ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35k24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_476406.1| Oryza sativa (japonica cultivar-group), mRNA 151 4e-33
2dbj|AK067989.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 4e-33
3dbj|AK058681.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 4e-33
4dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
5dbj|AP003746.2| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
6gb|BT018515.1| Zea mays clone EL01N0430F02.d mRNA sequence 101 3e-18
7gb|AY110885.1| Zea mays CL3247_1 mRNA sequence 88 5e-14
8gb|AY023327.1| Oryza sativa microsatellite MRG5652 containing (G... 60 1e-05
9dbj|AK036267.1| Mus musculus 16 days neonate cerebellum cDNA, RI... 44 0.62
10dbj|AK030612.1| Mus musculus adult male pituitary gland cDNA, RI... 44 0.62
11dbj|AK036829.1| Mus musculus adult female vagina cDNA, RIKEN ful... 44 0.62
12gb|AC020967.2|AC020967 Mus musculus chromosome 18 clone RP23-161... 44 0.62
13ref|NM_053141.2| Mus musculus protocadherin beta 16 (Pcdhb16), mRNA 44 0.62
14ref|XM_965645.1| PREDICTED: Tribolium castaneum similar to Proba... 42 2.4
15gb|AC093346.7| Mus musculus chromosome 5, clone RP23-15K13, comp... 40 9.6
16gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, com... 40 9.6
17emb|CR937053.2|RN476F3 Rattus norvegicus chromosome 1 BAC CH230-... 40 9.6
18emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chr... 40 9.6
19emb|AL353614.9| Human DNA sequence from clone RP11-91N2 on chrom... 40 9.6
20gb|AC113935.2| Homo sapiens chromosome 1 clone RP4-706A16, compl... 40 9.6
21gb|AF325177.1| Mus musculus BAC470L12 sequence 40 9.6
22dbj|AB176449.1| Homo sapiens ALPL gene for alkaline phosphatase,... 40 9.6
23gb|AF289666.1|AF289666 Mus musculus GTF2I and GTF2IRD1 genes, pa... 40 9.6
24gb|AC110248.22| Mus musculus chromosome 3, clone RP23-257P11, co... 40 9.6
25dbj|AP005270.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 9.6 
>ref|XM_476406.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 5268

 Score =  151 bits (76), Expect = 4e-33
 Identities = 136/156 (87%)
 Strand = Plus / Minus

                                                                        
Query: 547  cgtagtccatggaatcttctcgcagcaatgtcttgaaatcctggtacacaagcgctacat 606
            ||||||||| ||  ||||||||||||| |||||||||||||||||| ||| | ||| |||
Sbjct: 5056 cgtagtccacggtgtcttctcgcagcactgtcttgaaatcctggtatacacgtgctgcat 4997

                                                                        
Query: 607  cctgcaggcagctcggcaaactgatgttagtgttgttaatgttaagcgggatattctgct 666
            ||||| ||||||||||||||||| |||| || ||  ||||||| |  |||||||||||||
Sbjct: 4996 cctgcgggcagctcggcaaactggtgttggtattactaatgttcaatgggatattctgct 4937

                                                
Query: 667  tggagattgcttcaccaggttttggtggatccttca 702
            ||||||||| ||| |||| |||||||||||||||||
Sbjct: 4936 tggagattgtttcgccagattttggtggatccttca 4901



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 459  cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
            ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 5141 cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 5082

                  
Query: 519  ttctgg 524
            ||||||
Sbjct: 5081 ttctgg 5076
to top
>dbj|AK067989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013125L12, full
            insert sequence
          Length = 3061

 Score =  151 bits (76), Expect = 4e-33
 Identities = 136/156 (87%)
 Strand = Plus / Minus

                                                                        
Query: 547  cgtagtccatggaatcttctcgcagcaatgtcttgaaatcctggtacacaagcgctacat 606
            ||||||||| ||  ||||||||||||| |||||||||||||||||| ||| | ||| |||
Sbjct: 2554 cgtagtccacggtgtcttctcgcagcactgtcttgaaatcctggtatacacgtgctgcat 2495

                                                                        
Query: 607  cctgcaggcagctcggcaaactgatgttagtgttgttaatgttaagcgggatattctgct 666
            ||||| ||||||||||||||||| |||| || ||  ||||||| |  |||||||||||||
Sbjct: 2494 cctgcgggcagctcggcaaactggtgttggtattactaatgttcaatgggatattctgct 2435

                                                
Query: 667  tggagattgcttcaccaggttttggtggatccttca 702
            ||||||||| ||| |||| |||||||||||||||||
Sbjct: 2434 tggagattgtttcgccagattttggtggatccttca 2399



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 459  cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
            ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 2639 cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 2580

                  
Query: 519  ttctgg 524
            ||||||
Sbjct: 2579 ttctgg 2574



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 280  ccagtcatacttggaccctttgtctcgttactcggccacc 319
            ||||||| ||||||||||| || || |||||||| |||||
Sbjct: 2770 ccagtcagacttggaccctctgccttgttactcgcccacc 2731
to top
>dbj|AK058681.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A04, full
            insert sequence
          Length = 1532

 Score =  151 bits (76), Expect = 4e-33
 Identities = 136/156 (87%)
 Strand = Plus / Minus

                                                                        
Query: 547  cgtagtccatggaatcttctcgcagcaatgtcttgaaatcctggtacacaagcgctacat 606
            ||||||||| ||  ||||||||||||| |||||||||||||||||| ||| | ||| |||
Sbjct: 1025 cgtagtccacggtgtcttctcgcagcactgtcttgaaatcctggtatacacgtgctgcat 966

                                                                        
Query: 607  cctgcaggcagctcggcaaactgatgttagtgttgttaatgttaagcgggatattctgct 666
            ||||| ||||||||||||||||| |||| || ||  ||||||| |  |||||||||||||
Sbjct: 965  cctgcgggcagctcggcaaactggtgttggtattactaatgttcaatgggatattctgct 906

                                                
Query: 667  tggagattgcttcaccaggttttggtggatccttca 702
            ||||||||| ||| |||| |||||||||||||||||
Sbjct: 905  tggagattgtttcgccagattttggtggatccttca 870



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 459  cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
            ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 1110 cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 1051

                  
Query: 519  ttctgg 524
            ||||||
Sbjct: 1050 ttctgg 1045



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 280  ccagtcatacttggaccctttgtctcgttactcggccacc 319
            ||||||| ||||||||||| || || |||||||| |||||
Sbjct: 1241 ccagtcagacttggaccctctgccttgttactcgcccacc 1202
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  105 bits (53), Expect = 2e-19
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                          
Query: 586    cctggtacacaagcgctacatcctgcaggcagctcggcaaactgatgttagtgttgttaa 645
              ||||||| ||| | ||| |||||||| ||||||||||||||||| |||| || ||  |||
Sbjct: 580521 cctggtatacacgtgctgcatcctgcgggcagctcggcaaactggtgttggtattactaa 580462

                                                                       
Query: 646    tgttaagcgggatattctgcttggagattgcttcaccaggttttggtggatccttca 702
              |||| |  |||||||||||||||||||||| ||| |||| |||||||||||||||||
Sbjct: 580461 tgttcaatgggatattctgcttggagattgtttcgccagattttggtggatccttca 580405



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                          
Query: 459    cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
              ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 580770 cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 580711

                    
Query: 519    ttctgg 524
              ||||||
Sbjct: 580710 ttctgg 580705



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 547    cgtagtccatggaatcttctcgcagcaatgtcttgaaatcctg 589
              ||||||||| ||  ||||||||||||| |||||||||||||||
Sbjct: 580685 cgtagtccacggtgtcttctcgcagcactgtcttgaaatcctg 580643



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                      
Query: 280    ccagtcatacttggaccctttgtctcgttactcggccacc 319
              ||||||| ||||||||||| || || |||||||| |||||
Sbjct: 580901 ccagtcagacttggaccctctgccttgttactcgcccacc 580862
to top
>dbj|AP003746.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1123_C12
          Length = 114309

 Score =  105 bits (53), Expect = 2e-19
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                         
Query: 586   cctggtacacaagcgctacatcctgcaggcagctcggcaaactgatgttagtgttgttaa 645
             ||||||| ||| | ||| |||||||| ||||||||||||||||| |||| || ||  |||
Sbjct: 15023 cctggtatacacgtgctgcatcctgcgggcagctcggcaaactggtgttggtattactaa 14964

                                                                      
Query: 646   tgttaagcgggatattctgcttggagattgcttcaccaggttttggtggatccttca 702
             |||| |  |||||||||||||||||||||| ||| |||| |||||||||||||||||
Sbjct: 14963 tgttcaatgggatattctgcttggagattgtttcgccagattttggtggatccttca 14907



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 459   cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
             ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 15272 cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 15213

                   
Query: 519   ttctgg 524
             ||||||
Sbjct: 15212 ttctgg 15207



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 547   cgtagtccatggaatcttctcgcagcaatgtcttgaaatcctg 589
             ||||||||| ||  ||||||||||||| |||||||||||||||
Sbjct: 15187 cgtagtccacggtgtcttctcgcagcactgtcttgaaatcctg 15145



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 280   ccagtcatacttggaccctttgtctcgttactcggccacc 319
             ||||||| ||||||||||| || || |||||||| |||||
Sbjct: 15403 ccagtcagacttggaccctctgccttgttactcgcccacc 15364
to top
>gb|BT018515.1| Zea mays clone EL01N0430F02.d mRNA sequence
          Length = 1409

 Score =  101 bits (51), Expect = 3e-18
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 550 agtccatggaatcttctcgcagcaatgtcttgaaatcctggtacacaagcgctacatcct 609
           ||||||||||||||||  | |||| |||||||||||||||||| |||   ||||| ||||
Sbjct: 821 agtccatggaatcttcgtggagcactgtcttgaaatcctggtaaacagaagctacgtcct 762

                                                                       
Query: 610 gcaggcagctcggcaaactgatgttagtgttgttaatgttaagcgggatattctgcttgg 669
           ||||||||||||||| ||||||||||||| || |||  ||||  || ||||||||| |||
Sbjct: 761 gcaggcagctcggcagactgatgttagtgctgctaacattaaaaggaatattctgcctgg 702

              
Query: 670 aga 672
           |||
Sbjct: 701 aga 699



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 68/80 (85%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                        
Query: 69   gggcacagcaagaaaaggagtactacaagttaatggc-tctaagtaggtaaagctatctc 127
            ||||| ||||||||||||||| || ||| | |||||| ||||||||   || ||||||| 
Sbjct: 1248 gggcagagcaagaaaaggagtgctccaaatcaatggcatctaagtaaa-aaggctatctt 1190

                                
Query: 128  ccttccctttctgcttctat 147
            |||| |||||||||||||||
Sbjct: 1189 cctttcctttctgcttctat 1170
to top
>gb|AY110885.1| Zea mays CL3247_1 mRNA sequence
          Length = 1132

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 550 agtccatggaatcttctcgcagcaatgtcttgaaatcctggtacacaagcgctacatcct 609
           ||||||||||||||||  | |||| |||||||||||||||||| |||   ||| | ||||
Sbjct: 539 agtccatggaatcttcgtggagcactgtcttgaaatcctggtaaacagaggctgcgtcct 598

                                           
Query: 610 gcaggcagctcggcaaactgatgttagtgttg 641
           ||||||||||||||| ||||| ||||||||||
Sbjct: 599 gcaggcagctcggcagactgaggttagtgttg 630
to top
>gb|AY023327.1| Oryza sativa microsatellite MRG5652 containing (GTG)X8, genomic
           sequence
          Length = 224

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 459 cctcttgtaacagccaccggccttctaactttcgacgcacttcttggagttggacgcttc 518
           ||||||||||||||| |||| ||||| ||| ||||||  ||||||||||| ||||| || 
Sbjct: 98  cctcttgtaacagccgccggtcttcttactctcgacgagcttcttggagtcggacgtttt 39

                 
Query: 519 ttctgg 524
           ||||||
Sbjct: 38  ttctgg 33
to top
>dbj|AK036267.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:9630050H08 product:protocadherin
            beta 16, full insert sequence
          Length = 3925

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   aaaatgggcacagcaagaaaag 85
            ||||||||||||||||||||||
Sbjct: 1354 aaaatgggcacagcaagaaaag 1333
to top
>dbj|AK030612.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
            enriched library, clone:5330438J06 product:protocadherin
            beta 16, full insert sequence
          Length = 3792

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   aaaatgggcacagcaagaaaag 85
            ||||||||||||||||||||||
Sbjct: 2652 aaaatgggcacagcaagaaaag 2631
to top
>dbj|AK036829.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched
            library, clone:9930016J18 product:protocadherin beta 16,
            full insert sequence
          Length = 4949

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   aaaatgggcacagcaagaaaag 85
            ||||||||||||||||||||||
Sbjct: 2627 aaaatgggcacagcaagaaaag 2606
to top
>gb|AC020967.2|AC020967 Mus musculus chromosome 18 clone RP23-161O8, complete sequence
          Length = 225883

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    aaaatgggcacagcaagaaaag 85
             ||||||||||||||||||||||
Sbjct: 89729 aaaatgggcacagcaagaaaag 89708
to top
>ref|NM_053141.2| Mus musculus protocadherin beta 16 (Pcdhb16), mRNA
          Length = 4949

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   aaaatgggcacagcaagaaaag 85
            ||||||||||||||||||||||
Sbjct: 2627 aaaatgggcacagcaagaaaag 2606
to top
>ref|XM_965645.1| PREDICTED: Tribolium castaneum similar to Probable cytochrome P450
           49a1 (CYPXLIXA1) (LOC659328), mRNA
          Length = 1620

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 515 cttcttctggaccgtggcagaagta 539
           ||||||||||| |||||||||||||
Sbjct: 771 cttcttctggaacgtggcagaagta 795
to top
>gb|AC093346.7| Mus musculus chromosome 5, clone RP23-15K13, complete sequence
          Length = 211278

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 123    atctcccttccctttctgcttcta 146
              ||||||||||||||||| ||||||
Sbjct: 196032 atctcccttccctttcttcttcta 196055
to top
>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence
          Length = 194261

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 601    ctacatcctgcaggcagctc 620
              ||||||||||||||||||||
Sbjct: 136174 ctacatcctgcaggcagctc 136193
to top
>emb|CR937053.2|RN476F3 Rattus norvegicus chromosome 1 BAC CH230-476F3, complete sequence
          Length = 139452

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    ggaaaagcccagcacaaaag 49
             ||||||||||||||||||||
Sbjct: 39964 ggaaaagcccagcacaaaag 39945
to top
>emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chromosome 1 Contains a
             novel gene, a novel pseudogene, a novel gene similar to
             heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), a
             pseudogene similar to part of a novel gene, the gene for a
             hypothetical protein AE2, a profilin 1 (PFN1) pseudogene,
             the 5' end of the ALPL gene for alkaline phosphatase,
             liver/bone/kidney and a CpG island, complete sequence
          Length = 206231

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   gatggtatcatcatcagtga 197
             ||||||||||||||||||||
Sbjct: 98044 gatggtatcatcatcagtga 98025
to top
>emb|AL353614.9| Human DNA sequence from clone RP11-91N2 on chromosome 9p24.1-24.3
             Contains part of a novel gene (FLJ35024) and a novel gene,
             complete sequence
          Length = 119255

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   gcctgtcagtcagctataaa 251
             ||||||||||||||||||||
Sbjct: 52235 gcctgtcagtcagctataaa 52216
to top
>gb|AC113935.2| Homo sapiens chromosome 1 clone RP4-706A16, complete sequence
          Length = 142422

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 135   tttctgcttctatatactag 154
             ||||||||||||||||||||
Sbjct: 48336 tttctgcttctatatactag 48355
to top
>gb|AF325177.1| Mus musculus BAC470L12 sequence
          Length = 205602

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 123    atctcccttccctttctgcttcta 146
              ||||||||||||||||| ||||||
Sbjct: 114894 atctcccttccctttcttcttcta 114871
to top
>dbj|AB176449.1| Homo sapiens ALPL gene for alkaline phosphatase, promoter region and
            exon 1
          Length = 4388

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 178  gatggtatcatcatcagtga 197
            ||||||||||||||||||||
Sbjct: 2669 gatggtatcatcatcagtga 2650
to top
>gb|AF289666.1|AF289666 Mus musculus GTF2I and GTF2IRD1 genes, partial cds
          Length = 130665

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 123   atctcccttccctttctgcttcta 146
             ||||||||||||||||| ||||||
Sbjct: 34629 atctcccttccctttcttcttcta 34652
to top
>gb|AC110248.22| Mus musculus chromosome 3, clone RP23-257P11, complete sequence
          Length = 206915

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 607    cctgcaggcagctcggcaaactga 630
              |||||||||||||||||| |||||
Sbjct: 136151 cctgcaggcagctcggcagactga 136128
to top
>dbj|AP005270.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-291B19, complete
             sequence
          Length = 200493

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   ccttccctttctgcttctat 147
             ||||||||||||||||||||
Sbjct: 80234 ccttccctttctgcttctat 80215


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,667,482
Number of Sequences: 3902068
Number of extensions: 4667482
Number of successful extensions: 85397
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85299
Number of HSP's gapped (non-prelim): 97
length of query: 703
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 680
effective length of database: 17,143,297,704
effective search space: 11657442438720
effective search space used: 11657442438720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top