||||||||||||||||
Sbjct: 113475 aggaaggagctgggccttgc 113456
to top
>dbj|AK038913.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230074J21 product:INOSITOL 3,4,5,6
            TETRAKISPHOSPHATE 1-KINASE/INOSITOL 1,3,4-TRISPHOSPHATE
            5/6-KINASE homolog [Homo sapiens], full insert sequence
          Length = 2858

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 156  aggaaggagctgggccttgc 175
            ||||||||||||||||||||
Sbjct: 2353 aggaaggagctgggccttgc 2334
to top
>gb|AF263916.1|AF263916 Sus scrofa insulin gene, 5' flanking sequence
          Length = 1022

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 152 gcggaggaaggagctgggcc 171
           ||||||||||||||||||||
Sbjct: 299 gcggaggaaggagctgggcc 280
to top
>gb|AF000263.1| Caenorhabditis elegans cosmid T08B2, complete sequence
          Length = 28189

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ggacgattaattaattaaca 61
             ||||||||||||||||||||
Sbjct: 17681 ggacgattaattaattaaca 17700
to top
>gb|AC008126.9|AC008126 Homo sapiens 12 BAC RPCI11-90E9 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 173545

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 18    agtaatagcagtaggaaaagggaa 41
             ||||||||||| ||||||||||||
Sbjct: 91897 agtaatagcagaaggaaaagggaa 91920
to top
>dbj|AK187570.1| Mus musculus cDNA, clone:Y0G0142E24, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000046518, based on BLAT search
          Length = 418

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 156 aggaaggagctgggccttgc 175
           ||||||||||||||||||||
Sbjct: 49  aggaaggagctgggccttgc 30
to top
>emb|Z96436.1|HS19PT009 H.sapiens telomeric DNA sequence, clone 19PTEL009, read
          19PTELOO009.seq
          Length = 1012

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 agtaatgagggaaagcaaaa 83
          ||||||||||||||||||||
Sbjct: 79 agtaatgagggaaagcaaaa 60
to top
>emb|Z81107.1|CER07H5 Caenorhabditis elegans Cosmid R07H5, complete sequence
          Length = 33802

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    ggacgattaattaattaaca 61
             ||||||||||||||||||||
Sbjct: 19354 ggacgattaattaattaaca 19373
to top
>gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons 7-12
          Length = 1557

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 180 ggtgtcgcggggcgggacgg 199
           ||||||||||||||||||||
Sbjct: 690 ggtgtcgcggggcgggacgg 709
to top
>gb|M81893.1|DOGIDUA Canis sp. alpha-L-iduronidase (IDUA) mRNA, complete cds
          Length = 2175

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 180  ggtgtcgcggggcgggacgg 199
            ||||||||||||||||||||
Sbjct: 1275 ggtgtcgcggggcgggacgg 1294


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,762,698
Number of Sequences: 3902068
Number of extensions: 1762698
Number of successful extensions: 47774
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47717
Number of HSP's gapped (non-prelim): 57
length of query: 230
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 208
effective length of database: 17,147,199,772
effective search space: 3566617552576
effective search space used: 3566617552576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top