| Clone Name | rbags35k04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_192095.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1272 Score = 389 bits (196), Expect = e-105 Identities = 295/328 (89%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaagg 440 |||||||| ||||||| ||| |||||||||||||| || || ||||||| |||||||| | Sbjct: 1112 tcttctacctcttgcacaagctcatcctttgtgtggttgcacgatgttacgaccacaatg 1053 Query: 441 ccacctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggcca 500 ||||| |||||||||||||| |||||||| ||||||||||| ||||||||| ||| ||| Sbjct: 1052 ccaccaggttcaaccaagttcgatacagactcccaatacattactctttttatacgacca 993 Query: 501 tctggatgcaatccaatggcatccaatgtccctttatctgtaataattttgaatttcctg 560 || || ||||||||||||||||||||||||||||| ||||||| |||||||||||| || Sbjct: 992 tcagggtgcaatccaatggcatccaatgtccctttgtctgtaacaattttgaattttcta 933 Query: 561 tctaattttgtctgaagtacatcatcgaccaagaaacttatagtagtgaacccatcacga 620 ||||| ||||||| ||||| |||||| ||||||||| |||||| ||| ||||||||||| Sbjct: 932 tctaactttgtctcaagtatatcatcaaccaagaaatttatagaagtaaacccatcacgt 873 Query: 621 gcagcaaggtttcttgcaagttcaatggctccttcactgtaatcagttcctgttaagtct 680 |||||||||||| |||||||||||||||||||||||||||||||||| |||||||| | | Sbjct: 872 gcagcaaggttttttgcaagttcaatggctccttcactgtaatcagtccctgttaaattt 813 Query: 681 gaaaacccctgcttggcaagtgcttgca 708 |||||||||||||||||||||||||||| Sbjct: 812 gaaaacccctgcttggcaagtgcttgca 785 Score = 75.8 bits (38), Expect = 2e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 221 tcacgcccgttggaaagccacagtgcacacttgagacccctcaattccgccaaacatgat 280 |||| |||||||||| ||||| |||||||||||||| ||||||| || |||||||| || Sbjct: 1272 tcacacccgttggaaggccaccgtgcacacttgagaaccctcaacccctccaaacataat 1213 Query: 281 ggtaggatacgtttgaacatgatccaagtatcggaagatctg 322 |||||| || || | |||||||| | ||| ||||||||||| Sbjct: 1212 ggtagggtatgtccggacatgatcgatgtaccggaagatctg 1171
>gb|AY110338.1| Zea mays CL4501_1 mRNA sequence Length = 857 Score = 351 bits (177), Expect = 2e-93 Identities = 289/328 (88%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaagg 440 ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||| | Sbjct: 378 tcttctacttcatgcagaagctcatcctttgtgtgattacatgacgttatgaccacaatg 319 Query: 441 ccacctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggcca 500 ||||| || ||||||||||||||||||||||||||||| | || |||||| ||||| ||| Sbjct: 318 ccaccaggctcaaccaagtttgatacagattcccaatataccattcttttcgcacgacca 259 Query: 501 tctggatgcaatccaatggcatccaatgtccctttatctgtaataattttgaatttcctg 560 |||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 258 tctggatgcaatccgatggcatccaatgtccctttgtctgtaacaattttgaatttccta 199 Query: 561 tctaattttgtctgaagtacatcatcgaccaagaaacttatagtagtgaacccatcacga 620 ||||| ||||||| |||||||||||| ||| |||| | || ||| ||||||||| Sbjct: 198 tctaactttgtctcaagtacatcatcaaccnnnnngtttattgaagagaagccatcacga 139 Query: 621 gcagcaaggtttcttgcaagttcaatggctccttcactgtaatcagttcctgttaagtct 680 ||||| ||||||||||||||||||| ||||||| ||||||||| ||||| ||||||||| Sbjct: 138 gcagctaggtttcttgcaagttcaacagctcctttactgtaatctgttccagttaagtct 79 Query: 681 gaaaacccctgcttggcaagtgcttgca 708 | |||||||||||| || | |||||||| Sbjct: 78 gtaaacccctgcttagccaatgcttgca 51 Score = 81.8 bits (41), Expect = 3e-12 Identities = 74/85 (87%) Strand = Plus / Minus Query: 237 gccacagtgcacacttgagacccctcaattccgccaaacatgatggtaggatacgtttga 296 ||||||||||| |||||||| ||||||||||| |||||||| ||||||||||| ||| | Sbjct: 522 gccacagtgcagacttgagagccctcaattcctccaaacattatggtaggatatgttcgg 463 Query: 297 acatgatccaagtatcggaagatct 321 ||||| || | ||| |||||||||| Sbjct: 462 acatggtctatgtaccggaagatct 438
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 588 accaagaaacttatagtagtgaacccatcacgagcagcaaggtttcttgcaagttcaatg 647 ||||||||| |||||| ||| ||||||||||| |||||||||||| |||||||||||||| Sbjct: 28308427 accaagaaatttatagaagtaaacccatcacgtgcagcaaggttttttgcaagttcaatg 28308368 Query: 648 gctccttcactgtaatcagttcctgttaagtctgaaaacc 687 |||||||||||||||||||| |||||||| | |||||||| Sbjct: 28308367 gctccttcactgtaatcagtccctgttaaatttgaaaacc 28308328 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 498 ccatctggatgcaatccaatggcatccaatgtccctttatctgtaataattttgaatttc 557 ||||| || ||||||||||||||||||||||||||||| ||||||| |||||||||||| Sbjct: 28309248 ccatcagggtgcaatccaatggcatccaatgtccctttgtctgtaacaattttgaatttt 28309189 Query: 558 ctgtctaattttgtctgaagtacatcatc 586 || ||||| ||||||| ||||| |||||| Sbjct: 28309188 ctatctaactttgtctcaagtatatcatc 28309160 Score = 75.8 bits (38), Expect = 2e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 221 tcacgcccgttggaaagccacagtgcacacttgagacccctcaattccgccaaacatgat 280 |||| |||||||||| ||||| |||||||||||||| ||||||| || |||||||| || Sbjct: 28310252 tcacacccgttggaaggccaccgtgcacacttgagaaccctcaacccctccaaacataat 28310193 Query: 281 ggtaggatacgtttgaacatgatccaagtatcggaagatctg 322 |||||| || || | |||||||| | ||| ||||||||||| Sbjct: 28310192 ggtagggtatgtccggacatgatcgatgtaccggaagatctg 28310151 Score = 75.8 bits (38), Expect = 2e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 430 tgaccacaaggccacctggttcaaccaagtttgatacagattcccaatacatcactct 487 ||||||||| |||||| |||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 28309789 tgaccacaatgccaccaggttcaaccaagttcgatacagactcccaatacattactct 28309732 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgacc 434 |||||||| ||||||| ||| |||||||||||||| || || ||||||| |||| Sbjct: 28310092 tcttctacctcttgcacaagctcatcctttgtgtggttgcacgatgttacgacc 28310039 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 685 acccctgcttggcaagtgcttgca 708 |||||||||||||||||||||||| Sbjct: 28307859 acccctgcttggcaagtgcttgca 28307836
>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0478H03 Length = 167560 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 588 accaagaaacttatagtagtgaacccatcacgagcagcaaggtttcttgcaagttcaatg 647 ||||||||| |||||| ||| ||||||||||| |||||||||||| |||||||||||||| Sbjct: 142934 accaagaaatttatagaagtaaacccatcacgtgcagcaaggttttttgcaagttcaatg 142875 Query: 648 gctccttcactgtaatcagttcctgttaagtctgaaaacc 687 |||||||||||||||||||| |||||||| | |||||||| Sbjct: 142874 gctccttcactgtaatcagtccctgttaaatttgaaaacc 142835 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 498 ccatctggatgcaatccaatggcatccaatgtccctttatctgtaataattttgaatttc 557 ||||| || ||||||||||||||||||||||||||||| ||||||| |||||||||||| Sbjct: 143755 ccatcagggtgcaatccaatggcatccaatgtccctttgtctgtaacaattttgaatttt 143696 Query: 558 ctgtctaattttgtctgaagtacatcatc 586 || ||||| ||||||| ||||| |||||| Sbjct: 143695 ctatctaactttgtctcaagtatatcatc 143667 Score = 75.8 bits (38), Expect = 2e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 221 tcacgcccgttggaaagccacagtgcacacttgagacccctcaattccgccaaacatgat 280 |||| |||||||||| ||||| |||||||||||||| ||||||| || |||||||| || Sbjct: 144759 tcacacccgttggaaggccaccgtgcacacttgagaaccctcaacccctccaaacataat 144700 Query: 281 ggtaggatacgtttgaacatgatccaagtatcggaagatctg 322 |||||| || || | |||||||| | ||| ||||||||||| Sbjct: 144699 ggtagggtatgtccggacatgatcgatgtaccggaagatctg 144658 Score = 75.8 bits (38), Expect = 2e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 430 tgaccacaaggccacctggttcaaccaagtttgatacagattcccaatacatcactct 487 ||||||||| |||||| |||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 144296 tgaccacaatgccaccaggttcaaccaagttcgatacagactcccaatacattactct 144239 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgacc 434 |||||||| ||||||| ||| |||||||||||||| || || ||||||| |||| Sbjct: 144599 tcttctacctcttgcacaagctcatcctttgtgtggttgcacgatgttacgacc 144546 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 685 acccctgcttggcaagtgcttgca 708 |||||||||||||||||||||||| Sbjct: 142366 acccctgcttggcaagtgcttgca 142343
>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0519D04 Length = 193068 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 588 accaagaaacttatagtagtgaacccatcacgagcagcaaggtttcttgcaagttcaatg 647 ||||||||| |||||| ||| ||||||||||| |||||||||||| |||||||||||||| Sbjct: 23527 accaagaaatttatagaagtaaacccatcacgtgcagcaaggttttttgcaagttcaatg 23468 Query: 648 gctccttcactgtaatcagttcctgttaagtctgaaaacc 687 |||||||||||||||||||| |||||||| | |||||||| Sbjct: 23467 gctccttcactgtaatcagtccctgttaaatttgaaaacc 23428 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 498 ccatctggatgcaatccaatggcatccaatgtccctttatctgtaataattttgaatttc 557 ||||| || ||||||||||||||||||||||||||||| ||||||| |||||||||||| Sbjct: 24348 ccatcagggtgcaatccaatggcatccaatgtccctttgtctgtaacaattttgaatttt 24289 Query: 558 ctgtctaattttgtctgaagtacatcatc 586 || ||||| ||||||| ||||| |||||| Sbjct: 24288 ctatctaactttgtctcaagtatatcatc 24260 Score = 75.8 bits (38), Expect = 2e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 221 tcacgcccgttggaaagccacagtgcacacttgagacccctcaattccgccaaacatgat 280 |||| |||||||||| ||||| |||||||||||||| ||||||| || |||||||| || Sbjct: 25352 tcacacccgttggaaggccaccgtgcacacttgagaaccctcaacccctccaaacataat 25293 Query: 281 ggtaggatacgtttgaacatgatccaagtatcggaagatctg 322 |||||| || || | |||||||| | ||| ||||||||||| Sbjct: 25292 ggtagggtatgtccggacatgatcgatgtaccggaagatctg 25251 Score = 75.8 bits (38), Expect = 2e-10 Identities = 53/58 (91%) Strand = Plus / Minus Query: 430 tgaccacaaggccacctggttcaaccaagtttgatacagattcccaatacatcactct 487 ||||||||| |||||| |||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 24889 tgaccacaatgccaccaggttcaaccaagttcgatacagactcccaatacattactct 24832 Score = 52.0 bits (26), Expect = 0.003 Identities = 47/54 (87%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgacc 434 |||||||| ||||||| ||| |||||||||||||| || || ||||||| |||| Sbjct: 25192 tcttctacctcttgcacaagctcatcctttgtgtggttgcacgatgttacgacc 25139 Score = 48.1 bits (24), Expect = 0.040 Identities = 24/24 (100%) Strand = Plus / Minus Query: 685 acccctgcttggcaagtgcttgca 708 |||||||||||||||||||||||| Sbjct: 22959 acccctgcttggcaagtgcttgca 22936
>dbj|AK058740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G07, full insert sequence Length = 513 Score = 87.7 bits (44), Expect = 5e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 381 tcttctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaagg 440 |||||||| ||||||| ||| |||||||||||||| || || ||||||| |||||||| | Sbjct: 84 tcttctacctcttgcacaagctcatcctttgtgtggttgcacgatgttacgaccacaatg 25 Query: 441 ccacctggttcaaccaagtt 460 ||||| |||||||||||||| Sbjct: 24 ccaccaggttcaaccaagtt 5 Score = 75.8 bits (38), Expect = 2e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 221 tcacgcccgttggaaagccacagtgcacacttgagacccctcaattccgccaaacatgat 280 |||| |||||||||| ||||| |||||||||||||| ||||||| || |||||||| || Sbjct: 244 tcacacccgttggaaggccaccgtgcacacttgagaaccctcaacccctccaaacataat 185 Query: 281 ggtaggatacgtttgaacatgatccaagtatcggaagatctg 322 |||||| || || | |||||||| | ||| ||||||||||| Sbjct: 184 ggtagggtatgtccggacatgatcgatgtaccggaagatctg 143
>gb|U66193.1|BNU66193 Brassica napus S locus-linked gene two (SLL2) mRNA, complete cds Length = 1183 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 471 tcccaatacatcactctttttgcacggccatctggatgcaatccaatggcatccaatgtc 530 ||||||||||| |||||||| || ||||||| || ||||| |||||||||||||| || Sbjct: 758 tcccaatacatgactcttttgacagggccatcagggtgcaaaccaatggcatccaaagtt 699 Query: 531 ccttt 535 ||||| Sbjct: 698 ccttt 694
>dbj|AB012867.1| Brassica rapa mRNA for SLL2-S9-protein, complete cds Length = 2078 Score = 52.0 bits (26), Expect = 0.003 Identities = 53/62 (85%) Strand = Plus / Minus Query: 639 agttcaatggctccttcactgtaatcagttcctgttaagtctgaaaacccctgcttggca 698 ||||||| ||||||||||| |||||||| |||||||| || || ||||||| ||| ||| Sbjct: 1457 agttcaaccgctccttcactataatcagtccctgttaaatcagagaacccctccttagca 1398 Query: 699 ag 700 || Sbjct: 1397 ag 1396 Score = 50.1 bits (25), Expect = 0.010 Identities = 46/53 (86%) Strand = Plus / Minus Query: 471 tcccaatacatcactctttttgcacggccatctggatgcaatccaatggcatc 523 ||||||||||| |||||||| || ||||||| || ||||| ||||||||||| Sbjct: 1625 tcccaatacatgactcttttgacagggccatcagggtgcaaaccaatggcatc 1573
>gb|AC144375.14| Medicago truncatula clone mth2-11p13, complete sequence Length = 123953 Score = 50.1 bits (25), Expect = 0.010 Identities = 37/41 (90%) Strand = Plus / Plus Query: 498 ccatctggatgcaatccaatggcatccaatgtccctttatc 538 ||||| |||||||||||||| ||||| | |||||||||||| Sbjct: 22441 ccatcaggatgcaatccaatagcatcaagtgtccctttatc 22481 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 460 ttgatacagattcccaatacatca 483 |||||||||| ||||||||||||| Sbjct: 22268 ttgatacagaatcccaatacatca 22291
>ref|NM_105339.2| Arabidopsis thaliana AR401; S-adenosylmethionine-dependent methyltransferase AT1G66680 (AR401) mRNA, complete cds Length = 1421 Score = 48.1 bits (24), Expect = 0.040 Identities = 111/140 (79%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaaggcca 443 |||||||||| || ||||| ||||||||||| ||||| ||||| || |||| | ||| Sbjct: 962 tctacttcttccaccagttcgtcctttgtgtggttacacgatgtgatcaccaatattcca 903 Query: 444 cctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggccatct 503 || || |||||| || || || || ||||| ||||| |||||||| || ||||||| Sbjct: 902 ccaggagcaaccagcttggacactgaatcccagtacatgactcttttgacagggccatca 843 Query: 504 ggatgcaatccaatggcatc 523 |||||||| ||||| ||||| Sbjct: 842 ggatgcaaaccaatagcatc 823 Score = 40.1 bits (20), Expect = 9.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 654 tcactgtaatcagttcctgttaagtctgaaaacccctgcttggcaagt 701 ||||||||||||||||| ||||| || || ||||| | ||| |||||| Sbjct: 692 tcactgtaatcagttccggttaaatcagagaacccttccttagcaagt 645
>emb|BX815165.1|CNS0ACS6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS39ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1269 Score = 48.1 bits (24), Expect = 0.040 Identities = 111/140 (79%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaaggcca 443 |||||||||| || ||||| ||||||||||| ||||| ||||| || |||| | ||| Sbjct: 946 tctacttcttccaccagttcgtcctttgtgtggttacacgatgtgatcaccaatattcca 887 Query: 444 cctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggccatct 503 || || |||||| || || || || ||||| ||||| |||||||| || ||||||| Sbjct: 886 ccaggagcaaccagcttggacactgaatcccagtacatgactcttttgacagggccatca 827 Query: 504 ggatgcaatccaatggcatc 523 |||||||| ||||| ||||| Sbjct: 826 ggatgcaaaccaatagcatc 807 Score = 40.1 bits (20), Expect = 9.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 654 tcactgtaatcagttcctgttaagtctgaaaacccctgcttggcaagt 701 ||||||||||||||||| ||||| || || ||||| | ||| |||||| Sbjct: 676 tcactgtaatcagttccggttaaatcagagaacccttccttagcaagt 629
>gb|BT005868.1| Arabidopsis thaliana At1g66680 gene, complete cds Length = 792 Score = 48.1 bits (24), Expect = 0.040 Identities = 111/140 (79%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaaggcca 443 |||||||||| || ||||| ||||||||||| ||||| ||||| || |||| | ||| Sbjct: 590 tctacttcttccaccagttcgtcctttgtgtggttacacgatgtgatcaccaatattcca 531 Query: 444 cctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggccatct 503 || || |||||| || || || || ||||| ||||| |||||||| || ||||||| Sbjct: 530 ccaggagcaaccagcttggacactgaatcccagtacatgactcttttgacagggccatca 471 Query: 504 ggatgcaatccaatggcatc 523 |||||||| ||||| ||||| Sbjct: 470 ggatgcaaaccaatagcatc 451 Score = 40.1 bits (20), Expect = 9.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 654 tcactgtaatcagttcctgttaagtctgaaaacccctgcttggcaagt 701 ||||||||||||||||| ||||| || || ||||| | ||| |||||| Sbjct: 320 tcactgtaatcagttccggttaaatcagagaacccttccttagcaagt 273
>gb|AY087928.1| Arabidopsis thaliana clone 3969 mRNA, complete sequence Length = 1304 Score = 48.1 bits (24), Expect = 0.040 Identities = 111/140 (79%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaaggcca 443 |||||||||| || ||||| ||||||||||| ||||| ||||| || |||| | ||| Sbjct: 960 tctacttcttccaccagttcgtcctttgtgtggttacacgatgtgatcaccaatattcca 901 Query: 444 cctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggccatct 503 || || |||||| || || || || ||||| ||||| |||||||| || ||||||| Sbjct: 900 ccaggagcaaccagcttggacactgaatcccagtacatgactcttttgacagggccatca 841 Query: 504 ggatgcaatccaatggcatc 523 |||||||| ||||| ||||| Sbjct: 840 ggatgcaaaccaatagcatc 821 Score = 40.1 bits (20), Expect = 9.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 654 tcactgtaatcagttcctgttaagtctgaaaacccctgcttggcaagt 701 ||||||||||||||||| ||||| || || ||||| | ||| |||||| Sbjct: 690 tcactgtaatcagttccggttaaatcagagaacccttccttagcaagt 643
>dbj|D88747.2| Arabidopsis thaliana mRNA for AR401, complete cds Length = 1245 Score = 48.1 bits (24), Expect = 0.040 Identities = 111/140 (79%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgttatgaccacaaggcca 443 |||||||||| || ||||| ||||||||||| ||||| ||||| || |||| | ||| Sbjct: 914 tctacttcttccaccagttcgtcctttgtgtggttacacgatgtgatcaccaatattcca 855 Query: 444 cctggttcaaccaagtttgatacagattcccaatacatcactctttttgcacggccatct 503 || || |||||| || || || || ||||| ||||| |||||||| || ||||||| Sbjct: 854 ccaggagcaaccagcttggacactgaatcccagtacatgactcttttgacagggccatca 795 Query: 504 ggatgcaatccaatggcatc 523 |||||||| ||||| ||||| Sbjct: 794 ggatgcaaaccaatagcatc 775 Score = 40.1 bits (20), Expect = 9.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 654 tcactgtaatcagttcctgttaagtctgaaaacccctgcttggcaagt 701 ||||||||||||||||| ||||| || || ||||| | ||| |||||| Sbjct: 644 tcactgtaatcagttccggttaaatcagagaacccttccttagcaagt 597
>gb|DQ235195.1| Solanum tuberosum clone 168B08 SLL2-S9-protein-like mRNA, complete cds Length = 1202 Score = 44.1 bits (22), Expect = 0.63 Identities = 64/78 (82%) Strand = Plus / Minus Query: 614 atcacgagcagcaaggtttcttgcaagttcaatggctccttcactgtaatcagttcctgt 673 ||||||| | ||||| |||| ||||| || || ||||||||||| || |||||||| || Sbjct: 651 atcacgatccgcaagccttctcgcaaggtctattgctccttcactatagtcagttccggt 592 Query: 674 taagtctgaaaacccctg 691 | |||||||||||||| Sbjct: 591 gagatctgaaaacccctg 574
>gb|AC151347.2| Xenopus tropicalis clone ISB-394A6, complete sequence Length = 78040 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 182 ctacaacatagggataaaaaacact 206 ||||||| ||||||||||||||||| Sbjct: 22394 ctacaacttagggataaaaaacact 22418
>gb|AC120042.3| Homo sapiens chromosome 8, clone RP11-659E9, complete sequence Length = 170940 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 ctgtccttgcaaactggaaag 136 ||||||||||||||||||||| Sbjct: 8248 ctgtccttgcaaactggaaag 8268
>gb|AC019357.7| Homo sapiens chromosome 8, clone RP11-687A13, complete sequence Length = 181694 Score = 42.1 bits (21), Expect = 2.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 ctgtccttgcaaactggaaag 136 ||||||||||||||||||||| Sbjct: 61447 ctgtccttgcaaactggaaag 61467
>dbj|AP004908.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT12N11, TM0066, complete sequence Length = 79585 Score = 42.1 bits (21), Expect = 2.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 549 ttgaatttcctgtctaattttgtct 573 |||| |||||||||||||||||||| Sbjct: 67832 ttgattttcctgtctaattttgtct 67856 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 549 ttgaatttcctgtctaattttgtc 572 |||| ||||||||||||||||||| Sbjct: 72612 ttgattttcctgtctaattttgtc 72635
>gb|AC117731.14| Mus musculus chromosome 8, clone RP24-128L11, complete sequence Length = 171484 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 56 caaactcttctacttcttgc 37
>gb|AC162367.5| Mus musculus chromosome 8, clone RP24-209A21, complete sequence Length = 149211 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 33885 caaactcttctacttcttgc 33866
>gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's Hospital Oakland Research Institute) complete sequence Length = 209019 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 85 caaaaattgcttcataaagttctcttac 112 |||||||||| ||||| ||||||||||| Sbjct: 176202 caaaaattgcatcatagagttctcttac 176175
>ref|XM_363829.1| Magnaporthe grisea 70-15 hypothetical protein (MG01755.4) partial mRNA Length = 1302 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 638 aagttcaatggctccttcac 657 |||||||||||||||||||| Sbjct: 157 aagttcaatggctccttcac 176
>gb|BC058518.1| Mus musculus BCL2-associated athanogene 4, mRNA (cDNA clone MGC:66831 IMAGE:5717401), complete cds Length = 2042 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1222 caaactcttctacttcttgc 1203
>ref|NM_026121.2| Mus musculus BCL2-associated athanogene 4 (Bag4), mRNA Length = 4823 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1239 caaactcttctacttcttgc 1220
>gb|AC146435.3| Pan troglodytes BAC clone RP43-15P23 from 7, complete sequence Length = 192805 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 536 atctgtaataattttgaatt 555 |||||||||||||||||||| Sbjct: 117303 atctgtaataattttgaatt 117284
>gb|AC147331.3| Pan troglodytes BAC clone RP43-10H17 from 7, complete sequence Length = 189220 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 536 atctgtaataattttgaatt 555 |||||||||||||||||||| Sbjct: 81787 atctgtaataattttgaatt 81768
>gb|BC009102.1| Mus musculus BCL2-associated athanogene 4, mRNA (cDNA clone IMAGE:3482770), partial cds Length = 918 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 273 caaactcttctacttcttgc 254
>gb|AC116183.6| Rattus norvegicus 2 BAC CH230-24G20 (Children's Hospital Oakland Research Institute) complete sequence Length = 238137 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 85 caaaaattgcttcataaagttctcttac 112 |||||||||| ||||| ||||||||||| Sbjct: 37234 caaaaattgcatcatagagttctcttac 37207
>gb|BC037239.1| Mus musculus BCL2-associated athanogene 4, mRNA (cDNA clone IMAGE:4953039), partial cds Length = 4574 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1237 caaactcttctacttcttgc 1218
>gb|AC156990.11| Mus musculus chromosome 8, clone RP23-322E23, complete sequence Length = 201790 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 189425 caaactcttctacttcttgc 189444
>emb|AL031053.1|HS267M20 Human DNA sequence from clone RP1-267M20 on chromosome Xq22.2-22.3, complete sequence Length = 167943 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 537 tctgtaataattttgaatttcctg 560 ||||| |||||||||||||||||| Sbjct: 2181 tctgttataattttgaatttcctg 2158
>emb|CR391994.10| Zebrafish DNA sequence from clone DKEY-239B22, complete sequence Length = 157765 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 92 tgcttcataaagttctctta 111 |||||||||||||||||||| Sbjct: 64462 tgcttcataaagttctctta 64443
>gb|AF332863.1| Mus musculus silencer of death domain (SODD) mRNA, complete cds Length = 2154 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1232 caaactcttctacttcttgc 1213
>dbj|AK136899.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched library, clone:9330172K04 product:BCL2-associated athanogene 4, full insert sequence Length = 4550 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1229 caaactcttctacttcttgc 1210
>gb|AC007543.4| Homo sapiens 12p12 BAC RPCI11-1018J8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 212176 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tgagctacaacatagggataaaaa 201 |||||||||| ||||||||||||| Sbjct: 60751 tgagctacaaaatagggataaaaa 60728
>dbj|AK160316.1| Mus musculus 16 days embryo lung cDNA, RIKEN full-length enriched library, clone:8430404F19 product:BCL2-associated athanogene 4, full insert sequence Length = 1950 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1231 caaactcttctacttcttgc 1212
>dbj|AK162658.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830147C21 product:BCL2-associated athanogene 4, full insert sequence Length = 4780 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1226 caaactcttctacttcttgc 1207
>emb|BX470176.11| Zebrafish DNA sequence from clone CH211-120C23 in linkage group 7, complete sequence Length = 176596 Score = 40.1 bits (20), Expect = 9.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgcagaagttc 403 ||||||||| | |||||||||||||||| Sbjct: 104963 caaactctttttcttcttgcagaagttc 104936
>dbj|AK010765.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410112I15 product:BCL2-associated athanogene 4, full insert sequence Length = 2126 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 1230 caaactcttctacttcttgc 1211
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome Length = 6260361 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 aatgtccctttatctgtaat 544 |||||||||||||||||||| Sbjct: 2434731 aatgtccctttatctgtaat 2434750
>dbj|AK090261.1| Mus musculus 21 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:G630030A02 product:hypothetical protein, full insert sequence Length = 2293 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 376 caaactcttctacttcttgc 395 |||||||||||||||||||| Sbjct: 686 caaactcttctacttcttgc 705
>gb|AC013288.7|AC013288 Arabidopsis thaliana chromosome 1 BAC F4N21 genomic sequence, complete sequence Length = 96899 Score = 40.1 bits (20), Expect = 9.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 384 tctacttcttgcagaagttcatcctttgtgtgattacatgatgt 427 |||||||||| || ||||| ||||||||||| ||||| ||||| Sbjct: 90336 tctacttcttccaccagttcgtcctttgtgtggttacacgatgt 90293
>gb|AC013401.10| Homo sapiens BAC clone RP11-98N11 from 2, complete sequence Length = 168595 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 532 ctttatctgtaataattttg 551 |||||||||||||||||||| Sbjct: 162824 ctttatctgtaataattttg 162805
>gb|AC068252.9| Mus musculus chromosome 5, clone RP23-312J7, complete sequence Length = 190438 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 gactgccagtgtaggctaca 156 |||||||||||||||||||| Sbjct: 132705 gactgccagtgtaggctaca 132724
>gb|AC153621.5| Mus musculus 6 BAC RP23-272K20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 215547 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 ctgaggataaaattgagcta 184 |||||||||||||||||||| Sbjct: 187473 ctgaggataaaattgagcta 187492
>emb|CR954198.2| Medicago truncatula chromosome 5 clone mte1-67f21, COMPLETE SEQUENCE Length = 101335 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 gataaaattgagctacaaca 189 |||||||||||||||||||| Sbjct: 58022 gataaaattgagctacaaca 58003
>gb|AC159308.4| Mus musculus BAC clone RP23-187B11 from chromosome 9, complete sequence Length = 217927 Score = 40.1 bits (20), Expect = 9.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 taaagttctcttactctctg 118 |||||||||||||||||||| Sbjct: 70222 taaagttctcttactctctg 70241
>gb|AC171728.1| Lycopersicon esculentum chromosome 01 clone C01HBa0216G16, complete sequence Length = 196870 Score = 40.1 bits (20), Expect = 9.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 156 aacaacaacctgaggataaaattg 179 ||||||||||||| |||||||||| Sbjct: 142823 aacaacaacctgaagataaaattg 142800 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,823,967 Number of Sequences: 3902068 Number of extensions: 6823967 Number of successful extensions: 119991 Number of sequences better than 10.0: 49 Number of HSP's better than 10.0 without gapping: 49 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 119798 Number of HSP's gapped (non-prelim): 193 length of query: 714 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 691 effective length of database: 17,143,297,704 effective search space: 11846018713464 effective search space used: 11846018713464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)