| Clone Name | rbags35e03 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AF542973.1| Triticum aestivum cyclophilin mRNA, partial cds | 48 | 0.021 | 2 | gb|AC009346.5|AC009346 Drosophila melanogaster, chromosome 3R, r... | 40 | 5.2 | 3 | gb|AE003602.4| Drosophila melanogaster chromosome 3R, section 6 ... | 40 | 5.2 |
|---|
>gb|AF542973.1| Triticum aestivum cyclophilin mRNA, partial cds Length = 806 Score = 48.1 bits (24), Expect = 0.021 Identities = 51/60 (85%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 328 gaaaactagtcaccgtagctt-ccaccaaagaccattccaggtcatcacagcggcacttc 386 ||||| ||||| | ||||||| || ||| ||||| || ||||||||| |||||||||||| Sbjct: 746 gaaaantagtcncngtagcttcccnccagagaccgtttcaggtcatcccagcggcacttc 687
>gb|AC009346.5|AC009346 Drosophila melanogaster, chromosome 3R, region 83A-83B, BAC clone BACR03P13, complete sequence Length = 168448 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 acaataacgaaagtgcattt 46 |||||||||||||||||||| Sbjct: 77667 acaataacgaaagtgcattt 77648
>gb|AE003602.4| Drosophila melanogaster chromosome 3R, section 6 of 118 of the complete sequence Length = 326091 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 acaataacgaaagtgcattt 46 |||||||||||||||||||| Sbjct: 237738 acaataacgaaagtgcattt 237719 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,738,923 Number of Sequences: 3902068 Number of extensions: 2738923 Number of successful extensions: 43111 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43106 Number of HSP's gapped (non-prelim): 4 length of query: 390 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 368 effective length of database: 17,147,199,772 effective search space: 6310169516096 effective search space used: 6310169516096 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)