ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags35c18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF525086.1| Triticum aestivum GSK-like kinase mRNA, complete cds 252 5e-64
2gb|AC169520.2| Mus musculus BAC clone RP23-35C6 from chromosome ... 42 0.81
3gb|AC166063.4| Mus musculus BAC clone RP23-21L22 from chromosome... 42 0.81
4gb|AC155249.2| Mus musculus BAC clone RP24-254A5 from chromosome... 40 3.2
5ref|XM_742285.1| Aspergillus fumigatus Af293 hypothetical protei... 40 3.2
6emb|AL589645.10| Human DNA sequence from clone RP11-251H13 on ch... 40 3.2
7dbj|AB122031.1| Oncorhynchus mykiss tyrb mRNA for tyrosinase b, ... 40 3.2

>gb|AF525086.1| Triticum aestivum GSK-like kinase mRNA, complete cds
          Length = 1573

 Score =  252 bits (127), Expect = 5e-64
 Identities = 152/159 (95%), Gaps = 1/159 (0%)
 Strand = Plus / Minus

                                                                        
Query: 65   gcctcgatccatgaacaaatactggaccaaatattggcggtacatagtgtgcatccttcc 124
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1539 gcctcgatccatgaacaaatactggaccaaatattggcggtacatagggtgcatccttca 1480

                                                                        
Query: 125  ttgcatagcacatgagctcaggggagaacagtcgaaacacttctcatctacttacagaat 184
            ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||
Sbjct: 1479 ttgcatagcacatgagctcaggggaaaacggtcgaaacacttctcatctacttacagtat 1420

                                                   
Query: 185  catgggtgatttgttacnatcggcagtagggggaaagaa 223
            |||||||| |||||||| |||||||||||||||||||||
Sbjct: 1419 catgggtggtttgttac-atcggcagtagggggaaagaa 1382



to top

>gb|AC169520.2| Mus musculus BAC clone RP23-35C6 from chromosome 19, complete sequence
          Length = 209374

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 131    agcacatgagctcaggggagaacag 155
              ||||| |||||||||||||||||||
Sbjct: 123500 agcacttgagctcaggggagaacag 123476



to top

>gb|AC166063.4| Mus musculus BAC clone RP23-21L22 from chromosome 19, complete sequence
          Length = 232698

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 131    agcacatgagctcaggggagaacag 155
              ||||| |||||||||||||||||||
Sbjct: 138755 agcacttgagctcaggggagaacag 138779



to top

>gb|AC155249.2| Mus musculus BAC clone RP24-254A5 from chromosome 9, complete sequence
          Length = 191932

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 173   tacttacagaatcatgggtgattt 196
             |||||||||||||||| |||||||
Sbjct: 84831 tacttacagaatcatgtgtgattt 84854



to top

>ref|XM_742285.1| Aspergillus fumigatus Af293 hypothetical protein (Afu8g05770)
           partial mRNA
          Length = 912

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 215 gggaaagaaagaatcatgac 234
           ||||||||||||||||||||
Sbjct: 340 gggaaagaaagaatcatgac 359



to top

>emb|AL589645.10| Human DNA sequence from clone RP11-251H13 on chromosome 9, complete
             sequence
          Length = 48323

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 218   aaagaaagaatcatgacacc 237
             ||||||||||||||||||||
Sbjct: 39354 aaagaaagaatcatgacacc 39373



to top

>dbj|AB122031.1| Oncorhynchus mykiss tyrb mRNA for tyrosinase b, complete cds
          Length = 3171

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 gggggaaagaaagaatcatg 232
           ||||||||||||||||||||
Sbjct: 77  gggggaaagaaagaatcatg 58


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,094,692
Number of Sequences: 3902068
Number of extensions: 3094692
Number of successful extensions: 41938
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41930
Number of HSP's gapped (non-prelim): 7
length of query: 249
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 227
effective length of database: 17,147,199,772
effective search space: 3892414348244
effective search space used: 3892414348244
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top