>emb|AL596090.11| Mouse DNA sequence from clone RP23-135F6 on chromosome 11 Contains
the 5' end of the gene for the likely ortholog of H.
sapiens target of myb1-like 2 (chicken) (TOM1L2)
(A730055F12Rik), a glyceraldehyde-3-phosphate
dehydrogenase (Gapd) pseudogene, the gene for a novel
Leucine Rich Repeat domain-containing protein
(4930449E07Rik), the Atpaf2 gene for ATP synthase
mitochondrial F1 complex assembly factor 2, the gene for
a novel protein (4933439F18Rik), an acid phosphatase 1
soluble (Acp1) pseudogene, a ribosomal protein S4,
X-linked (Rps4x) pseudogene, the Drg2 gene for
developmentally regulated GTP binding protein 2, the 5'
end of the Myo15 gene for myosin XV and four CpG islands,
complete sequence
Length = 207440
Score = 38.2 bits (19), Expect = 9.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 2 acacacatactattagtat 20
|||||||||||||||||||
Sbjct: 4491 acacacatactattagtat 4473
>dbj|AP003115.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1000E4
Length = 115937
Score = 38.2 bits (19), Expect = 9.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 12 tattagtatttggtagtagaaga 34
|||||||||||||| ||||||||
Sbjct: 74721 tattagtatttggttgtagaaga 74743
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,164,353
Number of Sequences: 3902068
Number of extensions: 1164353
Number of successful extensions: 81656
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81567
Number of HSP's gapped (non-prelim): 87
length of query: 185
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 163
effective length of database: 17,147,199,772
effective search space: 2794993562836
effective search space used: 2794993562836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)