ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags36a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY557340.2| Triticum aestivum root hair defective 3 GTP-bindi... 287 1e-74
2gb|AC185139.2| Pan troglodytes BAC clone CH251-174C16 from chrom... 42 0.97
3gb|AY359583.1| Zea mays B73 Etr2-like ethylene receptor (ETR61) ... 42 0.97
4gb|AC104651.2| Homo sapiens BAC clone RP11-217P16 from 2, comple... 42 0.97
5gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome 40 3.8
6gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 3.8
7gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 3.8
8gb|AC106017.11| Homo sapiens chromosome 17, clone RP11-744A16, c... 40 3.8
9gb|AF522077.2| Lactobacillus plantarum strain NC8 bacteriocin pr... 40 3.8
10gb|AC005099.2| Homo sapiens BAC clone CTA-351J1 from 7, complete... 40 3.8
11gb|CP000001.1| Bacillus cereus E33L, complete genome 40 3.8
12emb|Z86064.2|HS435D1 Human DNA sequence from clone RP3-435D1 on ... 40 3.8
13emb|AL353715.21| Human DNA sequence from clone CTD-3184A7 on chr... 40 3.8
14emb|X94434.1|LPATOVGNS L.plantarum pln[A,B,C,D,E,F,G,H,I,J,K,L,M... 40 3.8
15emb|AL935253.1| Lactobacillus plantarum strain WCFS1 complete ge... 40 3.8
16gb|AC105213.5| Homo sapiens chromosome 8, clone RP11-346A14, com... 40 3.8
17gb|AC144506.1| Homo sapiens chromosome 17, clone XXfos-800635C12... 40 3.8
18gb|AC139077.2| Homo sapiens chromosome 17, clone XXfos-88899C12,... 40 3.8
19gb|AC007952.15| Homo sapiens chromosome 17, clone RP11-160E2, co... 40 3.8
20gb|AC140106.1| Homo sapiens chromosome 17, clone XXfos-801239H9,... 40 3.8
21gb|AF217796.1|AF217796 Homo sapiens SCG10 like-protein, helicase... 40 3.8
22emb|AL132777.4|CNS01DTI Human chromosome 14 DNA sequence BAC R-3... 40 3.8
23emb|AL049874.3|CNS0000Q Human chromosome 14 DNA sequence BAC R-1... 40 3.8
24gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 3.8
25gb|AC005389.1|AC005389 Homo sapiens chromosome 17, clone hRPK.60... 40 3.8
26gb|AC157784.2| Mus musculus chromosome 18, clone RP24-163C18, co... 40 3.8

>gb|AY557340.2| Triticum aestivum root hair defective 3 GTP-binding protein (wrsi2)
            mRNA, complete cds
          Length = 2800

 Score =  287 bits (145), Expect = 1e-74
 Identities = 221/247 (89%), Gaps = 5/247 (2%)
 Strand = Plus / Minus

                                                                        
Query: 49   gaagttnttctacaacgtttcttacaaacgattcccagccccaaaattccatatatgaca 108
            |||||| |||||||| |||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 2733 gaagttattctacaatgtttcttacaaacgattcccagccccaaaattccttatataaca 2674

                                                                        
Query: 109  gctgnggnctcttccacataattttcatncatcagctcgggangggca----agcgtaga 164
            |||| || |||||||||| |||| |||| |||||| | |||| |||||    |||||| |
Sbjct: 2673 gctgtggactcttccacaaaattctcatacatcaggttgggaagggcaagcgagcgtaca 2614

                                                                        
Query: 165  aaaaccgcagggcacttcaatctcctaggctcaaaccgttgcagctncaactgggtagag 224
            ||||||||| |||||||||||||||||||||||||||||||||||| || ||  ||||||
Sbjct: 2613 aaaaccgcaaggcacttcaatctcctaggctcaaaccgttgcagctacagct-agtagag 2555

                                                                        
Query: 225  ttttcagctaaaagctagggatcccctcctcattgngctaccgggcttgaatattcaggt 284
             ||||||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||
Sbjct: 2554 ctttcagctaaaagctagggatccactcatcattgtgctaccgggcttgaatattcaggt 2495

                   
Query: 285  ccattct 291
            |||||||
Sbjct: 2494 ccattct 2488



to top

>gb|AC185139.2| Pan troglodytes BAC clone CH251-174C16 from chromosome 2, complete
              sequence
          Length = 166804

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    acttcaatctcctaggctcaa 198
              |||||||||||||||||||||
Sbjct: 120745 acttcaatctcctaggctcaa 120725



to top

>gb|AY359583.1| Zea mays B73 Etr2-like ethylene receptor (ETR61) pseudogene, partial
            sequence
          Length = 9532

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 57   tctacaacgtttcttacaaac 77
            |||||||||||||||||||||
Sbjct: 2855 tctacaacgtttcttacaaac 2835



to top

>gb|AC104651.2| Homo sapiens BAC clone RP11-217P16 from 2, complete sequence
          Length = 106954

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   acttcaatctcctaggctcaa 198
             |||||||||||||||||||||
Sbjct: 45203 acttcaatctcctaggctcaa 45183



to top

>gb|CP000109.1| Thiomicrospira crunogena XCL-2, complete genome
          Length = 2427734

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 64      cgtttcttacaaacgattcc 83
               ||||||||||||||||||||
Sbjct: 1412044 cgtttcttacaaacgattcc 1412025



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     ctacaacgtttcttacaaac 77
              ||||||||||||||||||||
Sbjct: 800240 ctacaacgtttcttacaaac 800221



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     ctacaacgtttcttacaaac 77
              ||||||||||||||||||||
Sbjct: 800135 ctacaacgtttcttacaaac 800116



to top

>gb|AC106017.11| Homo sapiens chromosome 17, clone RP11-744A16, complete sequence
          Length = 178625

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    tcaatctcctaggctcaaac 200
              ||||||||||||||||||||
Sbjct: 122595 tcaatctcctaggctcaaac 122576



to top

>gb|AF522077.2| Lactobacillus plantarum strain NC8 bacteriocin production locus,
            partial sequence
          Length = 12350

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 180  ttcaatctcctaggctcaaa 199
            ||||||||||||||||||||
Sbjct: 6694 ttcaatctcctaggctcaaa 6675



to top

>gb|AC005099.2| Homo sapiens BAC clone CTA-351J1 from 7, complete sequence
          Length = 131611

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   cttcaatctcctaggctcaa 198
             ||||||||||||||||||||
Sbjct: 85016 cttcaatctcctaggctcaa 84997



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     ctacaacgtttcttacaaac 77
              ||||||||||||||||||||
Sbjct: 783150 ctacaacgtttcttacaaac 783131



to top

>emb|Z86064.2|HS435D1 Human DNA sequence from clone RP3-435D1 on chromosome Xq25 Contains the
             3' end of the HS6ST2 gene for heparan sulfate
             6-O-sulfotransferase 2, a novel gene and the 3' end of a
             novel gene, complete sequence
          Length = 184975

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 17972 tcaatctcctaggctcaaac 17953



to top

>emb|AL353715.21| Human DNA sequence from clone CTD-3184A7 on chromosome 20 Contains the
             5' end of the GMEB2 gene for glucocorticoid modulatory
             element binding protein 2, the gene for SCG10-like protein
             (SCLIP) (ortholog of rabbit neuroplasticin-2 (NPC2)), the
             TNFRSF6B gene for member 6 (decoy) of tumor necrosis
             factor receptor superfamily, a novel gene and four CpG
             islands, complete sequence
          Length = 92458

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 17086 tcaatctcctaggctcaaac 17067



to top

>emb|X94434.1|LPATOVGNS L.plantarum pln[A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,R,S,T,U,V] genes and
            ORF1
          Length = 16139

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 180  ttcaatctcctaggctcaaa 199
            ||||||||||||||||||||
Sbjct: 2070 ttcaatctcctaggctcaaa 2051



to top

>emb|AL935253.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 2/11
          Length = 324050

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   ttcaatctcctaggctcaaa 199
             ||||||||||||||||||||
Sbjct: 24642 ttcaatctcctaggctcaaa 24623



to top

>gb|AC105213.5| Homo sapiens chromosome 8, clone RP11-346A14, complete sequence
          Length = 200131

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     tatacaaccatcatatatga 21
             ||||||||||||||||||||
Sbjct: 49145 tatacaaccatcatatatga 49126



to top

>gb|AC144506.1| Homo sapiens chromosome 17, clone XXfos-800635C12, complete sequence
          Length = 36963

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 12647 tcaatctcctaggctcaaac 12666



to top

>gb|AC139077.2| Homo sapiens chromosome 17, clone XXfos-88899C12, complete sequence
          Length = 37411

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 11043 tcaatctcctaggctcaaac 11062



to top

>gb|AC007952.15| Homo sapiens chromosome 17, clone RP11-160E2, complete sequence
          Length = 158103

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 86781 tcaatctcctaggctcaaac 86762



to top

>gb|AC140106.1| Homo sapiens chromosome 17, clone XXfos-801239H9, complete sequence
          Length = 40948

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 13690 tcaatctcctaggctcaaac 13671



to top

>gb|AF217796.1|AF217796 Homo sapiens SCG10 like-protein, helicase-like protein NHL, M68, and
             ADP-ribosylation factor related protein 1 (ARFRP1) genes,
             complete cds
          Length = 114793

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tcaatctcctaggctcaaac 200
             ||||||||||||||||||||
Sbjct: 10277 tcaatctcctaggctcaaac 10258



to top

>emb|AL132777.4|CNS01DTI Human chromosome 14 DNA sequence BAC R-307P22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 191464

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 181    tcaatctcctaggctcaaac 200
              ||||||||||||||||||||
Sbjct: 187703 tcaatctcctaggctcaaac 187722



to top

>emb|AL049874.3|CNS0000Q Human chromosome 14 DNA sequence BAC R-1042B17 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 193047

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    tcaatctcctaggctcaaac 200
              ||||||||||||||||||||
Sbjct: 164768 tcaatctcctaggctcaaac 164749



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     ctacaacgtttcttacaaac 77
              ||||||||||||||||||||
Sbjct: 800239 ctacaacgtttcttacaaac 800220



to top

>gb|AC005389.1|AC005389 Homo sapiens chromosome 17, clone hRPK.601_N_13, complete sequence
          Length = 120359

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    tcaatctcctaggctcaaac 200
              ||||||||||||||||||||
Sbjct: 107461 tcaatctcctaggctcaaac 107442



to top

>gb|AC157784.2| Mus musculus chromosome 18, clone RP24-163C18, complete sequence
          Length = 182283

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    tcagctaaaagctagggatc 247
              ||||||||||||||||||||
Sbjct: 107758 tcagctaaaagctagggatc 107739


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,527,939
Number of Sequences: 3902068
Number of extensions: 1527939
Number of successful extensions: 29075
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28977
Number of HSP's gapped (non-prelim): 96
length of query: 293
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 271
effective length of database: 17,147,199,772
effective search space: 4646891138212
effective search space used: 4646891138212
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top