ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 ... 398 e-108
2ref|XM_476794.1| Oryza sativa (japonica cultivar-group), mRNA 174 1e-40
3ref|XM_476789.1| Oryza sativa (japonica cultivar-group), mRNA 174 1e-40
4gb|AY109733.1| Zea mays CL5075_1 mRNA sequence 172 4e-40
5ref|XM_476787.1| Oryza sativa (japonica cultivar-group), mRNA 167 3e-38
6ref|XM_469971.1| Oryza sativa (japonica cultivar-group), mRNA 145 9e-32
7dbj|AK059548.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 9e-32
8dbj|AK058881.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 9e-32
9dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 143 4e-31
10dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic D... 143 4e-31
11dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic D... 143 4e-31
12gb|AY496116.1| Capsicum annuum putative ribosomal protein mRNA, ... 125 9e-26
13gb|AF400215.1| Spodoptera frugiperda ribosomal protein S18 mRNA,... 113 3e-22
14gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genom... 105 8e-20
15gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 geno... 105 8e-20
16gb|BT013131.1| Lycopersicon esculentum clone 114423F, mRNA sequence 105 8e-20
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 105 8e-20
18dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 105 8e-20
19ref|XM_360287.1| Magnaporthe grisea 70-15 hypothetical protein (... 101 1e-18
20gb|AY849628.1| Magnaporthe grisea 40S ribosomal protein S18-like... 101 1e-18
21dbj|AB180432.1| Plutella xylostella mRNA for Ribosomal protein S... 98 2e-17
22ref|XM_789831.1| PREDICTED: Strongylocentrotus purpuratus simila... 96 8e-17
23gb|DQ200372.1| Solanum tuberosum clone 058H04 unknown mRNA 94 3e-16
24ref|XM_778977.1| PREDICTED: Strongylocentrotus purpuratus simila... 88 2e-14
25gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete se... 86 7e-14
26emb|AM048974.1| Sphaerius sp. APV-2005 mRNA for ribosomal protei... 82 1e-12
27ref|NM_117048.2| Arabidopsis thaliana RPS18C (S18 RIBOSOMAL PROT... 78 2e-11
28ref|NM_102125.2| Arabidopsis thaliana PFL (POINTED FIRST LEAVES)... 78 2e-11
29gb|BT020298.1| Arabidopsis thaliana At1g22780 gene, complete cds 78 2e-11
30gb|AY769334.1| Bombyx mori ribosomal protein S18 (RpS18) mRNA, c... 78 2e-11
31gb|BT025610.1| Arabidopsis thaliana At1g22780 mRNA, complete cds 78 2e-11
32gb|AY064680.1| Arabidopsis thaliana S18.A ribosomal protein (At4... 78 2e-11
33gb|AF411781.1|AF411781 Arabidopsis thaliana At1g22780/T22J18_5 m... 78 2e-11
34gb|AF386941.1|AF386941 Arabidopsis thaliana S18.A ribosomal prot... 78 2e-11
35gb|AF370463.1|AF370463 Arabidopsis thaliana S18.A ribosomal prot... 78 2e-11
36emb|BX813906.1|CNS0ACAK Arabidopsis thaliana Full-length cDNA Co... 78 2e-11
37gb|AY087428.1| Arabidopsis thaliana clone 35333 mRNA, complete s... 78 2e-11
38gb|AY086334.1| Arabidopsis thaliana clone 24071 mRNA, complete s... 78 2e-11
39emb|Z28701.1|ATS18RP1 A.thaliana (C24) mRNA for S18 ribosomal pr... 78 2e-11
40ref|XM_746138.1| Aspergillus fumigatus Af293 ribosomal protein S... 76 7e-11
41gb|BT006539.1| Arabidopsis thaliana At4g09800 gene, complete cds 76 7e-11
42gb|AY440501.1| Armigeres subalbatus ASAP ID: 41411 cytosolic sma... 74 3e-10
43ref|XM_657953.1| Aspergillus nidulans FGSC A4 hypothetical prote... 74 3e-10
44gb|AY099517.1| Danio rerio 40S ribosomal protein S18 (rps18) mRN... 70 4e-09
45ref|NM_173234.1| Danio rerio ribosomal protein S18 (rps18), mRNA 70 4e-09
46gb|AF210641.1|AF210641 Danio rerio Ke3 mRNA, partial cds 70 4e-09
47gb|BC062289.1| Danio rerio ribosomal protein S18, mRNA (cDNA clo... 70 4e-09
48emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, ... 68 2e-08
49emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, ... 68 2e-08
50emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BA... 68 2e-08
51emb|Z28962.1|ATS18RP3 A.thaliana (Columbia) gene for S18 ribosom... 68 2e-08
52ref|NM_103125.2| Arabidopsis thaliana RNA binding / structural c... 66 7e-08
53ref|XM_387069.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 66 7e-08
54gb|AY232075.1| Drosophila yakuba clone yak-ad_RpS18 mRNA sequence 66 7e-08
55gb|AY231741.1| Drosophila yakuba clone yak-em_RpS18 mRNA sequence 66 7e-08
56gb|AY070029.1| Arabidopsis thaliana putative ribosomal protein S... 66 7e-08
57gb|AY034965.1| Arabidopsis thaliana putative ribosomal protein S... 66 7e-08
58gb|BT024929.1| Drosophila melanogaster IP16603 full insert cDNA 66 7e-08
59gb|AY118434.1| Drosophila melanogaster RH43343 full insert cDNA 66 7e-08
60dbj|AB226103.1| Aspergillus oryzae cDNA, contig sequence: AoEST2960 66 7e-08
61dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 66 7e-08
62ref|NM_166383.1| Drosophila melanogaster Ribosomal protein S18 C... 66 7e-08
63ref|NM_057616.3| Drosophila melanogaster Ribosomal protein S18 C... 66 7e-08
64gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56... 66 7e-08
65gb|DQ066248.1| Ixodes scapularis isolate ISN-L-49 ribosomal prot... 66 7e-08
66emb|BX816977.1|CNS0ADD2 Arabidopsis thaliana Full-length cDNA Co... 66 7e-08
67dbj|AB162351.1| Drosophila sechellia genes, CG11099 to CG8914 re... 66 7e-08
68dbj|AB162349.1| Drosophila simulans genes, CG11099 to CG8900 reg... 66 7e-08
69gb|AY086800.1| Arabidopsis thaliana clone 27800 mRNA, complete s... 66 7e-08
70emb|Z28702.1|ATS18RP2 A.thaliana (Columbia) mRNA for S18 ribosom... 66 7e-08
71gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58... 66 7e-08
72gb|AC004321.1|AC004321 Drosophila melanogaster DNA sequence (P1 ... 66 7e-08
73gb|L22959.1|DRORPS18A Drosophila melanogaster ribosomal protein ... 66 7e-08
74gb|AC079286.2|AC079286 Arabidopsis thaliana chromosome 1 BAC T15... 60 4e-06
75gb|AC015446.4|AC015446 Arabidopsis thaliana chromosome I BAC F12... 60 4e-06
76gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, part... 58 2e-05
77ref|XM_322560.1| Neurospora crassa OR74A hypothetical protein (N... 58 2e-05
78ref|XM_951701.1| Neurospora crassa OR74A hypothetical protein (N... 58 2e-05
79gb|AF548335.1| Branchiostoma belcheri ribosomal protein S18 mRNA... 58 2e-05
80gb|AY342352.1| Ixodes ricinus ribosomal protein S18 mRNA, partia... 58 2e-05
81dbj|AB182248.1| Antheraea yamamai Antheraea S18 gene mRNA for ri... 58 2e-05
82ref|XM_752114.1| Ustilago maydis 521 hypothetical protein (UM010... 56 7e-05
83emb|BX072327.1|CNS09RYZ Single read from an extremity of a full-... 56 7e-05
84emb|BX072326.1|CNS09RYY Single read from an extremity of a full-... 56 7e-05
85emb|BX072311.1|CNS09RYJ Single read from an extremity of a full-... 56 7e-05
86emb|BX072310.1|CNS09RYI Single read from an extremity of a full-... 56 7e-05
87emb|BX072288.1|CNS09RXW Single read from an extremity of a full-... 56 7e-05
88emb|BX072287.1|CNS09RXV Single read from an extremity of a full-... 56 7e-05
89emb|BX069062.1|CNS09PGA Single read from an extremity of a full-... 56 7e-05
90emb|BX063554.1|CNS09L7A Single read from an extremity of a full-... 56 7e-05
91emb|BX049522.1|CNS09ADI Single read from an extremity of a full-... 56 7e-05
92emb|BX048448.1|CNS099JO Single read from an extremity of a full-... 56 7e-05
93emb|BX048447.1|CNS099JN Single read from an extremity of a full-... 56 7e-05
94emb|BX043249.1|CNS095J9 Single read from an extremity of a full-... 56 7e-05
95emb|BX042743.1|CNS09557 Single read from an extremity of a full-... 56 7e-05
96emb|BX042742.1|CNS09556 Single read from an extremity of a full-... 56 7e-05
97emb|BX038898.1|CNS0926E Single read from an extremity of a full-... 56 7e-05
98emb|BX038897.1|CNS0926D Single read from an extremity of a full-... 56 7e-05
99emb|BX038809.1|CNS0923X Single read from an extremity of a full-... 56 7e-05
100emb|BX038808.1|CNS0923W Single read from an extremity of a full-... 56 7e-05
101emb|BX038794.1|CNS0923I Single read from an extremity of a full-... 56 7e-05
102emb|BX038793.1|CNS0923H Single read from an extremity of a full-... 56 7e-05
103emb|BX038685.1|CNS0920H Single read from an extremity of a full-... 56 7e-05
104emb|BX038684.1|CNS0920G Single read from an extremity of a full-... 56 7e-05
105emb|BX038638.1|CNS091Z6 Single read from an extremity of a full-... 56 7e-05
106emb|BX038637.1|CNS091Z5 Single read from an extremity of a full-... 56 7e-05
107emb|BX038386.1|CNS091S6 Single read from an extremity of a full-... 56 7e-05
108emb|BX038260.1|CNS091OO Single read from an extremity of a full-... 56 7e-05
109emb|BX037628.1|CNS09174 Single read from an extremity of a full-... 56 7e-05
110emb|BX037394.1|CNS0910M Single read from an extremity of a full-... 56 7e-05
111emb|BX036909.1|CNS090N5 Single read from an extremity of a full-... 56 7e-05
112emb|BX034354.1|CNS08YO6 Single read from an extremity of a full-... 56 7e-05
113emb|BX034173.1|CNS08YJ5 Single read from an extremity of a full-... 56 7e-05
114emb|BX033670.1|CNS08Y56 Single read from an extremity of a full-... 56 7e-05
115emb|BX033669.1|CNS08Y55 Single read from an extremity of a full-... 56 7e-05
116emb|BX033110.1|CNS08XPM Single read from an extremity of a full-... 56 7e-05
117emb|BX032956.1|CNS08XLC Single read from an extremity of a full-... 56 7e-05
118emb|BX032189.1|CNS08X01 Single read from an extremity of a full-... 56 7e-05
119emb|BX030688.1|CNS08VUC Single read from an extremity of a full-... 56 7e-05
120emb|BX027156.1|CNS08T48 Single read from an extremity of a full-... 56 7e-05
121emb|BX026624.1|CNS08SPG Single read from an extremity of a full-... 56 7e-05
122emb|BX026623.1|CNS08SPF Single read from an extremity of a full-... 56 7e-05
123emb|BX023324.1|CNS08Q5S Single read from an extremity of a full-... 56 7e-05
124emb|BX023323.1|CNS08Q5R Single read from an extremity of a full-... 56 7e-05
125emb|BX022521.1|CNS08PJH Single read from an extremity of a full-... 56 7e-05
126emb|BX021989.1|CNS08P4P Single read from an extremity of a full-... 56 7e-05
127emb|BX021988.1|CNS08P4O Single read from an extremity of a full-... 56 7e-05
128emb|BX021615.1|CNS08OUB Single read from an extremity of a full-... 56 7e-05
129emb|BX020788.1|CNS08O7C Single read from an extremity of a full-... 56 7e-05
130emb|BX020787.1|CNS08O7B Single read from an extremity of a full-... 56 7e-05
131emb|BX016687.1|CNS08L1F Single read from an extremity of a full-... 56 7e-05
132emb|BX009941.1|CNS08FU1 Single read from an extremity of a full-... 56 7e-05
133emb|BX009940.1|CNS08FU0 Single read from an extremity of a full-... 56 7e-05
134emb|BX009869.1|CNS08FS1 Single read from an extremity of a full-... 56 7e-05
135emb|Y12227.1|ATY12227 Arabidopsis thaliana DNA, 24 kb surroundin... 56 7e-05
136gb|AF526232.1| Argopecten irradians isolate iolsaicl552ct593cn61... 56 7e-05
137gb|AC003979.2|T22J18 Arabidopsis thaliana chromosome 1 BAC T22J1... 56 7e-05
138gb|AF283268.1|AF283268 Anopheles gambiae strain G3 ribosomal pro... 56 7e-05
139emb|Z23165.1|ATRBPS18A A.thaliana ribosomal protein gene S18, co... 56 7e-05
140ref|XM_311570.2| Anopheles gambiae str. PEST ENSANGP00000022445 ... 56 7e-05
141emb|AJ843092.1| Platichthys flesus mRNA for 40S ribosomal protei... 54 3e-04
142gb|DQ413212.1| Acyrthosiphon pisum isolate WHAP0121 putative rib... 54 3e-04
143emb|CR699685.2|CNS0G2TT Tetraodon nigroviridis full-length cDNA 52 0.001
144emb|CR697045.2|CNS0G0SH Tetraodon nigroviridis full-length cDNA 52 0.001
145emb|BX063555.1|CNS09L7B Single read from an extremity of a full-... 52 0.001
146emb|BX050031.1|CNS09ARN Single read from an extremity of a full-... 52 0.001
147emb|BX037931.1|CNS091FJ Single read from an extremity of a full-... 52 0.001
148emb|BX037930.1|CNS091FI Single read from an extremity of a full-... 52 0.001
149emb|BX037395.1|CNS0910N Single read from an extremity of a full-... 52 0.001
150emb|BX032190.1|CNS08X02 Single read from an extremity of a full-... 52 0.001
151emb|BX009870.1|CNS08FS2 Single read from an extremity of a full-... 52 0.001
152emb|BX826567.1|CNS0A3AT Arabidopsis thaliana Full-length cDNA Co... 52 0.001
153emb|CR734341.2|CNS0GTEC Tetraodon nigroviridis full-length cDNA 50 0.004
154emb|CR674974.2|CNS0FJS4 Tetraodon nigroviridis full-length cDNA 50 0.004
155emb|CR734533.2|CNS0GTJO Tetraodon nigroviridis full-length cDNA 50 0.004
156emb|CR733895.2|CNS0GT1Y Tetraodon nigroviridis full-length cDNA 50 0.004
157emb|CR733804.2|CNS0GSZF Tetraodon nigroviridis full-length cDNA 50 0.004
158emb|CR720262.2|CNS0GIP8 Tetraodon nigroviridis full-length cDNA 50 0.004
159emb|CR722880.2|CNS0GKPY Tetraodon nigroviridis full-length cDNA 50 0.004
160emb|CR722776.2|CNS0GKN2 Tetraodon nigroviridis full-length cDNA 50 0.004
161emb|CR722174.2|CNS0GK6C Tetraodon nigroviridis full-length cDNA 50 0.004
162emb|CR721952.2|CNS0GK06 Tetraodon nigroviridis full-length cDNA 50 0.004
163emb|CR720455.2|CNS0GIUL Tetraodon nigroviridis full-length cDNA 50 0.004
164emb|CR704786.2|CNS0G6RI Tetraodon nigroviridis full-length cDNA 50 0.004
165emb|CR703781.2|CNS0G5ZL Tetraodon nigroviridis full-length cDNA 50 0.004
166emb|CR703599.2|CNS0G5UJ Tetraodon nigroviridis full-length cDNA 50 0.004
167emb|CR703505.2|CNS0G5RX Tetraodon nigroviridis full-length cDNA 50 0.004
168emb|CR703433.2|CNS0G5PX Tetraodon nigroviridis full-length cDNA 50 0.004
169emb|CR702036.2|CNS0G4N4 Tetraodon nigroviridis full-length cDNA 50 0.004
170emb|CR702025.2|CNS0G4MT Tetraodon nigroviridis full-length cDNA 50 0.004
171emb|CR702003.2|CNS0G4M7 Tetraodon nigroviridis full-length cDNA 50 0.004
172emb|CR701412.2|CNS0G45S Tetraodon nigroviridis full-length cDNA 50 0.004
173emb|CR701350.2|CNS0G442 Tetraodon nigroviridis full-length cDNA 50 0.004
174emb|CR701061.2|CNS0G3W1 Tetraodon nigroviridis full-length cDNA 50 0.004
175emb|CR699796.2|CNS0G2WW Tetraodon nigroviridis full-length cDNA 50 0.004
176emb|CR699943.2|CNS0G30Z Tetraodon nigroviridis full-length cDNA 50 0.004
177emb|CR699936.2|CNS0G30S Tetraodon nigroviridis full-length cDNA 50 0.004
178emb|CR699450.2|CNS0G2NA Tetraodon nigroviridis full-length cDNA 50 0.004
179emb|CR691285.2|CNS0FWCH Tetraodon nigroviridis full-length cDNA 50 0.004
180emb|CR698404.2|CNS0G1U8 Tetraodon nigroviridis full-length cDNA 50 0.004
181emb|CR697912.2|CNS0G1GK Tetraodon nigroviridis full-length cDNA 50 0.004
182emb|CR697012.2|CNS0G0RK Tetraodon nigroviridis full-length cDNA 50 0.004
183emb|CR696669.2|CNS0G0I1 Tetraodon nigroviridis full-length cDNA 50 0.004
184emb|CR696546.2|CNS0G0EM Tetraodon nigroviridis full-length cDNA 50 0.004
185emb|CR696299.2|CNS0G07R Tetraodon nigroviridis full-length cDNA 50 0.004
186emb|CR694383.2|CNS0FYQJ Tetraodon nigroviridis full-length cDNA 50 0.004
187emb|CR694171.2|CNS0FYKN Tetraodon nigroviridis full-length cDNA 50 0.004
188emb|CR694138.2|CNS0FYJQ Tetraodon nigroviridis full-length cDNA 50 0.004
189emb|CR694134.2|CNS0FYJM Tetraodon nigroviridis full-length cDNA 50 0.004
190emb|CR694030.2|CNS0FYGQ Tetraodon nigroviridis full-length cDNA 50 0.004
191emb|CR693776.2|CNS0FY9O Tetraodon nigroviridis full-length cDNA 50 0.004
192emb|CR693694.2|CNS0FY7E Tetraodon nigroviridis full-length cDNA 50 0.004
193emb|CR693089.2|CNS0FXQL Tetraodon nigroviridis full-length cDNA 50 0.004
194emb|CR692975.2|CNS0FXNF Tetraodon nigroviridis full-length cDNA 50 0.004
195emb|CR692013.2|CNS0FWWP Tetraodon nigroviridis full-length cDNA 50 0.004
196emb|CR690406.2|CNS0FVO2 Tetraodon nigroviridis full-length cDNA 50 0.004
197emb|CR689779.2|CNS0FV6N Tetraodon nigroviridis full-length cDNA 50 0.004
198emb|CR688604.2|CNS0FUA0 Tetraodon nigroviridis full-length cDNA 50 0.004
199emb|CR688046.2|CNS0FTUI Tetraodon nigroviridis full-length cDNA 50 0.004
200emb|CR687925.2|CNS0FTR5 Tetraodon nigroviridis full-length cDNA 50 0.004
201emb|CR686387.2|CNS0FSKF Tetraodon nigroviridis full-length cDNA 50 0.004
202emb|CR686304.2|CNS0FSI4 Tetraodon nigroviridis full-length cDNA 50 0.004
203emb|CR686239.2|CNS0FSGB Tetraodon nigroviridis full-length cDNA 50 0.004
204emb|CR685614.2|CNS0FRYY Tetraodon nigroviridis full-length cDNA 50 0.004
205emb|CR684442.2|CNS0FR2E Tetraodon nigroviridis full-length cDNA 50 0.004
206emb|CR683437.2|CNS0FQAH Tetraodon nigroviridis full-length cDNA 50 0.004
207emb|CR682886.2|CNS0FPV6 Tetraodon nigroviridis full-length cDNA 50 0.004
208emb|CR682487.2|CNS0FPK3 Tetraodon nigroviridis full-length cDNA 50 0.004
209emb|CR682175.2|CNS0FPBF Tetraodon nigroviridis full-length cDNA 50 0.004
210emb|CR681394.2|CNS0FOPQ Tetraodon nigroviridis full-length cDNA 50 0.004
211emb|CR680612.2|CNS0FO40 Tetraodon nigroviridis full-length cDNA 50 0.004
212emb|CR679692.2|CNS0FNEG Tetraodon nigroviridis full-length cDNA 50 0.004
213emb|CR679567.2|CNS0FNAZ Tetraodon nigroviridis full-length cDNA 50 0.004
214emb|CR678814.2|CNS0FMQ2 Tetraodon nigroviridis full-length cDNA 50 0.004
215emb|CR679090.2|CNS0FMXQ Tetraodon nigroviridis full-length cDNA 50 0.004
216emb|CR678694.2|CNS0FMMQ Tetraodon nigroviridis full-length cDNA 50 0.004
217emb|CR677677.2|CNS0FLUU Tetraodon nigroviridis full-length cDNA 50 0.004
218emb|CR677659.2|CNS0FLUC Tetraodon nigroviridis full-length cDNA 50 0.004
219emb|CR677875.2|CNS0FM0B Tetraodon nigroviridis full-length cDNA 50 0.004
220emb|CR677055.2|CNS0FLDN Tetraodon nigroviridis full-length cDNA 50 0.004
221emb|CR676589.2|CNS0FL0P Tetraodon nigroviridis full-length cDNA 50 0.004
222emb|CR676244.2|CNS0FKR4 Tetraodon nigroviridis full-length cDNA 50 0.004
223emb|CR675831.2|CNS0FKFX Tetraodon nigroviridis full-length cDNA 50 0.004
224emb|CR675684.2|CNS0FKBU Tetraodon nigroviridis full-length cDNA 50 0.004
225emb|CR675638.2|CNS0FKAK Tetraodon nigroviridis full-length cDNA 50 0.004
226emb|CR675556.2|CNS0FK8A Tetraodon nigroviridis full-length cDNA 50 0.004
227emb|CR674793.2|CNS0FJN3 Tetraodon nigroviridis full-length cDNA 50 0.004
228emb|CR674782.2|CNS0FJMS Tetraodon nigroviridis full-length cDNA 50 0.004
229emb|CR672937.2|CNS0FI7J Tetraodon nigroviridis full-length cDNA 50 0.004
230emb|CR671413.2|CNS0FH17 Tetraodon nigroviridis full-length cDNA 50 0.004
231emb|CR670010.2|CNS0FFY8 Tetraodon nigroviridis full-length cDNA 50 0.004
232emb|CR668099.2|CNS0FEH5 Tetraodon nigroviridis full-length cDNA 50 0.004
233emb|CR666571.2|CNS0FDAP Tetraodon nigroviridis full-length cDNA 50 0.004
234emb|CR666558.2|CNS0FDAC Tetraodon nigroviridis full-length cDNA 50 0.004
235emb|CR666487.2|CNS0FD8D Tetraodon nigroviridis full-length cDNA 50 0.004
236emb|CR666205.2|CNS0FD0J Tetraodon nigroviridis full-length cDNA 50 0.004
237emb|CR666012.2|CNS0FCV6 Tetraodon nigroviridis full-length cDNA 50 0.004
238emb|CR665971.2|CNS0FCU1 Tetraodon nigroviridis full-length cDNA 50 0.004
239emb|CR665244.2|CNS0FC9U Tetraodon nigroviridis full-length cDNA 50 0.004
240emb|CR664532.2|CNS0FBQ2 Tetraodon nigroviridis full-length cDNA 50 0.004
241emb|CR664405.2|CNS0FBMJ Tetraodon nigroviridis full-length cDNA 50 0.004
242emb|CR664162.2|CNS0FBFS Tetraodon nigroviridis full-length cDNA 50 0.004
243emb|CR663985.2|CNS0FBAV Tetraodon nigroviridis full-length cDNA 50 0.004
244emb|CR663647.2|CNS0FB1H Tetraodon nigroviridis full-length cDNA 50 0.004
245emb|CR663135.2|CNS0FAN9 Tetraodon nigroviridis full-length cDNA 50 0.004
246emb|CR662647.2|CNS0FA9P Tetraodon nigroviridis full-length cDNA 50 0.004
247emb|CR662501.2|CNS0FA5N Tetraodon nigroviridis full-length cDNA 50 0.004
248emb|CR663048.2|CNS0FAKU Tetraodon nigroviridis full-length cDNA 50 0.004
249emb|CR662236.1|CNS0F9YA Tetraodon nigroviridis full-length cDNA 50 0.004
250emb|CR660192.2|CNS0F8DI Tetraodon nigroviridis full-length cDNA 50 0.004
251emb|CR659614.2|CNS0F7XG Tetraodon nigroviridis full-length cDNA 50 0.004
252emb|CR659372.2|CNS0F7QQ Tetraodon nigroviridis full-length cDNA 50 0.004
253emb|CR659053.2|CNS0F7HV Tetraodon nigroviridis full-length cDNA 50 0.004
254emb|CR658943.2|CNS0F7ET Tetraodon nigroviridis full-length cDNA 50 0.004
255emb|CR658458.2|CNS0F71C Tetraodon nigroviridis full-length cDNA 50 0.004
256emb|CR658408.2|CNS0F6ZY Tetraodon nigroviridis full-length cDNA 50 0.004
257emb|CR658256.2|CNS0F6VQ Tetraodon nigroviridis full-length cDNA 50 0.004
258emb|CR657185.2|CNS0F61Z Tetraodon nigroviridis full-length cDNA 50 0.004
259emb|CR657479.2|CNS0F6A5 Tetraodon nigroviridis full-length cDNA 50 0.004
260emb|CR657387.2|CNS0F67L Tetraodon nigroviridis full-length cDNA 50 0.004
261emb|CR656585.2|CNS0F5LB Tetraodon nigroviridis full-length cDNA 50 0.004
262emb|CR656288.2|CNS0F5D2 Tetraodon nigroviridis full-length cDNA 50 0.004
263emb|CR655824.2|CNS0F506 Tetraodon nigroviridis full-length cDNA 50 0.004
264emb|CR655051.2|CNS0F4EP Tetraodon nigroviridis full-length cDNA 50 0.004
265emb|CR654549.2|CNS0F40R Tetraodon nigroviridis full-length cDNA 50 0.004
266emb|CR654507.2|CNS0F3ZL Tetraodon nigroviridis full-length cDNA 50 0.004
267emb|CR653869.2|CNS0F3HV Tetraodon nigroviridis full-length cDNA 50 0.004
268emb|CR651524.2|CNS0F1OQ Tetraodon nigroviridis full-length cDNA 50 0.004
269emb|CR651377.2|CNS0F1KN Tetraodon nigroviridis full-length cDNA 50 0.004
270emb|CR650659.2|CNS0F10P Tetraodon nigroviridis full-length cDNA 50 0.004
271emb|CR650612.2|CNS0F0ZE Tetraodon nigroviridis full-length cDNA 50 0.004
272emb|CR648545.2|CNS0EZDZ Tetraodon nigroviridis full-length cDNA 50 0.004
273emb|CR649903.2|CNS0F0FP Tetraodon nigroviridis full-length cDNA 50 0.004
274emb|CR649897.2|CNS0F0FJ Tetraodon nigroviridis full-length cDNA 50 0.004
275emb|CR650082.2|CNS0F0KO Tetraodon nigroviridis full-length cDNA 50 0.004
276emb|CR649301.2|CNS0EZYZ Tetraodon nigroviridis full-length cDNA 50 0.004
277emb|CR649145.2|CNS0EZUN Tetraodon nigroviridis full-length cDNA 50 0.004
278emb|CR649084.2|CNS0EZSY Tetraodon nigroviridis full-length cDNA 50 0.004
279emb|CR648289.2|CNS0EZ6V Tetraodon nigroviridis full-length cDNA 50 0.004
280emb|CR647649.2|CNS0EYP3 Tetraodon nigroviridis full-length cDNA 50 0.004
281emb|CR646928.2|CNS0EY52 Tetraodon nigroviridis full-length cDNA 50 0.004
282emb|CR646852.2|CNS0EY2Y Tetraodon nigroviridis full-length cDNA 50 0.004
283emb|CR643214.2|CNS0EV9W Tetraodon nigroviridis full-length cDNA 50 0.004
284emb|CR646670.2|CNS0EXXW Tetraodon nigroviridis full-length cDNA 50 0.004
285emb|CR646186.2|CNS0EXKG Tetraodon nigroviridis full-length cDNA 50 0.004
286emb|CR645374.2|CNS0EWXW Tetraodon nigroviridis full-length cDNA 50 0.004
287emb|CR645545.2|CNS0EX2N Tetraodon nigroviridis full-length cDNA 50 0.004
288emb|CR644929.2|CNS0EWLJ Tetraodon nigroviridis full-length cDNA 50 0.004
289emb|CR644417.2|CNS0EW7B Tetraodon nigroviridis full-length cDNA 50 0.004
290emb|CR642426.2|CNS0EUO0 Tetraodon nigroviridis full-length cDNA 50 0.004
291emb|CR642359.2|CNS0EUM5 Tetraodon nigroviridis full-length cDNA 50 0.004
292emb|CR642332.2|CNS0EULE Tetraodon nigroviridis full-length cDNA 50 0.004
293emb|CR641930.2|CNS0EUA8 Tetraodon nigroviridis full-length cDNA 50 0.004
294emb|CR641784.2|CNS0EU66 Tetraodon nigroviridis full-length cDNA 50 0.004
295emb|CR639750.2|CNS0ESLO Tetraodon nigroviridis full-length cDNA 50 0.004
296emb|CR639600.2|CNS0ESHI Tetraodon nigroviridis full-length cDNA 50 0.004
297emb|CR639369.2|CNS0ESB3 Tetraodon nigroviridis full-length cDNA 50 0.004
298emb|CR639264.2|CNS0ES86 Tetraodon nigroviridis full-length cDNA 50 0.004
299emb|CR638994.2|CNS0ES0O Tetraodon nigroviridis full-length cDNA 50 0.004
300emb|CR638421.2|CNS0ERKR Tetraodon nigroviridis full-length cDNA 50 0.004
301emb|CR638881.2|CNS0ERXJ Tetraodon nigroviridis full-length cDNA 50 0.004
302emb|CR638732.2|CNS0ERTE Tetraodon nigroviridis full-length cDNA 50 0.004
303emb|CR637163.2|CNS0EQLT Tetraodon nigroviridis full-length cDNA 50 0.004
304emb|CR637549.2|CNS0EQWJ Tetraodon nigroviridis full-length cDNA 50 0.004
305emb|CR635324.2|CNS0EP6Q Tetraodon nigroviridis full-length cDNA 50 0.004
306emb|CR635674.2|CNS0EPGG Tetraodon nigroviridis full-length cDNA 50 0.004
307emb|CR634323.2|CNS0EOEX Tetraodon nigroviridis full-length cDNA 50 0.004
308emb|CR634758.2|CNS0EOR0 Tetraodon nigroviridis full-length cDNA 50 0.004
309emb|CR634222.2|CNS0EOC4 Tetraodon nigroviridis full-length cDNA 50 0.004
310emb|CR633494.2|CNS0ENRW Tetraodon nigroviridis full-length cDNA 50 0.004
311gb|AY829783.1| Lonomia obliqua ribosomal protein 25 mRNA, partia... 50 0.004
312emb|BX006616.1|CNS08D9O Single read from an extremity of a full-... 50 0.004
313emb|AL845501.9| Mouse DNA sequence from clone RP23-194C12 on chr... 50 0.004
314gb|AF402827.1| Ictalurus punctatus 40S ribosomal protein S18 mRN... 50 0.004
315emb|BX814653.1|CNS0AC5P Arabidopsis thaliana Full-length cDNA Co... 50 0.004
316gb|DQ084044.1| Oxyuranus scutellatus 40S ribosomal protein S18 m... 48 0.016
317emb|BX047931.1|CNS0995B Single read from an extremity of a full-... 48 0.016
318emb|BX032955.1|CNS08XLB Single read from an extremity of a full-... 48 0.016
319ref|XM_503080.1| Yarrowia lipolytica CLIB122, YALI0D20614g predi... 46 0.064
320emb|AL117108.1|CNS01DP8 Botrytis cinerea strain T4 cDNA library 46 0.064
321emb|AL115533.1|CNS01CHH Botrytis cinerea strain T4 cDNA library 46 0.064
322emb|AL117060.1|CNS01DNW Botrytis cinerea strain T4 cDNA library 46 0.064
323emb|AL116913.1|CNS01DJT Botrytis cinerea strain T4 cDNA library 46 0.064
324emb|AL116912.1|CNS01DJS Botrytis cinerea strain T4 cDNA library 46 0.064
325emb|AL115063.1|CNS01C4F Botrytis cinerea strain T4 cDNA library 46 0.064
326emb|AL114593.1|CNS01BRD Botrytis cinerea strain T4 cDNA library 46 0.064
327emb|AL114271.1|CNS01BIF Botrytis cinerea strain T4 cDNA library 46 0.064
328emb|AL113813.1|CNS01B5P Botrytis cinerea strain T4 cDNA library 46 0.064
329emb|AL112326.1|CNS01A0E Botrytis cinerea strain T4 cDNA library 46 0.064
330emb|AL112070.1|CNS019TA Botrytis cinerea strain T4 cDNA library 46 0.064
331emb|AL112020.1|CNS019RW Botrytis cinerea strain T4 cDNA library 46 0.064
332emb|AL111985.1|CNS019QX Botrytis cinerea strain T4 cDNA library 46 0.064
333emb|AL111834.1|CNS019MQ Botrytis cinerea strain T4 cDNA library 46 0.064
334emb|AL111737.1|CNS019K1 Botrytis cinerea strain T4 cDNA library 46 0.064
335gb|AY961557.1| Lysiphlebus testaceipes ribosomal protein S18 (Rp... 46 0.064
336emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 46 0.064
337ref|NM_213557.1| Rattus norvegicus ribosomal protein S18 (Rps18)... 44 0.25
338gb|AF110520.1|MMHC425O18 Mus musculus major histocompatibility c... 44 0.25
339gb|BC081458.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 44 0.25
340gb|BC081459.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 44 0.25
341gb|AY625691.1| Mus musculus UDP-Gal:betaGalNAc beta 1,3-galactos... 44 0.25
342ref|NM_011296.1| Mus musculus ribosomal protein S18 (Rps18), mRNA 44 0.25
343gb|BC100604.1| Mus musculus ribosomal protein S18, transcript va... 44 0.25
344gb|AC158364.4| Mus musculus BAC clone RP23-187J8 from chromosome... 44 0.25
345emb|CR974462.5| Mouse DNA sequence from clone RP23-222K15 on chr... 44 0.25
346emb|X57529.1|RRRPS18A R.rattus ribosomal protein S18 mRNA 44 0.25
347gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosom... 44 0.25
348gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, comple... 44 0.25
349emb|CR719205.2|CNS0GHVV Tetraodon nigroviridis full-length cDNA 44 0.25
350emb|CR718915.2|CNS0GHNT Tetraodon nigroviridis full-length cDNA 44 0.25
351emb|CR718870.2|CNS0GHMK Tetraodon nigroviridis full-length cDNA 44 0.25
352emb|CR718648.2|CNS0GHGE Tetraodon nigroviridis full-length cDNA 44 0.25
353emb|CR718490.2|CNS0GHC0 Tetraodon nigroviridis full-length cDNA 44 0.25
354emb|CR718379.2|CNS0GH8X Tetraodon nigroviridis full-length cDNA 44 0.25
355emb|CR718245.2|CNS0GH57 Tetraodon nigroviridis full-length cDNA 44 0.25
356emb|CR717975.2|CNS0GGXP Tetraodon nigroviridis full-length cDNA 44 0.25
357emb|CR717842.2|CNS0GGU0 Tetraodon nigroviridis full-length cDNA 44 0.25
358emb|CR717122.2|CNS0GGA3 Tetraodon nigroviridis full-length cDNA 44 0.25
359emb|CR716835.2|CNS0GG24 Tetraodon nigroviridis full-length cDNA 44 0.25
360emb|CR716783.2|CNS0GG0O Tetraodon nigroviridis full-length cDNA 44 0.25
361emb|CR716547.2|CNS0GFU4 Tetraodon nigroviridis full-length cDNA 44 0.25
362emb|CR716188.2|CNS0GFK5 Tetraodon nigroviridis full-length cDNA 44 0.25
363emb|CR716119.2|CNS0GFIB Tetraodon nigroviridis full-length cDNA 44 0.25
364emb|CR713825.2|CNS0GDQL Tetraodon nigroviridis full-length cDNA 44 0.25
365emb|CR713761.2|CNS0GDOT Tetraodon nigroviridis full-length cDNA 44 0.25
366emb|CR713713.2|CNS0GDNH Tetraodon nigroviridis full-length cDNA 44 0.25
367emb|CR713030.2|CNS0GD4I Tetraodon nigroviridis full-length cDNA 44 0.25
368emb|CR712757.2|CNS0GCWX Tetraodon nigroviridis full-length cDNA 44 0.25
369emb|CR711259.2|CNS0GBRB Tetraodon nigroviridis full-length cDNA 44 0.25
370emb|CR710553.2|CNS0GB7P Tetraodon nigroviridis full-length cDNA 44 0.25
371emb|CR710490.2|CNS0GB5Y Tetraodon nigroviridis full-length cDNA 44 0.25
372emb|CR710397.2|CNS0GB3D Tetraodon nigroviridis full-length cDNA 44 0.25
373emb|CR710326.2|CNS0GB1E Tetraodon nigroviridis full-length cDNA 44 0.25
374emb|CR710081.2|CNS0GAUL Tetraodon nigroviridis full-length cDNA 44 0.25
375emb|CR709316.2|CNS0GA9C Tetraodon nigroviridis full-length cDNA 44 0.25
376emb|CR709302.2|CNS0GA8Y Tetraodon nigroviridis full-length cDNA 44 0.25
377emb|CR709622.2|CNS0GAHU Tetraodon nigroviridis full-length cDNA 44 0.25
378emb|CR708879.2|CNS0G9X7 Tetraodon nigroviridis full-length cDNA 44 0.25
379emb|CR708197.2|CNS0G9E9 Tetraodon nigroviridis full-length cDNA 44 0.25
380emb|CR708195.2|CNS0G9E7 Tetraodon nigroviridis full-length cDNA 44 0.25
381emb|CR708147.2|CNS0G9CV Tetraodon nigroviridis full-length cDNA 44 0.25
382emb|CR707833.2|CNS0G945 Tetraodon nigroviridis full-length cDNA 44 0.25
383emb|CR707736.2|CNS0G91G Tetraodon nigroviridis full-length cDNA 44 0.25
384emb|CR707685.2|CNS0G901 Tetraodon nigroviridis full-length cDNA 44 0.25
385emb|CR707525.2|CNS0G8VL Tetraodon nigroviridis full-length cDNA 44 0.25
386emb|CR706946.2|CNS0G8FI Tetraodon nigroviridis full-length cDNA 44 0.25
387emb|CR706890.2|CNS0G8DY Tetraodon nigroviridis full-length cDNA 44 0.25
388emb|CR705389.2|CNS0G789 Tetraodon nigroviridis full-length cDNA 44 0.25
389emb|CR705005.2|CNS0G6XL Tetraodon nigroviridis full-length cDNA 44 0.25
390emb|CR704878.2|CNS0G6U2 Tetraodon nigroviridis full-length cDNA 44 0.25
391emb|CR705234.2|CNS0G73Y Tetraodon nigroviridis full-length cDNA 44 0.25
392emb|CR704207.2|CNS0G6BF Tetraodon nigroviridis full-length cDNA 44 0.25
393emb|CR702707.2|CNS0G55R Tetraodon nigroviridis full-length cDNA 44 0.25
394emb|CR699107.2|CNS0G2DR Tetraodon nigroviridis full-length cDNA 44 0.25
395ref|XM_723327.1| Plasmodium yoelii yoelii str. 17XNL ribosomal p... 44 0.25
396emb|CR692561.2|CNS0FXBX Tetraodon nigroviridis full-length cDNA 44 0.25
397emb|CR683824.2|CNS0FQL8 Tetraodon nigroviridis full-length cDNA 44 0.25
398emb|CR683804.2|CNS0FQKO Tetraodon nigroviridis full-length cDNA 44 0.25
399emb|CR682446.2|CNS0FPIY Tetraodon nigroviridis full-length cDNA 44 0.25
400emb|CR678273.2|CNS0FMB8 Tetraodon nigroviridis full-length cDNA 44 0.25
401emb|CR678402.1|CNS0FMEQ Tetraodon nigroviridis full-length cDNA 44 0.25
402ref|XM_734830.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.25
403emb|CR674533.2|CNS0FJFV Tetraodon nigroviridis full-length cDNA 44 0.25
404emb|CR673106.2|CNS0FIC8 Tetraodon nigroviridis full-length cDNA 44 0.25
405ref|XM_736816.1| Plasmodium chabaudi chabaudi ribosomal protein ... 44 0.25
406emb|CR632266.2|CNS0EMTS Tetraodon nigroviridis full-length cDNA 44 0.25
407emb|CR632183.2|CNS0EMRH Tetraodon nigroviridis full-length cDNA 44 0.25
408emb|CR631987.2|CNS0EMM1 Tetraodon nigroviridis full-length cDNA 44 0.25
409emb|BX069063.1|CNS09PGB Single read from an extremity of a full-... 44 0.25
410emb|BX034355.1|CNS08YO7 Single read from an extremity of a full-... 44 0.25
411emb|BX033111.1|CNS08XPN Single read from an extremity of a full-... 44 0.25
412emb|BX030689.1|CNS08VUD Single read from an extremity of a full-... 44 0.25
413emb|BX016493.1|CNS08KW1 Single read from an extremity of a full-... 44 0.25
414emb|BX883042.1| Rattus norvegicus chromosome 20, major histocomp... 44 0.25
415emb|AL122011.2|SPCC825 S.pombe chromosome III cosmid c825 44 0.25
416emb|AL034564.1|SPCC1259 S.pombe chromosome III cosmid c1259 44 0.25
417emb|AL607105.15| Mouse DNA sequence from clone RP23-371K8 on chr... 44 0.25
418gb|AC112212.2| Homo sapiens chromosome 3 clone RP11-185E15, comp... 44 0.25
419dbj|AK144398.1| Mus musculus 16 days neonate male medulla oblong... 44 0.25
420dbj|AK146354.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 44 0.25
421dbj|AK159437.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 44 0.25
422dbj|AK151580.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 44 0.25
423dbj|AK159821.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 44 0.25
424dbj|AK169246.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 44 0.25
425ref|NM_001023048.1| Schizosaccharomyces pombe 972h- 40S ribosoma... 44 0.25
426dbj|AK050626.1| Mus musculus 2 days neonate thymus thymic cells ... 44 0.25
427gb|BC093500.1| Mus musculus ribosomal protein S18, mRNA (cDNA cl... 44 0.25
428ref|XM_574920.1| PREDICTED: Rattus norvegicus similar to ribosom... 44 0.25
429emb|X83693.1|CRRPS18 C.reinhardtii mRNA for ribosomal protein S18 44 0.25
430gb|AF081143.1|AF081143 Cricetulus sp. ribosomal protein S18 mRNA... 44 0.25
431gb|AF100956.1|AF100956 Mus musculus major histocompatibility loc... 44 0.25
432gb|BC091729.1| Mus musculus cDNA clone IMAGE:2650809, containing... 44 0.25
433gb|AC122881.4| Mus musculus BAC clone RP23-79J21 from 13, comple... 44 0.25
434gb|AC135851.1| Homo sapiens chromosome 3 clone RP11-152N21, comp... 44 0.25
435gb|M76762.1|MUSKE3A Mus musculus ribosomal protein (Ke-3) gene, ... 44 0.25
436gb|M76763.1|MUSKE3B Mus musculus ribosomal protein (Ke-3) mRNA, ... 44 0.25
437gb|BC101788.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 42 1.0
438gb|BC101786.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 42 1.0
439ref|XM_518400.1| PREDICTED: Pan troglodytes similar to ribosomal... 42 1.0
440gb|BC106063.1| Homo sapiens ribosomal protein S18, mRNA (cDNA cl... 42 1.0
441ref|NM_022551.2| Homo sapiens ribosomal protein S18 (RPS18), mRNA 42 1.0
442gb|BC071678.1| Homo sapiens cDNA clone MGC:87887 IMAGE:5201620, ... 42 1.0
443ref|XM_977725.1| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.0
444ref|XM_912340.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.0
445ref|XM_357690.3| PREDICTED: Mus musculus similar to ribosomal pr... 42 1.0
446ref|XR_004649.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.0
447emb|CR734899.2|CNS0GTTU Tetraodon nigroviridis full-length cDNA 42 1.0
448emb|CR700305.2|CNS0G3B1 Tetraodon nigroviridis full-length cDNA 42 1.0
449emb|CR681861.2|CNS0FP2P Tetraodon nigroviridis full-length cDNA 42 1.0
450emb|CR683517.2|CNS0FQCP Tetraodon nigroviridis full-length cDNA 42 1.0
451emb|CR681204.2|CNS0FOKG Tetraodon nigroviridis full-length cDNA 42 1.0
452emb|CR677960.2|CNS0FM2O Tetraodon nigroviridis full-length cDNA 42 1.0
453emb|CR676300.2|CNS0FKSO Tetraodon nigroviridis full-length cDNA 42 1.0
454emb|CR675521.2|CNS0FK7B Tetraodon nigroviridis full-length cDNA 42 1.0
455emb|CR674465.2|CNS0FJDZ Tetraodon nigroviridis full-length cDNA 42 1.0
456emb|CR669926.2|CNS0FFVW Tetraodon nigroviridis full-length cDNA 42 1.0
457emb|CR669727.2|CNS0FFQD Tetraodon nigroviridis full-length cDNA 42 1.0
458emb|CR668754.2|CNS0FEZC Tetraodon nigroviridis full-length cDNA 42 1.0
459emb|CR666954.2|CNS0FDLC Tetraodon nigroviridis full-length cDNA 42 1.0
460emb|CR665553.2|CNS0FCIF Tetraodon nigroviridis full-length cDNA 42 1.0
461emb|CR650825.2|CNS0F15B Tetraodon nigroviridis full-length cDNA 42 1.0
462gb|BC012322.1| Homo sapiens mRNA similar to IGF-II mRNA-binding ... 42 1.0
463emb|AL078581.11|HSDJ12G14 Human DNA sequence from clone RP1-12G1... 42 1.0
464emb|X69150.1|HSRPS18 Homo sapiens mRNA for ribosomal protein S18 42 1.0
465emb|BX957299.8| Zebrafish DNA sequence from clone DKEY-179E8 in ... 42 1.0
466gb|AC012176.8| Homo sapiens chromosome 16 clone RP11-206F18, com... 42 1.0
467emb|CR621545.1| full-length cDNA clone CS0DI054YA04 of Placenta ... 42 1.0
468gb|AY090769.1| Homo sapiens ribosomal protein S18/S6-like mRNA, ... 42 1.0
469emb|CR611667.1| full-length cDNA clone CS0DD003YO07 of Neuroblas... 42 1.0
470emb|CR605901.1| full-length cDNA clone CS0DB009YM10 of Neuroblas... 42 1.0
471emb|CR604146.1| full-length cDNA clone CS0DB003YG14 of Neuroblas... 42 1.0
472emb|CR599079.1| full-length cDNA clone CS0DC015YK18 of Neuroblas... 42 1.0
473emb|CR596186.1| full-length cDNA clone CS0DI042YG15 of Placenta ... 42 1.0
474emb|CR593767.1| full-length cDNA clone CS0DI052YO14 of Placenta ... 42 1.0
475ref|XM_941412.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 1.0
476ref|XM_928927.1| PREDICTED: Homo sapiens similar to ribosomal pr... 42 1.0
477emb|BX817535.1|CNS0ABAG Arabidopsis thaliana Full-length cDNA Co... 42 1.0
478dbj|AB199895.1| Crassostrea gigas mRNA for ribosomal protein S18... 42 1.0
479gb|AC117984.2| Homo sapiens chromosome 16 clone CTD-2503H21, com... 42 1.0
480gb|AC073861.29| Homo sapiens 3 BAC RP11-234A1 (Roswell Park Canc... 42 1.0
481gb|AC026949.21| Mus musculus chromosome 7, clone RP23-103E11, co... 42 1.0
482gb|AY536376.1| Homo sapiens rhabdomyosarcoma antigen MU-RMS-40.2... 42 1.0
483ref|XM_511822.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 4.0
484ref|NM_001016358.2| Xenopus tropicalis hypothetical protein LOC5... 40 4.0
485gb|BC068873.1| Xenopus laevis hypothetical protein MGC82306, mRN... 40 4.0
486ref|XM_989187.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 4.0
487ref|XM_912873.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 4.0
488ref|XM_890398.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 4.0
489gb|AC125396.4| Mus musculus BAC clone RP24-69M4 from chromosome ... 40 4.0
490gb|AC129012.4| Mus musculus BAC clone RP24-545L10 from chromosom... 40 4.0
491gb|AC124503.2| Mus musculus BAC clone RP23-417F2 from chromosome... 40 4.0
492gb|AC121891.2| Mus musculus BAC clone RP24-155I9 from 8, complet... 40 4.0
493ref|XM_649589.1| Entamoeba histolytica HM-1:IMSS 40S ribosomal p... 40 4.0
494emb|CR718830.2|CNS0GHLG Tetraodon nigroviridis full-length cDNA 40 4.0
495emb|CR673747.2|CNS0FIU1 Tetraodon nigroviridis full-length cDNA 40 4.0
496emb|CR669065.2|CNS0FF7Z Tetraodon nigroviridis full-length cDNA 40 4.0
497emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chr... 40 4.0
498ref|XM_964627.1| PREDICTED: Tribolium castaneum similar to CG153... 40 4.0
499dbj|AB192511.1| Sus scrofa genomic DNA, chromosome 7, BAC clone:... 40 4.0
500ref|XM_945647.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 4.0

>gb|AY123418.1| Triticum aestivum putative ribosomal protein S18 mRNA, complete cds
          Length = 868

 Score =  398 bits (201), Expect = e-108
 Identities = 271/292 (92%), Gaps = 9/292 (3%)
 Strand = Plus / Minus

                                                                       
Query: 13  aattcaagtatacantntattaaaggttccagaaccgaaaaacattatctagggcaaaac 72
           |||||||| ||||| | |||||||||||||||||||  ||||||||||||||||||||||
Sbjct: 822 aattcaag-atacaatatattaaaggttccagaacc--aaaacattatctagggcaaaac 766

                                                                       
Query: 73  atcatccaaggtaatcgtctaaacaggaacactccttcagcttctggaaatggaccaaca 132
           ||||||||||||||||||||||||| ||||||||||| || || ||||||||||||||||
Sbjct: 765 atcatccaaggtaatcgtctaaacaagaacactccttaagattgtggaaatggaccaaca 706

                                                                       
Query: 133 cagtaatggtagcaaagctatgcgggatcattgagaagc---ttatcgcttcttggagac 189
           |||||   ||||||||||||||||||||| ||| |||||   ||||||||||||||||||
Sbjct: 705 cagta---gtagcaaagctatgcgggatctttgtgaagcagcttatcgcttcttggagac 649

                                                                       
Query: 190 accaacagtctttcctctcctgccggtagtcttggtgtgctgaccacggacacgcacgcc 249
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 648 accaacagtctttcctctcctgccggtagtctttgtgtgctgaccacggacacgcacgcc 589

                                                               
Query: 250 cnagtagtgacgaagaccacggnggttcctgatcttcttgagcctctcaagg 301
           | |||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 588 ccagtagtgacgaagaccacgatggttcctgatcttcttgagcctctcaagg 537



to top

>ref|XM_476794.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 438

 Score =  174 bits (88), Expect = 1e-40
 Identities = 119/130 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 438 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 379

                                                                       
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
           |||||||||||| |  ||| |||||||||| ||||||||| |||||||||||||||| ||
Sbjct: 378 accacggacacggagaccccagtagtgacggagaccacggtggttcctgatcttcttcag 319

                     
Query: 292 cctctcaagg 301
           ||||||||||
Sbjct: 318 cctctcaagg 309



to top

>ref|XM_476789.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 447

 Score =  174 bits (88), Expect = 1e-40
 Identities = 119/130 (91%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 447 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 388

                                                                       
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
           |||||||||||| |  ||| |||||||||| ||||||||| |||||||||||||||| ||
Sbjct: 387 accacggacacggagaccccagtagtgacggagaccacggtggttcctgatcttcttcag 328

                     
Query: 292 cctctcaagg 301
           ||||||||||
Sbjct: 327 cctctcaagg 318



to top

>gb|AY109733.1| Zea mays CL5075_1 mRNA sequence
          Length = 865

 Score =  172 bits (87), Expect = 4e-40
 Identities = 121/133 (90%)
 Strand = Plus / Minus

                                                                       
Query: 169 agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
           |||| |||||||||||||||||||||| |||||||| | |||||| ||||||||||||||
Sbjct: 542 agctcatcgcttcttggagacaccaacggtctttccacgcctgccagtagtcttggtgtg 483

                                                                       
Query: 229 ctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttctt 288
           ||| |||||||| || | |||| |||||||||| ||||||||| ||||||||||||||||
Sbjct: 482 ctggccacggacgcggaggccccagtagtgacgcagaccacggtggttcctgatcttctt 423

                        
Query: 289 gagcctctcaagg 301
           |||||||||||||
Sbjct: 422 gagcctctcaagg 410



to top

>ref|XM_476787.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 459

 Score =  167 bits (84), Expect = 3e-38
 Identities = 118/130 (90%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 459 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 400

                                                                       
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
           ||| |||||||| |  ||| |||||||||| ||||||||| |||||||||||||||| ||
Sbjct: 399 accgcggacacggagaccccagtagtgacggagaccacggtggttcctgatcttcttcag 340

                     
Query: 292 cctctcaagg 301
           ||||||||||
Sbjct: 339 cctctcaagg 330



to top

>ref|XM_469971.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1013

 Score =  145 bits (73), Expect = 9e-32
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| | |||| ||||||| |  ||||||||| |||||||||||||||||
Sbjct: 493 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctgatcttcttg 434

                      
Query: 290 agcctctcaag 300
           |||||||||||
Sbjct: 433 agcctctcaag 423



to top

>dbj|AK059548.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-F08, full
           insert sequence
          Length = 728

 Score =  145 bits (73), Expect = 9e-32
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 549 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 490

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| | |||| ||||||| |  ||||||||| |||||||||||||||||
Sbjct: 489 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctgatcttcttg 430

                      
Query: 290 agcctctcaag 300
           |||||||||||
Sbjct: 429 agcctctcaag 419



to top

>dbj|AK058881.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-B06, full
           insert sequence
          Length = 1013

 Score =  145 bits (73), Expect = 9e-32
 Identities = 116/131 (88%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 553 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 494

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| | |||| ||||||| |  ||||||||| |||||||||||||||||
Sbjct: 493 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctgatcttcttg 434

                      
Query: 290 agcctctcaag 300
           |||||||||||
Sbjct: 433 agcctctcaag 423



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                           
Query: 172     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3931978 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3931919

                                                                 
Query: 232     accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
               |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 3931918 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 3931869



 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                           
Query: 172     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3917582 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3917523

                                                                 
Query: 232     accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
               |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 3917522 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 3917473



 Score =  133 bits (67), Expect = 4e-28
 Identities = 98/109 (89%)
 Strand = Plus / Minus

                                                                           
Query: 172     ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
               ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 3906977 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 3906918

                                                                
Query: 232     accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
               ||| |||||||| |  ||| |||||||||| ||||||||| ||||||||
Sbjct: 3906917 accgcggacacggagaccccagtagtgacggagaccacggtggttcctg 3906869



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 277     cctgatcttcttgagcctctcaagg 301
               |||||||||||| ||||||||||||
Sbjct: 3930944 cctgatcttcttcagcctctcaagg 3930920



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 277     cctgatcttcttgagcctctcaagg 301
               |||||||||||| ||||||||||||
Sbjct: 3917055 cctgatcttcttcagcctctcaagg 3917031



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 277     cctgatcttcttgagcctctcaagg 301
               |||||||||||| ||||||||||||
Sbjct: 3905903 cctgatcttcttcagcctctcaagg 3905879



to top

>dbj|AP004670.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0496D04
          Length = 197358

 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                          
Query: 172    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 171090 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 171031

                                                                
Query: 232    accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
              |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 171030 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 170981



 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                          
Query: 172    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 156694 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 156635

                                                                
Query: 232    accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
              |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 156634 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 156585



 Score =  133 bits (67), Expect = 4e-28
 Identities = 98/109 (89%)
 Strand = Plus / Minus

                                                                          
Query: 172    ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
              ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 146089 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 146030

                                                               
Query: 232    accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
              ||| |||||||| |  ||| |||||||||| ||||||||| ||||||||
Sbjct: 146029 accgcggacacggagaccccagtagtgacggagaccacggtggttcctg 145981



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    cctgatcttcttgagcctctcaagg 301
              |||||||||||| ||||||||||||
Sbjct: 170056 cctgatcttcttcagcctctcaagg 170032



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    cctgatcttcttgagcctctcaagg 301
              |||||||||||| ||||||||||||
Sbjct: 156167 cctgatcttcttcagcctctcaagg 156143



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 277    cctgatcttcttgagcctctcaagg 301
              |||||||||||| ||||||||||||
Sbjct: 145015 cctgatcttcttcagcctctcaagg 144991



to top

>dbj|AP003843.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1656_E11
          Length = 116211

 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                         
Query: 172   ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
             ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 34704 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 34645

                                                               
Query: 232   accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
             |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 34644 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 34595



 Score =  143 bits (72), Expect = 4e-31
 Identities = 100/110 (90%)
 Strand = Plus / Minus

                                                                         
Query: 172   ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
             ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 20308 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 20249

                                                               
Query: 232   accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctga 281
             |||||||||||| |  ||| |||||||||| ||||||||| |||||||||
Sbjct: 20248 accacggacacggagaccccagtagtgacggagaccacggtggttcctga 20199



 Score =  133 bits (67), Expect = 4e-28
 Identities = 98/109 (89%)
 Strand = Plus / Minus

                                                                        
Query: 172  ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
            ||||| ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 9703 ttatctcttcttggagacaccgacagtctttcccctcctgccagtagtcttggtgtgctg 9644

                                                             
Query: 232  accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
            ||| |||||||| |  ||| |||||||||| ||||||||| ||||||||
Sbjct: 9643 accgcggacacggagaccccagtagtgacggagaccacggtggttcctg 9595



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 277   cctgatcttcttgagcctctcaagg 301
             |||||||||||| ||||||||||||
Sbjct: 33670 cctgatcttcttcagcctctcaagg 33646



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 277   cctgatcttcttgagcctctcaagg 301
             |||||||||||| ||||||||||||
Sbjct: 19781 cctgatcttcttcagcctctcaagg 19757



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 277  cctgatcttcttgagcctctcaagg 301
            |||||||||||| ||||||||||||
Sbjct: 8629 cctgatcttcttcagcctctcaagg 8605



to top

>gb|AY496116.1| Capsicum annuum putative ribosomal protein mRNA, complete cds
          Length = 771

 Score =  125 bits (63), Expect = 9e-26
 Identities = 103/117 (88%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           ||||| ||||||||||||||||||||||||||| || | ||| || ||||| ||||||||
Sbjct: 555 ttatctcttcttggagacaccaacagtctttcccctgcggccagtggtctttgtgtgctg 496

                                                                    
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttctt 288
           |||||||||||| | |||| |||||||||| | ||||||  ||||||||||||||||
Sbjct: 495 accacggacacggaggccccagtagtgacgcaaaccacgatggttcctgatcttctt 439



to top

>gb|AF400215.1| Spodoptera frugiperda ribosomal protein S18 mRNA, complete cds
          Length = 604

 Score =  113 bits (57), Expect = 3e-22
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           |||||| || |||||||||||  |||||||||||||||||||||||||||||||||||||
Sbjct: 553 cttcttagatacaccaacagttcttcctctcctgccggtagtcttggtgtgctgaccacg 494

                                   
Query: 238 gacacgcacgcccnagtagtgacg 261
            ||||||| |||| ||||||||||
Sbjct: 493 cacacgcaggccccagtagtgacg 470



to top

>gb|AC092076.7| Oryza sativa chromosome 3 BAC OSJNBb0021G19 genomic sequence, complete
              sequence
          Length = 141582

 Score =  105 bits (53), Expect = 8e-20
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                          
Query: 170    gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
              ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 137481 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 137422

                                                                 
Query: 230    tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
              || ||||| ||||| | |||| ||||||| |  ||||||||| ||||||||
Sbjct: 137421 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctg 137371



 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 277    cctgatcttcttgagcctctcaag 300
              ||||||||||||||||||||||||
Sbjct: 136709 cctgatcttcttgagcctctcaag 136686



to top

>gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 genomic sequence,
            complete sequence
          Length = 162497

 Score =  105 bits (53), Expect = 8e-20
 Identities = 96/111 (86%)
 Strand = Plus / Minus

                                                                        
Query: 170  gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
            ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 1847 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 1788

                                                               
Query: 230  tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
            || ||||| ||||| | |||| ||||||| |  ||||||||| ||||||||
Sbjct: 1787 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctg 1737



 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 277  cctgatcttcttgagcctctcaag 300
            ||||||||||||||||||||||||
Sbjct: 1075 cctgatcttcttgagcctctcaag 1052



to top

>gb|BT013131.1| Lycopersicon esculentum clone 114423F, mRNA sequence
          Length = 778

 Score =  105 bits (53), Expect = 8e-20
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           ||||| ||||||||||||||||||||||||||| || |  || || ||||| ||||||||
Sbjct: 536 ttatctcttcttggagacaccaacagtctttcccctgcgaccagtggtctttgtgtgctg 477

                                                                       
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
           ||| || ||||| | |||| |||||||||| | ||||||| | |||||||||||||| ||
Sbjct: 476 accgcgaacacggaggccccagtagtgacgcaaaccacggtgattcctgatcttcttcag 417

              
Query: 292 cct 294
           |||
Sbjct: 416 cct 414



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  105 bits (53), Expect = 8e-20
 Identities = 96/111 (86%)
 Strand = Plus / Plus

                                                                            
Query: 170      gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
                ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 32742060 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32742119

                                                                   
Query: 230      tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
                || ||||| ||||| | |||| ||||||| |  ||||||||| ||||||||
Sbjct: 32742120 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctg 32742170



 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 277      cctgatcttcttgagcctctcaag 300
                ||||||||||||||||||||||||
Sbjct: 32742832 cctgatcttcttgagcctctcaag 32742855



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  105 bits (53), Expect = 8e-20
 Identities = 96/111 (86%)
 Strand = Plus / Plus

                                                                            
Query: 170      gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
                ||||||||||||||||| ||||| |||||||| || ||||| ||||| ||||||||||||
Sbjct: 32832570 gcttatcgcttcttggacacaccgacagtcttacccctccttccggttgtcttggtgtgc 32832629

                                                                   
Query: 230      tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
                || ||||| ||||| | |||| ||||||| |  ||||||||| ||||||||
Sbjct: 32832630 tgcccacgcacacggaggccccagtagtgcctcagaccacggtggttcctg 32832680



 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 277      cctgatcttcttgagcctctcaag 300
                ||||||||||||||||||||||||
Sbjct: 32833342 cctgatcttcttgagcctctcaag 32833365



to top

>ref|XM_360287.1| Magnaporthe grisea 70-15 hypothetical protein (MG05661.4) partial
           mRNA
          Length = 471

 Score =  101 bits (51), Expect = 1e-18
 Identities = 83/94 (88%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| ||||| || |||  |||||||| |||||| ||||||||||||||||||||
Sbjct: 459 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 400

                                             
Query: 238 gacacgcacgcccnagtagtgacgaagaccacgg 271
           |||||| | |||| |||||||||| |||||||||
Sbjct: 399 gacacggaggccccagtagtgacggagaccacgg 366



to top

>gb|AY849628.1| Magnaporthe grisea 40S ribosomal protein S18-like protein mRNA,
           complete cds
          Length = 713

 Score =  101 bits (51), Expect = 1e-18
 Identities = 83/94 (88%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| ||||| || |||  |||||||| |||||| ||||||||||||||||||||
Sbjct: 510 cttcttggacacaccgacggtccgtcctctccggccggtcgtcttggtgtgctgaccacg 451

                                             
Query: 238 gacacgcacgcccnagtagtgacgaagaccacgg 271
           |||||| | |||| |||||||||| |||||||||
Sbjct: 450 gacacggaggccccagtagtgacggagaccacgg 417



to top

>dbj|AB180432.1| Plutella xylostella mRNA for Ribosomal protein S18, complete cds
          Length = 483

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 75/84 (89%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| |||||||||||| | |||||||||||||| ||||||||||||||||| ||
Sbjct: 475 cttcttggacacaccaacagtcctgcctctcctgccggtggtcttggtgtgctgaccgcg 416

                                   
Query: 238 gacacgcacgcccnagtagtgacg 261
            || |||| |||| ||||||||||
Sbjct: 415 cacgcgcaggccccagtagtgacg 392



to top

>ref|XM_789831.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S18 (LOC590220), mRNA
          Length = 563

 Score = 95.6 bits (48), Expect = 8e-17
 Identities = 97/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| || | 
Sbjct: 525 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctgtcccct 466

                                                                 
Query: 238 gacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
            |||||||  ||| |||| || || ||||||||| |   |||||||||||||||
Sbjct: 465 cacacgcagaccccagtaatgtcggagaccacggtgagccctgatcttcttgag 412



to top

>gb|DQ200372.1| Solanum tuberosum clone 058H04 unknown mRNA
          Length = 690

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           |||||||||||||||||||||||||||||||||||  |  || || ||||| || |||||
Sbjct: 512 ttatcgcttcttggagacaccaacagtctttcctcggcgaccagtggtcttagtatgctg 453

                                                                    
Query: 232 accacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttctt 288
           |||||| ||||| |  ||| |||||||||| | ||||||  | ||||||||||||||
Sbjct: 452 accacgcacacgaagaccccagtagtgacgtaaaccacgatgattcctgatcttctt 396



to top

>ref|XM_778977.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S18 (LOC578831), mRNA
          Length = 516

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 96/114 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| || | 
Sbjct: 477 cttcttggacacaccaacagtccttcctctcctgccagtagtcttggtgtgctgtcccct 418

                                                                 
Query: 238 gacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
            |||||||  ||| |||| || |  ||||||||| |   |||||||||||||||
Sbjct: 417 cacacgcagaccccagtaatgcctgagaccacggtgagccctgatcttcttgag 364



to top

>gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete sequence
          Length = 131213

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 78/90 (86%)
 Strand = Plus / Plus

                                                                         
Query: 169   agcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
             |||||| |||||||| || |||||||| ||||||||||| | ||| ||||||||||| ||
Sbjct: 66762 agcttaacgcttctttgacacaccaactgtctttcctctgcggccagtagtcttggtatg 66821

                                           
Query: 229   ctgaccacggacacgcacgcccnagtagtg 258
             ||||||||| ||||| | |||| |||||||
Sbjct: 66822 ctgaccacgaacacgaaggccccagtagtg 66851



 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                         
Query: 170   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
             ||||| |||||||| ||||||||||| |||||||| || | ||| ||||||||||| |||
Sbjct: 93987 gcttaacgcttctttgagacaccaacggtctttcccctgcggcctgtagtcttggtatgc 94046

                                          
Query: 230   tgaccacggacacgcacgcccnagtagtg 258
             |||||||| ||||| | |||| |||||||
Sbjct: 94047 tgaccacgaacacgaaggccccagtagtg 94075



to top

>emb|AM048974.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein S18e (rpS18e
           gene)
          Length = 459

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||| |||||||||||  ||||||| |||||||||||||||||||| ||||||||
Sbjct: 453 cttcttggacacaccaacagttcttcctcttctgccggtagtcttggtgtgttgaccacg 394

                                   
Query: 238 gacacgcacgcccnagtagtgacg 261
            || | || |||| | ||||||||
Sbjct: 393 taccctcaagccccaatagtgacg 370



to top

>ref|NM_117048.2| Arabidopsis thaliana RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding /
           structural constituent of ribosome AT4G09800 (RPS18C)
           mRNA, complete cds
          Length = 748

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgct 230
           |||| |||||||| ||||||||||||||||||||||| |  || |||||||||||||| |
Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgtt 504

                                                                       
Query: 231 gaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttga 290
           | || | |||||| |  ||| |||| || |  | ||||||| |||| |||||||||||||
Sbjct: 503 gtcctctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttga 444

            
Query: 291 g 291
           |
Sbjct: 443 g 443



to top

>ref|NM_102125.2| Arabidopsis thaliana PFL (POINTED FIRST LEAVES); RNA binding /
           structural constituent of ribosome AT1G22780 (PFL) mRNA,
           complete cds
          Length = 752

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 521 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 462

                
Query: 296 tcaag 300
           |||||
Sbjct: 461 tcaag 457



to top

>gb|BT020298.1| Arabidopsis thaliana At1g22780 gene, complete cds
          Length = 474

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 470 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 411

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 410 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 351

                
Query: 296 tcaag 300
           |||||
Sbjct: 350 tcaag 346



to top

>gb|AY769334.1| Bombyx mori ribosomal protein S18 (RpS18) mRNA, complete cds
          Length = 578

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           |||||| || |||||||||||  ||||||||||||| |||||||| ||||||||||||||
Sbjct: 525 cttctttgatacaccaacagttcttcctctcctgccagtagtcttagtgtgctgaccacg 466

                             
Query: 238 gacacgcacgcccnagta 255
            ||||| | |||| ||||
Sbjct: 465 cacacgaaggccccagta 448



to top

>gb|BT025610.1| Arabidopsis thaliana At1g22780 mRNA, complete cds
          Length = 459

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 455 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 396

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 395 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 336

                
Query: 296 tcaag 300
           |||||
Sbjct: 335 tcaag 331



to top

>gb|AY064680.1| Arabidopsis thaliana S18.A ribosomal protein (At4g09800; F17A8.150)
           mRNA, complete cds
          Length = 478

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgct 230
           |||| |||||||| ||||||||||||||||||||||| |  || |||||||||||||| |
Sbjct: 460 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgtt 401

                                                                       
Query: 231 gaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttga 290
           | || | |||||| |  ||| |||| || |  | ||||||| |||| |||||||||||||
Sbjct: 400 gtcctctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttga 341

            
Query: 291 g 291
           |
Sbjct: 340 g 340



to top

>gb|AF411781.1|AF411781 Arabidopsis thaliana At1g22780/T22J18_5 mRNA, complete cds
          Length = 632

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 514 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 455

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 454 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 395

                
Query: 296 tcaag 300
           |||||
Sbjct: 394 tcaag 390



to top

>gb|AF386941.1|AF386941 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA,
           complete cds
          Length = 738

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgct 230
           |||| |||||||| ||||||||||||||||||||||| |  || |||||||||||||| |
Sbjct: 553 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgtt 494

                                                                       
Query: 231 gaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttga 290
           | || | |||||| |  ||| |||| || |  | ||||||| |||| |||||||||||||
Sbjct: 493 gtcctctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttga 434

            
Query: 291 g 291
           |
Sbjct: 433 g 433



to top

>gb|AF370463.1|AF370463 Arabidopsis thaliana S18.A ribosomal protein (F17A8.150) mRNA,
           complete cds
          Length = 687

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgct 230
           |||| |||||||| ||||||||||||||||||||||| |  || |||||||||||||| |
Sbjct: 548 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgtt 489

                                                                       
Query: 231 gaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttga 290
           | || | |||||| |  ||| |||| || |  | ||||||| |||| |||||||||||||
Sbjct: 488 gtcctctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttga 429

            
Query: 291 g 291
           |
Sbjct: 428 g 428



to top

>emb|BX813906.1|CNS0ACAK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB47ZA11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 674

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 515 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 456

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 455 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 396

                
Query: 296 tcaag 300
           |||||
Sbjct: 395 tcaag 391



to top

>gb|AY087428.1| Arabidopsis thaliana clone 35333 mRNA, complete sequence
          Length = 709

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 581 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 522

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 521 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 462

                
Query: 296 tcaag 300
           |||||
Sbjct: 461 tcaag 457



to top

>gb|AY086334.1| Arabidopsis thaliana clone 24071 mRNA, complete sequence
          Length = 712

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgct 230
           |||| |||||||| ||||||||||||||||||||||| |  || |||||||||||||| |
Sbjct: 563 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgtt 504

                                                                       
Query: 231 gaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttga 290
           | || | |||||| |  ||| |||| || |  | ||||||| |||| |||||||||||||
Sbjct: 503 gtcctctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttga 444

            
Query: 291 g 291
           |
Sbjct: 443 g 443



to top

>emb|Z28701.1|ATS18RP1 A.thaliana (C24) mRNA for S18 ribosomal protein
          Length = 683

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 526 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 467

                                                                       
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctc 295
           || ||||| |  ||| ||||||| |  ||||||||  |||| |||||||||||||| | |
Sbjct: 466 cgtacacggagaccccagtagtgcctcagaccacgatggtttctgatcttcttgagacgc 407

                
Query: 296 tcaag 300
           |||||
Sbjct: 406 tcaag 402



to top

>ref|XM_746138.1| Aspergillus fumigatus Af293 ribosomal protein S13p/S18e
           (Afu6g13550) partial mRNA
          Length = 384

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 215 gtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||||||||||||||||||||||||||| |  ||| |||||||||| |||||||||
Sbjct: 338 gtagtcttggtgtgctgaccacggacacggagaccccagtagtgacgcagaccacgg 282



to top

>gb|BT006539.1| Arabidopsis thaliana At4g09800 gene, complete cds
          Length = 459

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
           |||||||| ||||||||||||||||||||||| |  || |||||||||||||| || || 
Sbjct: 455 cgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtgttgtcct 396

                                                                   
Query: 236 cggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgag 291
           | |||||| |  ||| |||| || |  | ||||||| |||| ||||||||||||||
Sbjct: 395 ctgacacggagaccccagtaatgcctcaaaccacggtggtttctgatcttcttgag 340



to top

>gb|AY440501.1| Armigeres subalbatus ASAP ID: 41411 cytosolic small ribosomal
           subunit S18 mRNA sequence
          Length = 578

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| ||||||||||||||||| || ||||||| |||| |||||||||| |||||||||
Sbjct: 455 ccggtggtcttggtgtgctgaccgcgcacacgcaggccccagtagtgacgcagaccacgg 396



to top

>ref|XM_657953.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5441.2), mRNA
          Length = 468

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||||||||| |||||||||||||||||||| |  ||| |||||||||| |||||||||
Sbjct: 425 ccggtagtcttcgtgtgctgaccacggacacggagaccccagtagtgacggagaccacgg 366



to top

>gb|AY099517.1| Danio rerio 40S ribosomal protein S18 (rps18) mRNA, complete cds
          Length = 543

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
           ||||||||||||||||| |||||||  ||| || ||||||| ||||||||| |   ||||
Sbjct: 440 ttggtgtgctgaccacgcacacgcagaccccagaagtgacggagaccacggtgagccctg 381

                            
Query: 281 atcttcttgagcctctc 297
           |||||||| ||||||||
Sbjct: 380 atcttcttcagcctctc 364



to top

>ref|NM_173234.1| Danio rerio ribosomal protein S18 (rps18), mRNA
          Length = 543

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
           ||||||||||||||||| |||||||  ||| || ||||||| ||||||||| |   ||||
Sbjct: 440 ttggtgtgctgaccacgcacacgcagaccccagaagtgacggagaccacggtgagccctg 381

                            
Query: 281 atcttcttgagcctctc 297
           |||||||| ||||||||
Sbjct: 380 atcttcttcagcctctc 364



to top

>gb|AF210641.1|AF210641 Danio rerio Ke3 mRNA, partial cds
          Length = 380

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
           ||||||||||||||||| |||||||  ||| || ||||||| ||||||||| |   ||||
Sbjct: 345 ttggtgtgctgaccacgcacacgcagaccccagaagtgacggagaccacggtgagccctg 286

                            
Query: 281 atcttcttgagcctctc 297
           |||||||| ||||||||
Sbjct: 285 atcttcttcagcctctc 269



to top

>gb|BC062289.1| Danio rerio ribosomal protein S18, mRNA (cDNA clone MGC:77944
           IMAGE:7000924), complete cds
          Length = 520

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 ttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctg 280
           ||||||||||||||||| |||||||  ||| || ||||||| ||||||||| |   ||||
Sbjct: 421 ttggtgtgctgaccacgcacacgcagaccccagaagtgacggagaccacggtgagccctg 362

                            
Query: 281 atcttcttgagcctctc 297
           |||||||| ||||||||
Sbjct: 361 atcttcttcagcctctc 345



to top

>emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 28
          Length = 198005

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
           |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 187 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 130



to top

>emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 27
          Length = 197394

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                        
Query: 171    cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
              |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 192581 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 192524



to top

>emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BAC clone  F17A8 (ESSA project)
          Length = 128071

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                       
Query: 171   cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
             |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 73280 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 73223



to top

>emb|Z28962.1|ATS18RP3 A.thaliana (Columbia) gene for S18 ribosomal protein (1471bp)
          Length = 1471

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 171  cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
            |||| |||||||| ||||||||||||||||||||||| |  || ||||||||||||||
Sbjct: 1397 cttaacgcttctttgagacaccaacagtctttcctctgcgaccagtagtcttggtgtg 1340



to top

>ref|NM_103125.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT1G34030 mRNA, complete cds
          Length = 754

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 486 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 427

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 426 agacgctcaag 416



to top

>ref|XM_387069.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06893.1)
           partial mRNA
          Length = 540

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||||||||||||||| |  ||| ||||||| || |||||||||
Sbjct: 494 ccggtggtcttggtgtgctgaccacggacacggagaccccagtagtgtcggagaccacgg 435



to top

>gb|AY232075.1| Drosophila yakuba clone yak-ad_RpS18 mRNA sequence
          Length = 456

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagtagtgacgcagaccacgg 360



to top

>gb|AY231741.1| Drosophila yakuba clone yak-em_RpS18 mRNA sequence
          Length = 456

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 419 ccggtggtcttggtgtgctggccacgaacacggaggccccagtagtgacgcagaccacgg 360



to top

>gb|AY070029.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030)
           mRNA, complete cds
          Length = 490

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 461 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 402

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 401 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 342

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 341 agacgctcaag 331



to top

>gb|AY034965.1| Arabidopsis thaliana putative ribosomal protein S18 (At1g34030)
           mRNA, complete cds
          Length = 759

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 545 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 486

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 485 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 426

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 425 agacgctcaag 415



to top

>gb|BT024929.1| Drosophila melanogaster IP16603 full insert cDNA
          Length = 1034

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 451 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 392



to top

>gb|AY118434.1| Drosophila melanogaster RH43343 full insert cDNA
          Length = 617

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 475 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 416



to top

>dbj|AB226103.1| Aspergillus oryzae cDNA, contig sequence: AoEST2960
          Length = 720

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||||||||| |  ||| |||||||||| |||||||||
Sbjct: 469 ccggtggtcttggtgtgctgtccacggacacggagaccccagtagtgacggagaccacgg 410



to top

>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103
          Length = 1282697

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                          
Query: 212    ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
              ||||| |||||||||||||| ||||||||||| |  ||| |||||||||| |||||||||
Sbjct: 854331 ccggtggtcttggtgtgctgtccacggacacggagaccccagtagtgacggagaccacgg 854272



to top

>ref|NM_166383.1| Drosophila melanogaster Ribosomal protein S18 CG8900-RB, transcript
           variant B (RpS18), mRNA
          Length = 648

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 476 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 417



to top

>ref|NM_057616.3| Drosophila melanogaster Ribosomal protein S18 CG8900-RA, transcript
           variant A (RpS18), mRNA
          Length = 631

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 459 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 400



to top

>gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56X-57A, BAC clone
             BACR48L22, complete sequence
          Length = 180814

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                         
Query: 212   ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
             ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 81201 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 81260



to top

>gb|DQ066248.1| Ixodes scapularis isolate ISN-L-49 ribosomal protein S18 mRNA,
           partial cds
          Length = 459

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                       
Query: 179 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacgg 238
           |||||||| ||||| |||||| |||| |||||||| || |||||||||||||| || |  
Sbjct: 452 ttcttggacacaccgacagtccttcccctcctgccagtggtcttggtgtgctgtcccctc 393

                                                                       
Query: 239 acacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttgagcctctca 298
           ||||||| |||| || |||| |  ||||||||| ||   | ||||||||| |||| ||||
Sbjct: 392 acacgcaggccccagaagtgtctgagaccacggtgggcacggatcttcttcagccgctca 333

              
Query: 299 agg 301
           |||
Sbjct: 332 agg 330



to top

>emb|BX816977.1|CNS0ADD2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 685

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 530 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 471

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 470 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 411

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 410 agacgctcaag 400



to top

>dbj|AB162351.1| Drosophila sechellia genes, CG11099 to CG8914 region, complete cds
          Length = 63744

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 212   ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
             ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 29451 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 29392



to top

>dbj|AB162349.1| Drosophila simulans genes, CG11099 to CG8900 region, complete cds
          Length = 35291

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 212   ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
             ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 29663 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 29604



to top

>gb|AY086800.1| Arabidopsis thaliana clone 27800 mRNA, complete sequence
          Length = 693

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 546 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 487

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 486 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 427

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 426 agacgctcaag 416



to top

>emb|Z28702.1|ATS18RP2 A.thaliana (Columbia) mRNA for S18 ribosomal protein (641bp)
          Length = 647

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 170 gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
           ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 494 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 435

                                                                       
Query: 230 tgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttcctgatcttcttg 289
           || ||||| ||||| |  ||| |||| || |  ||||||||  |||| ||||| ||||||
Sbjct: 434 tgtccacgaacacggagaccccagtaatgtctcagaccacgatggtttctgattttcttg 375

                      
Query: 290 agcctctcaag 300
           || | ||||||
Sbjct: 374 agacgctcaag 364



to top

>gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58 of 73 of the
            complete sequence
          Length = 256764

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 212  ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
            ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 7309 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 7250



to top

>gb|AC004321.1|AC004321 Drosophila melanogaster DNA sequence (P1 DS08872 (D215)), complete
             sequence
          Length = 34918

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                         
Query: 212   ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
             ||||| |||||||||||||| ||||| ||||| | |||| |||||||||| |||||||||
Sbjct: 14544 ccggtggtcttggtgtgctggccacgcacacggaggccccagtagtgacgcagaccacgg 14603



to top

>gb|L22959.1|DRORPS18A Drosophila melanogaster ribosomal protein S18 mRNA, complete cds
          Length = 567

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacgg 271
           ||||| |||||||||||||||||||| ||||| | |||| |||||||||| || ||||||
Sbjct: 419 ccggtggtcttggtgtgctgaccacgcacacggaggccccagtagtgacgcagcccacgg 360



to top

>gb|AC079286.2|AC079286 Arabidopsis thaliana chromosome 1 BAC T15K4 genomic sequence, complete
             sequence
          Length = 33513

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                         
Query: 170   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
             ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 24671 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 24730

                           
Query: 230   tgaccacggacacg 243
             || ||||| |||||
Sbjct: 24731 tgtccacgaacacg 24744



to top

>gb|AC015446.4|AC015446 Arabidopsis thaliana chromosome I BAC F12G12 genomic sequence, complete
             sequence
          Length = 125632

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                         
Query: 170   gcttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgc 229
             ||||| |||||||| || |||||||||||||||||||| |  || || ||||||||||| 
Sbjct: 87090 gcttaacgcttcttagacacaccaacagtctttcctctgcgaccagttgtcttggtgtgt 87031

                           
Query: 230   tgaccacggacacg 243
             || ||||| |||||
Sbjct: 87030 tgtccacgaacacg 87017



to top

>gb|AY190738.1| Pagrus major 40S ribosomal protein S18 mRNA, partial cds
          Length = 477

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| ||||||||||||||||| || |||||||  ||| || |||| |  ||||||||
Sbjct: 385 gccggtggtcttggtgtgctgaccgcgcacacgcagaccccagaagtgcctgagaccacg 326

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | |   |||||||||||| ||||||||
Sbjct: 325 gtgagccctgatcttcttcagcctctc 299



to top

>ref|XM_322560.1| Neurospora crassa OR74A hypothetical protein (NCU00475.1) partial
           mRNA
          Length = 618

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 gtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttc 277
           ||||||||||||||||| || ||||| | |||| |||||||||| ||||| ||| ||   
Sbjct: 566 gtcttggtgtgctgaccgcgaacacggaggccccagtagtgacggagaccgcggtgggcg 507

                                  
Query: 278 ctgatcttcttgagcctctcaag 300
           | |||||||||||| | ||||||
Sbjct: 506 cggatcttcttgaggcgctcaag 484



to top

>ref|XM_951701.1| Neurospora crassa OR74A hypothetical protein (NCU00475.1) partial
           mRNA
          Length = 618

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 gtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttc 277
           ||||||||||||||||| || ||||| | |||| |||||||||| ||||| ||| ||   
Sbjct: 566 gtcttggtgtgctgaccgcgaacacggaggccccagtagtgacggagaccgcggtgggcg 507

                                  
Query: 278 ctgatcttcttgagcctctcaag 300
           | |||||||||||| | ||||||
Sbjct: 506 cggatcttcttgaggcgctcaag 484



to top

>gb|AF548335.1| Branchiostoma belcheri ribosomal protein S18 mRNA, complete cds
          Length = 558

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||| |||||||||||||| ||||| ||||||| |||| |||||||
Sbjct: 454 gccggtggtcttggtgtgctgtccacgcacacgcaggccccagtagtg 407



to top

>gb|AY342352.1| Ixodes ricinus ribosomal protein S18 mRNA, partial cds
          Length = 456

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 179 ttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctg 231
           |||||||| ||||| |||||| |||| ||||| ||||| ||||||||||||||
Sbjct: 452 ttcttggacacaccgacagtccttcccctccttccggtggtcttggtgtgctg 400



to top

>dbj|AB182248.1| Antheraea yamamai Antheraea S18 gene mRNA for ribosomal protein
           S18, complete cds
          Length = 541

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           |||||||||||||||||||||  | ||||| ||||| || ||||| ||||| ||||| ||
Sbjct: 491 cttcttggagacaccaacagttctacctcttctgcctgtggtcttagtgtgttgaccgcg 432

                                   
Query: 238 gacacgcacgcccnagtagtgacg 261
            ||||| |  ||| ||||||||||
Sbjct: 431 aacacgaagaccccagtagtgacg 408



to top

>ref|XM_752114.1| Ustilago maydis 521 hypothetical protein (UM01060.1) partial mRNA
          Length = 465

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                       
Query: 218 gtcttggtgtgctgaccacggacacgca 245
           ||||||||||||||||||||||||||||
Sbjct: 422 gtcttggtgtgctgaccacggacacgca 395



to top

>emb|BX072327.1|CNS09RYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 721

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 346



to top

>emb|BX072326.1|CNS09RYY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 484 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 438



to top

>emb|BX072311.1|CNS09RYJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 658

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 287 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 333



to top

>emb|BX072310.1|CNS09RYI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 456



to top

>emb|BX072288.1|CNS09RXW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 309 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 355



to top

>emb|BX072287.1|CNS09RXV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 456



to top

>emb|BX069062.1|CNS09PGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 485 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 439



to top

>emb|BX063554.1|CNS09L7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 443



to top

>emb|BX049522.1|CNS09ADI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 499 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 453



to top

>emb|BX048448.1|CNS099JO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 280 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 326



to top

>emb|BX048447.1|CNS099JN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 478 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 432



to top

>emb|BX043249.1|CNS095J9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 447



to top

>emb|BX042743.1|CNS09557 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 269 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 315



to top

>emb|BX042742.1|CNS09556 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 487 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 441



to top

>emb|BX038898.1|CNS0926E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 350



to top

>emb|BX038897.1|CNS0926D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 458



to top

>emb|BX038809.1|CNS0923X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 300 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 346



to top

>emb|BX038808.1|CNS0923W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 503 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 457



to top

>emb|BX038794.1|CNS0923I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 301 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 347



to top

>emb|BX038793.1|CNS0923H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 456



to top

>emb|BX038685.1|CNS0920H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 304 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 350



to top

>emb|BX038684.1|CNS0920G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 442 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 396



to top

>emb|BX038638.1|CNS091Z6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 298 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 344



to top

>emb|BX038637.1|CNS091Z5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 458



to top

>emb|BX038386.1|CNS091S6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 71  ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 117



to top

>emb|BX038260.1|CNS091OO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 720

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 500 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 454



to top

>emb|BX037628.1|CNS09174 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 502 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 456



to top

>emb|BX037394.1|CNS0910M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 491 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 445



to top

>emb|BX036909.1|CNS090N5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 483 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 437



to top

>emb|BX034354.1|CNS08YO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcaaaccccagtagtg 452



to top

>emb|BX034173.1|CNS08YJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 303



to top

>emb|BX033670.1|CNS08Y56 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 266 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 312



to top

>emb|BX033669.1|CNS08Y55 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 493 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 447



to top

>emb|BX033110.1|CNS08XPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 441 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 395



to top

>emb|BX032956.1|CNS08XLC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 462

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 267 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 313



to top

>emb|BX032189.1|CNS08X01 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 464 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 418



to top

>emb|BX030688.1|CNS08VUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 477 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 431



to top

>emb|BX027156.1|CNS08T48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 489 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 443



to top

>emb|BX026624.1|CNS08SPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 246 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 292



to top

>emb|BX026623.1|CNS08SPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 467 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 421



to top

>emb|BX023324.1|CNS08Q5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 288 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 334



to top

>emb|BX023323.1|CNS08Q5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 452



to top

>emb|BX022521.1|CNS08PJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 388 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 342



to top

>emb|BX021989.1|CNS08P4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 262 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 308



to top

>emb|BX021988.1|CNS08P4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 524 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 478



to top

>emb|BX021615.1|CNS08OUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 456 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 410



to top

>emb|BX020788.1|CNS08O7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 270 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 316



to top

>emb|BX020787.1|CNS08O7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 407

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 82  ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 36



to top

>emb|BX016687.1|CNS08L1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 480 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 434



to top

>emb|BX009941.1|CNS08FU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 257 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 303



to top

>emb|BX009940.1|CNS08FU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 475 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 429



to top

>emb|BX009869.1|CNS08FS1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 498 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 452



to top

>emb|Y12227.1|ATY12227 Arabidopsis thaliana DNA, 24 kb surrounding PFL locus
          Length = 24053

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                         
Query: 176   cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
             ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 22237 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 22178

                     
Query: 236   cggacacg 243
             || |||||
Sbjct: 22177 cgtacacg 22170



to top

>gb|AF526232.1| Argopecten irradians isolate iolsaicl552ct593cn617 ribosomal
           protein S18 mRNA, complete cds
          Length = 532

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           ||||||||  |||||||||||  ||||||||||||| || ||||| |||||||| |||||
Sbjct: 481 cttcttggccacaccaacagttcttcctctcctgccagttgtctttgtgtgctgtccacg 422



to top

>gb|AC003979.2|T22J18 Arabidopsis thaliana chromosome 1 BAC T22J18 sequence, complete
             sequence
          Length = 84162

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                         
Query: 176   cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
             ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 10133 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 10192

                     
Query: 236   cggacacg 243
             || |||||
Sbjct: 10193 cgtacacg 10200



to top

>gb|AF283268.1|AF283268 Anopheles gambiae strain G3 ribosomal protein S18 (IrpS18) mRNA,
           partial cds
          Length = 379

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 101 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 55



to top

>emb|Z23165.1|ATRBPS18A A.thaliana ribosomal protein gene S18, complete CDS
          Length = 2848

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 176  cgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgacca 235
            ||||||||||| ||||||||||||||||| |  |  ||||| || ||||||||||| |||
Sbjct: 2355 cgcttcttggaaacaccaacagtctttccacggcgtccggtggttttggtgtgctgtcca 2296

                    
Query: 236  cggacacg 243
            || |||||
Sbjct: 2295 cgtacacg 2288



to top

>ref|XM_311570.2| Anopheles gambiae str. PEST ENSANGP00000022445
           (ENSANGG00000020271), partial mRNA
          Length = 459

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 212 ccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 419 ccggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 373



to top

>emb|AJ843092.1| Platichthys flesus mRNA for 40S ribosomal protein S18 (rps18 gene)
          Length = 530

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 211 gccggtagtcttggtgtgctgaccacggacacgca 245
           |||||| |||||||||||||||||||| |||||||
Sbjct: 445 gccggtggtcttggtgtgctgaccacgcacacgca 411



to top

>gb|DQ413212.1| Acyrthosiphon pisum isolate WHAP0121 putative ribosomal protein S18
           mRNA, complete cds
          Length = 459

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 77/94 (81%)
 Strand = Plus / Minus

                                                                       
Query: 178 cttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtgctgaccacg 237
           |||||| || |||||||||||  ||||||| |  |||||||| ||||| |||||||||||
Sbjct: 453 cttcttagatacaccaacagttcttcctctacgtccggtagttttggtatgctgaccacg 394

                                             
Query: 238 gacacgcacgcccnagtagtgacgaagaccacgg 271
            || | ||  ||| |||| ||||| |||||||||
Sbjct: 393 tactctcaaaccccagtaatgacggagaccacgg 360



to top

>emb|CR699685.2|CNS0G2TT Tetraodon nigroviridis full-length cDNA
          Length = 521

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 218 gtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttc 277
           |||||||||||||| ||||| || |||| |||| || |||| || || |||||| ||  |
Sbjct: 433 gtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccacggtgggcc 374

                               
Query: 278 ctgatcttcttgagcctctc 297
           | ||||||||| ||||||||
Sbjct: 373 cggatcttcttcagcctctc 354



to top

>emb|CR697045.2|CNS0G0SH Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 218 gtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacggnggttc 277
           |||||||||||||| ||||| || |||| |||| || |||| || || |||||| ||  |
Sbjct: 438 gtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccacggtgggcc 379

                               
Query: 278 ctgatcttcttgagcctctc 297
           | ||||||||| ||||||||
Sbjct: 378 cggatcttcttcagcctctc 359



to top

>emb|BX063555.1|CNS09L7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 272 ccggtagttttcgtgtgctgaccacggacacgca 305



to top

>emb|BX050031.1|CNS09ARN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 214 ggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtg 258
           |||||| || ||||||||||||||||||||||  ||| |||||||
Sbjct: 466 ggtagttttcgtgtgctgaccacggacacgcagaccccagtagtg 422



to top

>emb|BX037931.1|CNS091FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 313 ccggtagttttcgtgtgctgaccacggacacgca 346



to top

>emb|BX037930.1|CNS091FI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 504 ccggtagttttcgtgtgctgaccacggacacgca 471



to top

>emb|BX037395.1|CNS0910N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 273 ccggtagttttcgtgtgctgaccacggacacgca 306



to top

>emb|BX032190.1|CNS08X02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 786

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 256 ccggtagttttcgtgtgctgaccacggacacgca 289



to top

>emb|BX009870.1|CNS08FS2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 487

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 212 ccggtagtcttggtgtgctgaccacggacacgca 245
           |||||||| || ||||||||||||||||||||||
Sbjct: 279 ccggtagttttcgtgtgctgaccacggacacgca 312



to top

>emb|BX826567.1|CNS0A3AT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 646

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 171 cttatcgcttcttggagacaccaacagtctttcctctcctgccggtagtcttggtgtg 228
           |||| |||||||  || |||||||||||||||||||| |  || ||||||||||||||
Sbjct: 544 cttaacgcttctctgacacaccaacagtctttcctctgcgaccagtagtcttggtgtg 487



to top

>emb|CR734341.2|CNS0GTEC Tetraodon nigroviridis full-length cDNA
          Length = 520

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 439 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 380

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 379 gtgggcccggatcttcttcagcctctc 353



to top

>emb|CR674974.2|CNS0FJS4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR734533.2|CNS0GTJO Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR733895.2|CNS0GT1Y Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR733804.2|CNS0GSZF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR720262.2|CNS0GIP8 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR722880.2|CNS0GKPY Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR722776.2|CNS0GKN2 Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 419 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 360

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 359 gtgggcccggatcttcttcagcctctc 333



to top

>emb|CR722174.2|CNS0GK6C Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR721952.2|CNS0GK06 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR720455.2|CNS0GIUL Tetraodon nigroviridis full-length cDNA
          Length = 444

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 363 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 304

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 303 gtgggcccggatcttcttcagcctctc 277



to top

>emb|CR704786.2|CNS0G6RI Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR703781.2|CNS0G5ZL Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR703599.2|CNS0G5UJ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR703505.2|CNS0G5RX Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR703433.2|CNS0G5PX Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR702036.2|CNS0G4N4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR702025.2|CNS0G4MT Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR702003.2|CNS0G4M7 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR701412.2|CNS0G45S Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR701350.2|CNS0G442 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR701061.2|CNS0G3W1 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR699796.2|CNS0G2WW Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR699943.2|CNS0G30Z Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR699936.2|CNS0G30S Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR699450.2|CNS0G2NA Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR691285.2|CNS0FWCH Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR698404.2|CNS0G1U8 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR697912.2|CNS0G1GK Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR697012.2|CNS0G0RK Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR696669.2|CNS0G0I1 Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR696546.2|CNS0G0EM Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR696299.2|CNS0G07R Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR694383.2|CNS0FYQJ Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR694171.2|CNS0FYKN Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR694138.2|CNS0FYJQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR694134.2|CNS0FYJM Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR694030.2|CNS0FYGQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR693776.2|CNS0FY9O Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR693694.2|CNS0FY7E Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR693089.2|CNS0FXQL Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR692975.2|CNS0FXNF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR692013.2|CNS0FWWP Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR690406.2|CNS0FVO2 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR689779.2|CNS0FV6N Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR688604.2|CNS0FUA0 Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR688046.2|CNS0FTUI Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR687925.2|CNS0FTR5 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 396 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 337

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 336 gtgggcccggatcttcttcagcctctc 310



to top

>emb|CR686387.2|CNS0FSKF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR686304.2|CNS0FSI4 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR686239.2|CNS0FSGB Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR685614.2|CNS0FRYY Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR684442.2|CNS0FR2E Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR683437.2|CNS0FQAH Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 383

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 382 gtgggcccggatcttcttcagcctctc 356



to top

>emb|CR682886.2|CNS0FPV6 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR682487.2|CNS0FPK3 Tetraodon nigroviridis full-length cDNA
          Length = 640

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 559 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 500

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 499 gtgggcccggatcttcttcagcctctc 473



to top

>emb|CR682175.2|CNS0FPBF Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR681394.2|CNS0FOPQ Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR680612.2|CNS0FO40 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR679692.2|CNS0FNEG Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR679567.2|CNS0FNAZ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR678814.2|CNS0FMQ2 Tetraodon nigroviridis full-length cDNA
          Length = 496

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 415 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 356

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 355 gtgggcccggatcttcttcagcctctc 329



to top

>emb|CR679090.2|CNS0FMXQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR678694.2|CNS0FMMQ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR677677.2|CNS0FLUU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR677659.2|CNS0FLUC Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR677875.2|CNS0FM0B Tetraodon nigroviridis full-length cDNA
          Length = 537

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 454 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 395

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 394 gtgggcccggatcttcttcagcctctc 368



to top

>emb|CR677055.2|CNS0FLDN Tetraodon nigroviridis full-length cDNA
          Length = 530

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR676589.2|CNS0FL0P Tetraodon nigroviridis full-length cDNA
          Length = 1175

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                        
Query: 211  gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
            |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 1101 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 1042

                                       
Query: 271  gnggttcctgatcttcttgagcctctc 297
            | ||  || ||||||||| ||||||||
Sbjct: 1041 gtgggcccggatcttcttcagcctctc 1015



to top

>emb|CR676244.2|CNS0FKR4 Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR675831.2|CNS0FKFX Tetraodon nigroviridis full-length cDNA
          Length = 499

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 418 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 359

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 358 gtgggcccggatcttcttcagcctctc 332



to top

>emb|CR675684.2|CNS0FKBU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR675638.2|CNS0FKAK Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR675556.2|CNS0FK8A Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR674793.2|CNS0FJN3 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR674782.2|CNS0FJMS Tetraodon nigroviridis full-length cDNA
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 444 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 385

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 384 gtgggcccggatcttcttcagcctctc 358



to top

>emb|CR672937.2|CNS0FI7J Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR671413.2|CNS0FH17 Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaagccccagaagtggcggagcccgcg 387

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 386 gtgggcccggatcttcttcagcctctc 360



to top

>emb|CR670010.2|CNS0FFY8 Tetraodon nigroviridis full-length cDNA
          Length = 524

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 443 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 384

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 383 gtgggcccggatcttcttcagcctctc 357



to top

>emb|CR668099.2|CNS0FEH5 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 383

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 382 gtgggcccggatcttcttcagcctctc 356



to top

>emb|CR666571.2|CNS0FDAP Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR666558.2|CNS0FDAC Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR666487.2|CNS0FD8D Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 446 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 387

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 386 gtgggcccggatcttcttcagcctctc 360



to top

>emb|CR666205.2|CNS0FD0J Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 383

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 382 gtgggcccggatcttcttcagcctctc 356



to top

>emb|CR666012.2|CNS0FCV6 Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 447 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 388

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 387 gtgggcccggatcttcttcagcctctc 361



to top

>emb|CR665971.2|CNS0FCU1 Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 383

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 382 gtgggcccggatcttcttcagcctctc 356



to top

>emb|CR665244.2|CNS0FC9U Tetraodon nigroviridis full-length cDNA
          Length = 530

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR664532.2|CNS0FBQ2 Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 405 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 346

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 345 gtgggcccggatcttcttcagcctctc 319



to top

>emb|CR664405.2|CNS0FBMJ Tetraodon nigroviridis full-length cDNA
          Length = 523

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 442 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 383

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 382 gtgggcccggatcttcttcagcctctc 356



to top

>emb|CR664162.2|CNS0FBFS Tetraodon nigroviridis full-length cDNA
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR663985.2|CNS0FBAV Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR663647.2|CNS0FB1H Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR663135.2|CNS0FAN9 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR662647.2|CNS0FA9P Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR662501.2|CNS0FA5N Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR663048.2|CNS0FAKU Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR662236.1|CNS0F9YA Tetraodon nigroviridis full-length cDNA
          Length = 521

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359



to top

>emb|CR660192.2|CNS0F8DI Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 gccggtagtcttggtgtgctgaccacggacacgcacgcccnagtagtgacgaagaccacg 270
           |||||| |||||||||||||| ||||| || |||| |||| || |||| || || || ||
Sbjct: 445 gccggtggtcttggtgtgctggccacgcacgcgcaggccccagaagtggcggagcccgcg 386

                                      
Query: 271 gnggttcctgatcttcttgagcctctc 297
           | ||  || ||||||||| ||||||||
Sbjct: 385 gtgggcccggatcttcttcagcctctc 359


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,323,062
Number of Sequences: 3902068
Number of extensions: 2323062
Number of successful extensions: 44010
Number of sequences better than 10.0: 514
Number of HSP's better than 10.0 without gapping: 512
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 43379
Number of HSP's gapped (non-prelim): 609
length of query: 303
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 281
effective length of database: 17,147,199,772
effective search space: 4818363135932
effective search space used: 4818363135932
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top