| Clone Name | rbags34n10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase Length = 1800 Score = 1283 bits (647), Expect = 0.0 Identities = 653/656 (99%) Strand = Plus / Minus Query: 39 actagaaggcaaacgttgtttatcacatactaattcgacaacatcttaggggcaaacgtc 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1800 actagaaggcaaacgttgtttatcacatactaattcgacaacatcttaggggcaaacgtc 1741 Query: 99 cagaaacagtcttgccatcttaggaaccaacccttggtcatgtcaggcagggtctttgaa 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1740 cagaaacagtcttgccatcttaggaaccaacccttggtcatgtcaggcagggtctttgaa 1681 Query: 159 aagcagcatgcagcatatatacacaacacacatcaccggtcaaattcggagtaaaaagct 218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1680 aagcagcatgcagcatatatacacaacacacatcaccggtcaaattcggagtaaaaagct 1621 Query: 219 aagctctctcccggcgcaagtgtccgcctccacgatggggcgctcgctcgaccacccttc 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1620 aagctctctcccggcgcaagtgtccgcctccacgatggggcgctcgctcgaccacccttc 1561 Query: 279 aggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgggc 338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1560 aggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgggc 1501 Query: 339 ccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctg 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1500 ccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctg 1441 Query: 399 tgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttctg 458 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1440 tgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttctg 1381 Query: 459 gtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaaggc 518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1380 gtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaaggc 1321 Query: 519 tgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggttaa 578 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1320 tgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggttaa 1261 Query: 579 cgtaatctagtatgagatcctgggtcttgttctgtgcaagttgnttctgcatccatacaa 638 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 1260 cgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccatacaa 1201 Query: 639 cagccatctnacaggcactgcacatgggatcggcacggangccatttgatttcaca 694 ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 1200 cagccatctcacaggcactgcacatgggatcggcacggaggccatttgatttcaca 1145
>dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic proteinase, complete cds Length = 1527 Score = 668 bits (337), Expect = 0.0 Identities = 397/418 (94%) Strand = Plus / Minus Query: 277 tcaggccgccttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtggtacgg 336 ||||||||||||||| ||||| | |||||||||||||||||| |||||||||||||| || Sbjct: 1527 tcaggccgccttggcgaagccgacacgcagcttgccgtagtcgaagacggtgtggtaggg 1468 Query: 337 gcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggc 396 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1467 gcccatgaaaacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggc 1408 Query: 397 tgtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttc 456 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 1407 tgtgaatccactgatgcactgggcagcagctccttcgccaaccttcaggatatactcttc 1348 Query: 457 tggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaag 516 |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| Sbjct: 1347 tggtttcagcgcaaacttcttgccactaatggtgaactcaatgtcaggcatggatccaag 1288 Query: 517 gctgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggtt 576 |||| | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||| Sbjct: 1287 gctggcacagtccacagctgattctcccatggggcttggcagacggttgcacagctggtt 1228 Query: 577 aacgtaatctagtatgagatcctgggtcttgttctgtgcaagttgnttctgcatccatac 636 ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || Sbjct: 1227 aacgtaatctagtatgagatcctgggtcttgttctgtgcaagttggttctgcatccacac 1168 Query: 637 aacagccatctnacaggcactgcacatgggatcggcacggangccatttgatttcaca 694 ||||||||||| ||||||||||||||||||||||| | ||| |||||| ||||||||| Sbjct: 1167 aacagccatctcacaggcactgcacatgggatcggtatggaggccattcgatttcaca 1110
>dbj|AK104838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-E12, full insert sequence Length = 1777 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1563 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1504 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1503 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1444 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 1443 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1384 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1383 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1324 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1323 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1264 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1263 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1204 Query: 667 a 667 | Sbjct: 1203 a 1203
>dbj|AK103421.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128K05, full insert sequence Length = 1818 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1564 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1505 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1504 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1445 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 1444 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1385 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1384 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1325 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1324 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1265 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1264 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1205 Query: 667 a 667 | Sbjct: 1204 a 1204
>dbj|AK100749.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118K01, full insert sequence Length = 1086 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 772 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 713 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 712 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 653 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 652 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 593 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 592 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 533 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 532 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 473 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 472 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 413 Query: 667 a 667 | Sbjct: 412 a 412
>dbj|AK098911.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H22, full insert sequence Length = 1844 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1566 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1507 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1506 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1447 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 1446 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1387 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1386 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1327 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1326 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1267 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1266 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1207 Query: 667 a 667 | Sbjct: 1206 a 1206
>dbj|AK098906.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D14, full insert sequence Length = 1843 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1561 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1502 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1501 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1442 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 1441 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1382 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1381 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1322 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1321 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1262 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1261 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1202 Query: 667 a 667 | Sbjct: 1201 a 1201
>dbj|AK067742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116C15, full insert sequence Length = 1869 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1564 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1505 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1504 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1445 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 1444 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 1385 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1384 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1325 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1324 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1265 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1264 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1205 Query: 667 a 667 | Sbjct: 1204 a 1204
>dbj|AK066453.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059L24, full insert sequence Length = 2543 Score = 379 bits (191), Expect = e-102 Identities = 318/361 (88%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 2195 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 2136 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2135 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 2076 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 2075 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttgcctccaat 2016 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 2015 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1956 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1955 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1896 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1895 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1836 Query: 667 a 667 | Sbjct: 1835 a 1835
>dbj|D32144.1|RICAPA Rice mRNA for aspartic protease, complete cds Length = 2030 Score = 371 bits (187), Expect = 2e-99 Identities = 317/361 (87%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 1553 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 1494 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1493 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 1434 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 |||||||||||||||||| |||||||||||||| ||||| |||||||| ||| | ||||| Sbjct: 1433 tccttcaccaaccttcagaatatactcttctggcttcagtgcaaactttttggctccaat 1374 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||||| |||||||| | |||||||||||| Sbjct: 1373 ggtgaatgaaatctcaggcatggatgcaaggctgccacagtccacagatgattctcccat 1314 Query: 547 gggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtctt 606 ||||||||||| || || ||||| |||| ||| | | ||||||||||| ||||| Sbjct: 1313 tggacttgggagcttgtcacagagctgattaatgtagttcaagatgagatcctgagtctt 1254 Query: 607 gttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacatggg 666 ||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||| Sbjct: 1253 gttctgtgcaagttggttctgcatccatacaacagccatctcacaggcattgcacatggg 1194 Query: 667 a 667 | Sbjct: 1193 a 1193
>gb|AY112455.1| Zea mays CL6331_1 mRNA sequence Length = 1071 Score = 301 bits (152), Expect = 2e-78 Identities = 312/366 (85%) Strand = Plus / Minus Query: 304 cagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 ||||||||| ||||| |||||||||||||| |||||||| || || |||| |||||| Sbjct: 753 cagcttgccatagtcgaagacggtgtggtagactcccatgaaaacatcacccaagatcca 694 Query: 364 gagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagc 423 |||||| || || || || ||||| ||||| ||||||||||| ||||||||||||||||| Sbjct: 693 gagagggccacggggtggtgggatatccatagctgtgaatccgctgatgcactgggcagc 634 Query: 424 agctccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccacc 483 |||||||||||||||||| || |||| |||||||||||| ||||| ||||| || Sbjct: 633 ctgtccttcaccaaccttcagaatgtactgctctggtttcagcttgaacttattgcctcc 574 Query: 484 aatggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcc 543 |||||||||| ||||||||||||||||| |||| ||||| |||||||||||||||||||| Sbjct: 573 aatggtgaacgcaatgtcaggcatggacgcaagactgccacagtccacggctgattctcc 514 Query: 544 catgggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggt 603 ||| ||||| || ||||| | ||| ||||| |||| ||| | || ||||| ||||| || Sbjct: 513 cattggactcggaagacgctcgcaaagctgattaatgtagttcaggatgagctcctgtgt 454 Query: 604 cttgttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 ||||||||| |||||||| |||||||||||||| |||||||||| ||||||| ||||||| Sbjct: 453 cttgttctgggcaagttggttctgcatccataccacagccatctcacaggcattgcacat 394 Query: 664 gggatc 669 ||||| Sbjct: 393 tggatc 388
>gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence Length = 1169 Score = 281 bits (142), Expect = 1e-72 Identities = 284/332 (85%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggct 397 |||||||| || || |||| |||||||||||| || || || || ||||| ||||| ||| Sbjct: 814 cccatgaaaacatcacccaagatccagagagggccacggggtggtgggatatccatagct 755 Query: 398 gtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggatatactcttct 457 |||||||| ||||||||||||||||| |||||||||||||||||| || |||| ||| Sbjct: 754 gtgaatccgctgatgcactgggcagcctgtccttcaccaaccttcagaatgtactgctct 695 Query: 458 ggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggacccaagg 517 ||||||||| ||||| ||||| |||||||||||| ||||||||||||||||| |||| Sbjct: 694 ggtttcagcttgaacttattgcctccaatggtgaacgcaatgtcaggcatggacgcaaga 635 Query: 518 ctgccgcagtccacggctgattctcccatgggacttgggagacggttgcacagctggtta 577 ||||| ||||||||||||||||||||||| ||||| || ||||| | ||| ||||| ||| Sbjct: 634 ctgccacagtccacggctgattctcccattggactcggaagacgctcgcaaagctgatta 575 Query: 578 acgtaatctagtatgagatcctgggtcttgttctgtgcaagttgnttctgcatccataca 637 | ||| | || ||||| ||||| ||||||||||| |||||||| |||||||||||||| Sbjct: 574 atgtagttcaggatgagctcctgtgtcttgttctgggcaagttggttctgcatccatacc 515 Query: 638 acagccatctnacaggcactgcacatgggatc 669 |||||||||| ||||||| ||||||| ||||| Sbjct: 514 acagccatctcacaggcattgcacattggatc 483
>gb|AF285164.1| Oryza sativa subsp. japonica aspartic protease mRNA, partial cds Length = 562 Score = 236 bits (119), Expect = 8e-59 Identities = 218/251 (86%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||||||| Sbjct: 327 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatccagag 268 Query: 367 aggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagc 426 |||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 267 aggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggcagcagc 208 Query: 427 tccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaat 486 | ||| |||||||||||| |||||||||||||| ||||| |||||||| ||| | |||| Sbjct: 207 ttctttaccaaccttcagaatatactcttctggcttcagtgcaaactttttggcttcaat 148 Query: 487 ggtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccat 546 |||||| ||| ||||||||||| |||||||| | |||||||| | ||| ||| |||| Sbjct: 147 ggtgaatgaaatctcaggcatggatgcaaggctggcacagtccacagatgaatcttccat 88 Query: 547 gggacttggga 557 |||||||||| Sbjct: 87 tggacttggga 77 Score = 48.1 bits (24), Expect = 0.039 Identities = 38/43 (88%) Strand = Plus / Minus Query: 590 atgagatcctgggtcttgttctgtgcaagttgnttctgcatcc 632 ||||||||||| |||||| ||||||||||| | ||||| |||| Sbjct: 44 atgagatcctgagtcttggtctgtgcaagtgggttctggatcc 2
>ref|NM_192504.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1560 Score = 234 bits (118), Expect = 3e-58 Identities = 296/356 (83%) Strand = Plus / Minus Query: 308 ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 367 ||||| |||||||| ||||| ||||| | ||||| ||||| ||||||| |||||||||| Sbjct: 1529 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1470 Query: 368 ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 427 ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| | Sbjct: 1469 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1410 Query: 428 ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 487 || ||||||||||||||||| || | ||||||||| || ||||||| |||||||| || Sbjct: 1409 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1350 Query: 488 gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 547 ||||| |||||||||||||||| ||||||||| |||||| || | |||||||||||| Sbjct: 1349 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1290 Query: 548 ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 607 ||||| || ||||||| || ||||| | || ||| | | || ||||||||| || | Sbjct: 1289 ggactaggaagacggtcacatagctgatcaatgtactgcaatacgagatcctgagtttga 1230 Query: 608 ttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 || ||||||||||| | ||||||||||||||||| ||| ||| ||| ||||||| Sbjct: 1229 ttttgtgcaagttgggtatgcatccatacaacagctgtctcacaagcattgcacat 1174
>dbj|AK072283.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016B15, full insert sequence Length = 1862 Score = 234 bits (118), Expect = 3e-58 Identities = 296/356 (83%) Strand = Plus / Minus Query: 308 ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 367 ||||| |||||||| ||||| ||||| | ||||| ||||| ||||||| |||||||||| Sbjct: 1654 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1595 Query: 368 ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 427 ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| | Sbjct: 1594 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1535 Query: 428 ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 487 || ||||||||||||||||| || | ||||||||| || ||||||| |||||||| || Sbjct: 1534 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1475 Query: 488 gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 547 ||||| |||||||||||||||| ||||||||| |||||| || | |||||||||||| Sbjct: 1474 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1415 Query: 548 ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 607 ||||| || ||||||| || ||||| | || ||| | | || ||||||||| || | Sbjct: 1414 ggactaggaagacggtcacatagctgatcaatgtactgcaatacgagatcctgagtttga 1355 Query: 608 ttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 || ||||||||||| | ||||||||||||||||| ||| ||| ||| ||||||| Sbjct: 1354 ttttgtgcaagttgggtatgcatccatacaacagctgtctcacaagcattgcacat 1299
>dbj|AK072645.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131B07, full insert sequence Length = 1576 Score = 226 bits (114), Expect = 8e-56 Identities = 295/356 (82%) Strand = Plus / Minus Query: 308 ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 367 ||||| |||||||| ||||| ||||| | ||||| ||||| ||||||| |||||||||| Sbjct: 1308 ttgccatagtcaaacacggtatggtaggctcccataaagacatctcccaagatccagaga 1249 Query: 368 ggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagct 427 ||||| |||||||| || |||||||| ||||||||||||||||||||||||| ||||| | Sbjct: 1248 ggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggtagcagtt 1189 Query: 428 ccttcaccaaccttcaggatatactcttctggtttcagcgcaaacttcttgccaccaatg 487 || ||||||||||||||||| || | ||||||||| || ||||||| |||||||| || Sbjct: 1188 ccctcaccaaccttcaggatgtattgttctggtttgagaacaaacttgttgccaccgatt 1129 Query: 488 gtgaactcaatgtcaggcatggacccaaggctgccgcagtccacggctgattctcccatg 547 ||||| |||||||||||||||| ||||||||| |||||| || | |||||||||||| Sbjct: 1128 gtgaaggcaatgtcaggcatggatgcaaggctgctgcagtcaacagatgattctcccata 1069 Query: 548 ggacttgggagacggttgcacagctggttaacgtaatctagtatgagatcctgggtcttg 607 ||||| || ||||||| || || || | || ||| | | || ||||||||| || | Sbjct: 1068 ggactaggaagacggtcacatagttgatcaatgtactgcaatacgagatcctgagtttga 1009 Query: 608 ttctgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 || ||||||||||| | ||||||||||||||||| ||| ||| ||| ||||||| Sbjct: 1008 ttttgtgcaagttgggtatgcatccatacaacagctgtctcacaagcattgcacat 953
>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11, complete sequence Length = 204649 Score = 151 bits (76), Expect = 4e-33 Identities = 88/92 (95%) Strand = Plus / Minus Query: 361 ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 420 |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 96701 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 96642 Query: 421 agcagctccttcaccaaccttcaggatatact 452 |||||||||||||||||||||||| ||||||| Sbjct: 96641 agcagctccttcaccaaccttcagaatatact 96610 Score = 127 bits (64), Expect = 5e-26 Identities = 74/78 (94%) Strand = Plus / Minus Query: 590 atgagatcctgggtcttgttctgtgcaagttgnttctgcatccatacaacagccatctna 649 ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| | Sbjct: 96229 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaacagccatctca 96170 Query: 650 caggcactgcacatggga 667 |||||| ||||||||||| Sbjct: 96169 caggcattgcacatggga 96152 Score = 103 bits (52), Expect = 8e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 451 ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 510 ||||||||| ||||| |||||||| ||||| ||||||||||| ||| ||||||||||| Sbjct: 96451 ctcttctggcttcagtgcaaactttttgcctccaatggtgaatgaaatctcaggcatgga 96392 Query: 511 cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 558 |||||||||| |||||||| | |||||||||||| ||||||||||| Sbjct: 96391 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 96344 Score = 48.1 bits (24), Expect = 0.039 Identities = 48/56 (85%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||| Sbjct: 96850 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 96795
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 151 bits (76), Expect = 4e-33 Identities = 88/92 (95%) Strand = Plus / Minus Query: 361 ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 420 |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 28016536 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 28016477 Query: 421 agcagctccttcaccaaccttcaggatatact 452 |||||||||||||||||||||||| ||||||| Sbjct: 28016476 agcagctccttcaccaaccttcagaatatact 28016445 Score = 127 bits (64), Expect = 5e-26 Identities = 74/78 (94%) Strand = Plus / Minus Query: 590 atgagatcctgggtcttgttctgtgcaagttgnttctgcatccatacaacagccatctna 649 ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| | Sbjct: 28016064 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaacagccatctca 28016005 Query: 650 caggcactgcacatggga 667 |||||| ||||||||||| Sbjct: 28016004 caggcattgcacatggga 28015987 Score = 103 bits (52), Expect = 8e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 451 ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 510 ||||||||| ||||| |||||||| ||||| ||||||||||| ||| ||||||||||| Sbjct: 28016286 ctcttctggcttcagtgcaaactttttgcctccaatggtgaatgaaatctcaggcatgga 28016227 Query: 511 cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 558 |||||||||| |||||||| | |||||||||||| ||||||||||| Sbjct: 28016226 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 28016179 Score = 48.1 bits (24), Expect = 0.039 Identities = 48/56 (85%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||| Sbjct: 28016685 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 28016630
>dbj|D32165.1|RICAP Rice gene for aspartic protease, complete cds Length = 6782 Score = 151 bits (76), Expect = 4e-33 Identities = 88/92 (95%) Strand = Plus / Minus Query: 361 ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 420 |||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 6065 ccagagaggaccacggggaggagggatgtccatggctgtgaatccactgatgcactgggc 6006 Query: 421 agcagctccttcaccaaccttcaggatatact 452 |||||||||||||||||||||||| ||||||| Sbjct: 6005 agcagctccttcaccaaccttcagaatatact 5974 Score = 127 bits (64), Expect = 5e-26 Identities = 74/78 (94%) Strand = Plus / Minus Query: 590 atgagatcctgggtcttgttctgtgcaagttgnttctgcatccatacaacagccatctna 649 ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| | Sbjct: 5593 atgagatcctgagtcttgttctgtgcaagttggttctgcatccatacaacagccatctca 5534 Query: 650 caggcactgcacatggga 667 |||||| ||||||||||| Sbjct: 5533 caggcattgcacatggga 5516 Score = 95.6 bits (48), Expect = 2e-16 Identities = 93/108 (86%) Strand = Plus / Minus Query: 451 ctcttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatgga 510 ||||||||| ||||| |||||||| ||| | ||||||||||| ||| ||||||||||| Sbjct: 5815 ctcttctggcttcagtgcaaactttttggctccaatggtgaatgaaatctcaggcatgga 5756 Query: 511 cccaaggctgccgcagtccacggctgattctcccatgggacttgggag 558 |||||||||| |||||||| | |||||||||||| ||||||||||| Sbjct: 5755 tgcaaggctgccacagtccacagatgattctcccattggacttgggag 5708 Score = 48.1 bits (24), Expect = 0.039 Identities = 48/56 (85%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||||||||||| || ||||| ||||| | |||||||| ||||| |||||||||| Sbjct: 6214 cttgccgtagtcgaacacggtatggtaggcacccatgaaaacgtcacccaggatcc 6159
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 119 bits (60), Expect = 1e-23 Identities = 84/92 (91%) Strand = Plus / Plus Query: 361 ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 420 |||||||||||| |||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 27079661 ccagagaggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggt 27079720 Query: 421 agcagctccttcaccaaccttcaggatatact 452 ||||| ||| ||||||||||||||||| |||| Sbjct: 27079721 agcagttccctcaccaaccttcaggatgtact 27079752 Score = 83.8 bits (42), Expect = 7e-13 Identities = 93/110 (84%) Strand = Plus / Plus Query: 454 ttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggaccc 513 ||||||||| || ||||||| |||||||| || ||||| |||||||||||||||| | Sbjct: 27080543 ttctggtttgagaacaaacttgttgccaccgattgtgaaggcaatgtcaggcatggatgc 27080602 Query: 514 aaggctgccgcagtccacggctgattctcccatgggacttgggagacggt 563 |||||||| |||||| || | |||||||||||| ||||| || ||||||| Sbjct: 27080603 aaggctgctgcagtcaacagatgattctcccataggactaggaagacggt 27080652 Score = 46.1 bits (23), Expect = 0.15 Identities = 45/53 (84%) Strand = Plus / Plus Query: 611 tgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 ||||||||||| | ||||||||||||||||| ||| ||| ||| ||||||| Sbjct: 27080778 tgtgcaagttgggtatgcatccatacaacagctgtctcacaagcattgcacat 27080830
>dbj|AP003284.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0671D01 Length = 163006 Score = 119 bits (60), Expect = 1e-23 Identities = 84/92 (91%) Strand = Plus / Plus Query: 361 ccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggc 420 |||||||||||| |||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 138492 ccagagaggaccacgaggaggaggaatgtccatagctgtgaatccactgatgcactgggt 138551 Query: 421 agcagctccttcaccaaccttcaggatatact 452 ||||| ||| ||||||||||||||||| |||| Sbjct: 138552 agcagttccctcaccaaccttcaggatgtact 138583 Score = 83.8 bits (42), Expect = 7e-13 Identities = 93/110 (84%) Strand = Plus / Plus Query: 454 ttctggtttcagcgcaaacttcttgccaccaatggtgaactcaatgtcaggcatggaccc 513 ||||||||| || ||||||| |||||||| || ||||| |||||||||||||||| | Sbjct: 139374 ttctggtttgagaacaaacttgttgccaccgattgtgaaggcaatgtcaggcatggatgc 139433 Query: 514 aaggctgccgcagtccacggctgattctcccatgggacttgggagacggt 563 |||||||| |||||| || | |||||||||||| ||||| || ||||||| Sbjct: 139434 aaggctgctgcagtcaacagatgattctcccataggactaggaagacggt 139483 Score = 46.1 bits (23), Expect = 0.15 Identities = 45/53 (84%) Strand = Plus / Plus Query: 611 tgtgcaagttgnttctgcatccatacaacagccatctnacaggcactgcacat 663 ||||||||||| | ||||||||||||||||| ||| ||| ||| ||||||| Sbjct: 139609 tgtgcaagttgggtatgcatccatacaacagctgtctcacaagcattgcacat 139661
>dbj|AB002695.1| Pumpkin mRNA for aspartic endopeptidase, complete cds Length = 1776 Score = 97.6 bits (49), Expect = 5e-17 Identities = 130/157 (82%) Strand = Plus / Minus Query: 304 cagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 ||||||||| | ||||||||||||||||| | ||||||||||| ||||||| |||||| Sbjct: 1593 cagcttgccaaaatcaaagacggtgtggtagcgacccatgaagacatctcccaagatcca 1534 Query: 364 gagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagc 423 ||| || || |||||||| ||||| || | || || |||||||| |||||||| || | Sbjct: 1533 gaggggtccacgaggaggagggatatcaaatgcagtaaatccacttatgcactgagctac 1474 Query: 424 agctccttcaccaaccttcaggatatactcttctggt 460 || || ||||||||||| || ||||||||||||||| Sbjct: 1473 aggaccctcaccaaccttgagtatatactcttctggt 1437
>emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic proteinase (ap2 gene) Length = 1828 Score = 93.7 bits (47), Expect = 7e-16 Identities = 119/143 (83%) Strand = Plus / Minus Query: 317 tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcga 376 ||||||||||||||||| | |||||||||| |||||||| ||||||||||| || ||| Sbjct: 1566 tcaaagacggtgtggtagcgacccatgaagatatctcccagaatccagagaggtccacga 1507 Query: 377 ggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcacca 436 ||||| || || |||| || || || |||||||||||||| || ||| |||||||| Sbjct: 1506 ggaggaggaatatccaaagcagtaaagccactgatgcactgtgcttcagaaccttcaccc 1447 Query: 437 accttcaggatatactcttctgg 459 ||||| || |||||||||||||| Sbjct: 1446 accttgagaatatactcttctgg 1424
>emb|Y09123.1|CCY09123 C.calcitrapa mRNA for aspartic proteinase Length = 1721 Score = 67.9 bits (34), Expect = 4e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 350 tctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctgtgaatccactg 409 ||||||| |||||| ||||| || |||||||| | || ||||| ||||||||||||||| Sbjct: 1491 tctcccaagatccatagaggtccacgaggaggggcgacatccatagctgtgaatccactg 1432 Query: 410 atgcactgggcagcagctccttcaccaaccttcaggatatactcttctgg 459 ||||| || || || |||| ||||||| |||||||| |||| |||||| Sbjct: 1431 atgcattgtgcggcttctccctcaccaattttcaggatgtactgttctgg 1382
>emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic proteinase (ap1 gene) Length = 1784 Score = 67.9 bits (34), Expect = 4e-08 Identities = 121/150 (80%) Strand = Plus / Minus Query: 303 gcagcttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||| ||||| |||||||| || || ||| || ||||||| |||||||| |||| ||||| Sbjct: 1581 gcaggttgccatagtcaaatactgtatggaactggcccataaagacgtcgcccaagatcc 1522 Query: 363 agagaggaccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcag 422 ||||||| || |||||||| || | |||| || ||||||||||||| ||| || || Sbjct: 1521 agagaggtccacgaggaggtggcacatccagagcagtgaatccactgaggcattgagcta 1462 Query: 423 cagctccttcaccaaccttcaggatatact 452 || |||| ||||| || ||||||| ||||| Sbjct: 1461 catctccctcacccactttcaggacatact 1432
>gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease precursor mRNA, complete cds Length = 1740 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 314 tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 373 ||||||||||| ||||| ||||| |||||||| || ||||| || ||||| ||||||||| Sbjct: 1502 tagtcaaagacagtgtgatacggccccatgaatacatctccaagaatccaaagaggaccg 1443 Query: 374 cgagg 378 ||||| Sbjct: 1442 cgagg 1438
>gb|AY792822.1| Sus scrofa cathepsin D protein mRNA, partial cds Length = 1894 Score = 63.9 bits (32), Expect = 7e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 323 acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 382 ||||||| ||| |||| ||||| |||||||||||||||||||| || |||| || ||| Sbjct: 1136 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1077 Query: 383 gggatgtccatg 394 |||||||||||| Sbjct: 1076 gggatgtccatg 1065
>dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic proteinase, complete cds Length = 1560 Score = 63.9 bits (32), Expect = 7e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 307 cttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||| |||| || ||||||||||| | |||||||||||| || || || |||||||| Sbjct: 1489 cttgccgaagtcgaacacggtgtggtaagcgcccatgaagacatccccaagaatccagag 1430 Query: 367 aggaccgcgaggaggcgggatgtc 390 |||||| || || ||||| ||||| Sbjct: 1429 aggaccacgtgggggcggtatgtc 1406 Score = 40.1 bits (20), Expect = 9.5 Identities = 31/35 (88%) Strand = Plus / Minus Query: 629 atccatacaacagccatctnacaggcactgcacat 663 ||||| ||||||||||||| |||||| ||||||| Sbjct: 1167 atccacacaacagccatctcacaggctgtgcacat 1133
>gb|DQ018729.1|DQ018728S2 Sus scrofa cathepsin D (CTSD) gene, exons 7 through 9 and partial cds Length = 1274 Score = 63.9 bits (32), Expect = 7e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 323 acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 382 ||||||| ||| |||| ||||| |||||||||||||||||||| || |||| || ||| Sbjct: 535 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 476 Query: 383 gggatgtccatg 394 |||||||||||| Sbjct: 475 gggatgtccatg 464
>gb|DQ018727.1| Sus scrofa cathepsin D mRNA, complete cds Length = 2032 Score = 63.9 bits (32), Expect = 7e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 323 acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 382 ||||||| ||| |||| ||||| |||||||||||||||||||| || |||| || ||| Sbjct: 1274 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1215 Query: 383 gggatgtccatg 394 |||||||||||| Sbjct: 1214 gggatgtccatg 1203
>ref|NM_001037721.1| Sus scrofa cathepsin D (CTSD), mRNA Length = 2032 Score = 63.9 bits (32), Expect = 7e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 323 acggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggc 382 ||||||| ||| |||| ||||| |||||||||||||||||||| || |||| || ||| Sbjct: 1274 acggtgtagtagcggccgatgaaaacgtctcccaggatccagagcggcccgccgggcggc 1215 Query: 383 gggatgtccatg 394 |||||||||||| Sbjct: 1214 gggatgtccatg 1203
>dbj|AB045892.1| Nepenthes alata NaAP2 mRNA for aspartic proteinase 2, complete cds Length = 1839 Score = 63.9 bits (32), Expect = 7e-07 Identities = 104/128 (81%) Strand = Plus / Minus Query: 311 ccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagagga 370 |||||||| || ||||||||||| | |||||||| | |||||||| ||||||||| || Sbjct: 1577 ccgtagtcgaacacggtgtggtattgacccatgaaaatgtctcccaagatccagaggggt 1518 Query: 371 ccgcgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctcct 430 || |||||||| | ||||| | ||| |||||||||| ||||| || |||||| | ||| Sbjct: 1517 ccacgaggaggggcaatgtctaaagctatgaatccactaatgcattgtgcagcaacacct 1458 Query: 431 tcaccaac 438 || ||||| Sbjct: 1457 tcgccaac 1450
>ref|NM_205177.1| Gallus gallus cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA Length = 1448 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||| |||||||| ||||||||||||||||| Sbjct: 1283 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 1233
>gb|BT020155.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>ref|NM_001909.3| Homo sapiens cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA Length = 2205 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1307 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1249
>gb|BC001574.1| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA clone IMAGE:3455250) Length = 1494 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 646 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 588
>gb|BC016320.2| Homo sapiens cathepsin D (lysosomal aspartyl peptidase), mRNA (cDNA clone MGC:2311 IMAGE:3506977), complete cds Length = 2117 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1219 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1161
>emb|X05344.1|HSCATDC Human mRNA for cathepsin D from oestrogen responsive breast cancer cells Length = 1988 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1176 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1118
>emb|CR456947.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1218D for gene CTSD, cathepsin D (lysosomal aspartyl protease); complete cds, incl. stopcodon Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|BT007637.1| Synthetic construct Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, partial cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|BT006910.1| Homo sapiens cathepsin D (lysosomal aspartyl protease) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>emb|CR858646.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0315 (from clone DKFZp469J0315) Length = 2023 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1191 ggccgatgaagacgtcgcccaggatccagagtggtccgctgggtggcgggatgtccatg 1133
>emb|CR623521.1| full-length cDNA clone CS0DI064YA16 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2032 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1255 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1197
>emb|CR613410.1| full-length cDNA clone CS0DE003YB18 of Placenta of Homo sapiens (human) Length = 2061 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1273 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1215
>emb|CR612133.1| full-length cDNA clone CS0DF002YC21 of Fetal brain of Homo sapiens (human) Length = 2006 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1213 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1155
>emb|CR609839.1| full-length cDNA clone CS0DI057YH09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2026 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1280 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1222
>emb|CR597228.1| full-length cDNA clone CS0DN004YA05 of Adult brain of Homo sapiens (human) Length = 2051 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1273 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1215
>dbj|AB169854.1| Macaca fascicularis brain cDNA, clone: QccE-11243, similar to human cathepsin D (lysosomal aspartyl protease) (CTSD), mRNA, RefSeq: NM_001909.3 Length = 2199 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1311 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1253
>gb|S49650.1| prepro-cathepsin D [chickens, follicles, mRNA, 1448 nt] Length = 1448 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||| |||||||| ||||||||||||||||| Sbjct: 1283 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 1233
>ref|NM_213873.1| Sus scrofa pepsin (LOC396892), mRNA Length = 1398 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1194 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1144
>gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, complete sequence Length = 120298 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 53774 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 53716
>gb|AY892734.1| Synthetic construct Homo sapiens clone FLH024310.01L cathepsin D (CTSD) mRNA, partial cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|AY890251.1| Synthetic construct Homo sapiens clone FLH024315.01X cathepsin D (CTSD) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|AY890417.1| Synthetic construct Homo sapiens clone FLH031241.01X cathepsin D (CTSD) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|AY888315.1| Synthetic construct Homo sapiens clone FLH008539.01X cathepsin D (CTSD) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>dbj|AK130178.1| Homo sapiens cDNA FLJ26668 fis, clone MPG03026, highly similar to Cathepsin D precursor (EC 3.4.23.5) Length = 1906 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1199 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1141
>gb|AY893487.1| Synthetic construct Homo sapiens clone FLH127809.01X cathepsin D (CTSD) mRNA, complete cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|AY892880.1| Synthetic construct Homo sapiens clone FLH031237.01L cathepsin D (CTSD) mRNA, partial cds Length = 1239 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1174 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1116
>gb|AC160647.1| Gallus gallus BAC clone CH261-14N23 from chromosome unknown, complete sequence Length = 237526 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||| |||||||| ||||||||||||||||| Sbjct: 132663 gtcaaagacagtgtagtaggggccaatgaagacatctcccaggatccagag 132613
>gb|M11233.1|HUMCTHD Human cathepsin D mRNA, complete cds Length = 2038 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 1225 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 1167
>gb|M63138.1|HUMCATD5 Human cathepsin D (catD) gene, exons 7, 8, and 9 Length = 2062 Score = 61.9 bits (31), Expect = 3e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 336 ggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||| ||||||||||| |||||||||||||| || |||| || ||||||||||||||| Sbjct: 820 ggccgatgaagacgtcgcccaggatccagagtggcccgctgggtggcgggatgtccatg 762
>gb|J04601.1|PIGPEPA Pig pepsinogen A mRNA, complete cds Length = 1363 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1155 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1105
>gb|M20920.1|PIGPEP Swine pepsinogen A mRNA, complete cds Length = 1398 Score = 61.9 bits (31), Expect = 3e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 |||||||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1194 gtcaaagacggtgtagtactggcggatgaagacgtcacccaggatccagag 1144
>ref|NM_001025621.1| Canis familiaris cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA Length = 1524 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||||||| || ||||||||||||||||| |||| ||| || |||||||||||| Sbjct: 1232 atgaagacatcacccaggatccagagaggcccgccaggtggggggatgtccatg 1179
>ref|XM_863994.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease), transcript variant 2 (CTSD), mRNA Length = 1907 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1185 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1132
>ref|XM_609913.2| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease), transcript variant 1 (CTSD), mRNA Length = 1901 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1179 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1126
>ref|XM_871709.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease), transcript variant 5 (CTSD), mRNA Length = 1919 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1197 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1144
>ref|XM_871611.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease), transcript variant 4 (CTSD), mRNA Length = 1910 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1188 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1135
>ref|XM_871531.1| PREDICTED: Bos taurus cathepsin D (lysosomal aspartyl protease), transcript variant 3 (CTSD), mRNA Length = 1955 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1233 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1180
>emb|AM048627.1| Canis familiaris mRNA for cathepsin D (ctsd gene) Length = 1524 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 |||||||| || ||||||||||||||||| |||| ||| || |||||||||||| Sbjct: 1232 atgaagacatcacccaggatccagagaggcccgccaggtggggggatgtccatg 1179
>dbj|AB055312.1| Bos taurus cat-D mRNA for cathepsin D, partial cds Length = 1578 Score = 60.0 bits (30), Expect = 1e-05 Identities = 48/54 (88%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||||||||| |||||||||||||| || |||| ||| || |||||||||||| Sbjct: 1092 atgaagacgtcgcccaggatccagagcggcccgccaggcggggggatgtccatg 1039
>ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT1G11910 mRNA, complete cds Length = 1898 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1412 caactttcagaacatactcttctgg 1388
>gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence Length = 1929 Score = 58.0 bits (29), Expect = 4e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 594 gatcctgggtcttgttctgtgcaagttgnttctgcatccatacaacagccat 645 ||||||| |||| ||||||| |||||| ||||||||||||||||| ||||| Sbjct: 1417 gatcctgagtctggttctgtctaagttggttctgcatccatacaactgccat 1366
>gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase (At1g11910) mRNA, complete cds Length = 1830 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1412 caactttcagaacatactcttctgg 1388
>gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds Length = 1820 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1412 caactttcagaacatactcttctgg 1388
>gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds Length = 1874 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1412 caactttcagaacatactcttctgg 1388
>dbj|AK221098.1| Arabidopsis thaliana mRNA for putative aspartic proteinase, complete cds, clone: RAFL22-84-P18 Length = 721 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 428 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 369 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 368 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 309 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 308 caactttcagaacatactcttctgg 284
>dbj|AK221202.1| Arabidopsis thaliana mRNA for putative aspartic proteinase, complete cds, clone: RAFL23-06-J05 Length = 1039 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 656 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 597 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 596 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 537 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 536 caactttcagaacatactcttctgg 512
>gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete sequence Length = 1814 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1532 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1473 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1472 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1413 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1412 caactttcagaacatactcttctgg 1388
>gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspartic proteinase (At1g11910) mRNA, complete cds Length = 1552 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1483 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1424 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1423 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1364 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1363 caactttcagaacatactcttctgg 1339
>gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mRNA, partial cds Length = 1722 Score = 58.0 bits (29), Expect = 4e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| || | Sbjct: 1424 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatccagagaggtccac 1365 Query: 375 gaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttcac 434 |||| || | | ||| | || | || |||||||||||||| || ||| ||| |||| Sbjct: 1364 gaggtggagcaacgtcaagagcaataaaaccactgatgcactgtgccacaggtccctcac 1305 Query: 435 caaccttcaggatatactcttctgg 459 |||| ||||| | |||||||||||| Sbjct: 1304 caactttcagaacatactcttctgg 1280
>gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds Length = 1680 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 ||||||||||| |||||||| || ||||| || ||||| |||||||||||||| Sbjct: 1443 gtgtggtacggccccatgaatacatctccaagaatccaaagaggaccgcgagg 1391
>gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease precursor-like mRNA, complete cds Length = 1764 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 314 tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 373 |||||||| || ||||| ||||| |||||||| || ||||| || ||||| ||||||||| Sbjct: 1508 tagtcaaacacagtgtgatacggccccatgaatacatctccaagaatccaaagaggaccg 1449 Query: 374 cgagg 378 ||||| Sbjct: 1448 cgagg 1444
>emb|CR662614.2|CNS0FA8S Tetraodon nigroviridis full-length cDNA Length = 629 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 |||||||||| |||| | || ||||||||||||||||||||||| Sbjct: 244 aagacggtgtagtactgaccgatgaagacgtctcccaggatcca 201
>emb|CR660862.2|CNS0F8W4 Tetraodon nigroviridis full-length cDNA Length = 626 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 |||||||||| |||| | || ||||||||||||||||||||||| Sbjct: 245 aagacggtgtagtactgaccgatgaagacgtctcccaggatcca 202
>emb|X88774.1|BORNAPAP B.oleracea mRNA for putative aspartic protease (partial) Length = 431 Score = 56.0 bits (28), Expect = 2e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgc 374 ||||||| ||||||||||| ||||||||| || ||||| |||||||||||||| || | Sbjct: 238 agtcaaacacggtgtggtatttgcccatgaacacatctccaaggatccagagaggtccac 179 Query: 375 gagg 378 |||| Sbjct: 178 gagg 175
>gb|U61396.2| Vigna unguiculata aspartic proteinase mRNA, complete cds Length = 1842 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcgaggagg 381 |||||||||||||| || |||||||||||||| || |||||||| Sbjct: 1604 cccatgaagacgtccccaaggatccagagagggccacgaggagg 1561
>gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-associated protein 4 (SA4) mRNA, complete cds Length = 1970 Score = 56.0 bits (28), Expect = 2e-04 Identities = 89/108 (82%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 386 atgtccatggctgtgaatccact-gatgcactgggcagcagctccttcaccaaccttcag 444 ||||||| ||| ||||||||||| ||| ||||| || |||| ||||||||||||||||| Sbjct: 1502 atgtccaaggcagtgaatccacttgatacactgagctgcaggtccttcaccaaccttcaa 1443 Query: 445 gatatactcttctggtttcagcgcaaacttcttgccaccaatggtgaa 492 | ||||| |||| | | || |||||| |||||||||||| ||||| Sbjct: 1442 aacatactgctctgctgtaaggtcaaactgcttgccaccaatagtgaa 1395 Score = 48.1 bits (24), Expect = 0.039 Identities = 64/78 (82%) Strand = Plus / Minus Query: 586 tagtatgagatcctgggtcttgttctgtgcaagttgnttctgcatccatacaacagccat 645 |||||| |||||||| || ||||| || || ||| || |||||||| ||||| ||||| Sbjct: 1301 tagtataagatcctgtgttttgttatgcttaatttgattttgcatccacacaactgccat 1242 Query: 646 ctnacaggcactgcacat 663 || ||| ||||||||||| Sbjct: 1241 ctcacaagcactgcacat 1224
>gb|AY389666.1| Hyacinthus orientalis aspartic proteinase mRNA, partial cds Length = 585 Score = 54.0 bits (27), Expect = 6e-04 Identities = 81/99 (81%) Strand = Plus / Minus Query: 340 catgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatggctgt 399 ||||||||| || |||| |||||||||||||| || || ||||| | |||| ||| || Sbjct: 364 catgaagacatcacccaaaatccagagaggaccccgcggtggcggtacatccaaggccgt 305 Query: 400 gaatccactgatgcactgggcagcagctccttcaccaac 438 |||||| |||||||| || || |||||||| || ||||| Sbjct: 304 gaatccgctgatgcattgtgctgcagctccctccccaac 266
>emb|X77260.1|BOASPR B. oleracea L. gene for aspartic protease (partial) Length = 1121 Score = 54.0 bits (27), Expect = 6e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagagg 369 ||||||| ||||||||||| ||||||||| || ||||||| |||||||||||| Sbjct: 841 agtcaaacacggtgtggtatttgcccatgaatacatctcccaagatccagagagg 787 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 404 ccactgatgcactgggcagcagctccttcaccaaccttcaggatatactc 453 |||||||||||||| || ||||| || |||||||||||||| | |||||| Sbjct: 752 ccactgatgcactgtgctgcagcgccctcaccaaccttcagaacatactc 703
>dbj|AB045891.1| Nepenthes alata NaAP1 mRNA for aspartic proteinase 1, complete cds Length = 1802 Score = 54.0 bits (27), Expect = 6e-04 Identities = 111/139 (79%) Strand = Plus / Minus Query: 314 tagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccg 373 |||||||| || ||||| ||| | |||||||| | |||||||| |||||||||||| || Sbjct: 1596 tagtcaaacacagtgtgatactgacccatgaaaatgtctcccaagatccagagaggtcca 1537 Query: 374 cgaggaggcgggatgtccatggctgtgaatccactgatgcactgggcagcagctccttca 433 ||||||| | | ||| | ||||||||| || |||||||| || | ||| ||||||| Sbjct: 1536 agaggaggggccacgtctaaggctgtgaagccgctgatgcattgagttgcaactccttcg 1477 Query: 434 ccaaccttcaggatatact 452 ||||| | |||||||||| Sbjct: 1476 ccaacttgaaggatatact 1458
>gb|AF156788.1| Pleuronectes americanus pepsinogen A form IIb precursor (pep2b) mRNA, complete cds Length = 1280 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||||||||||||||||||||| Sbjct: 1099 atgaagacgtctcccaggatccagag 1074
>dbj|AB120129.1| Paralichthys olivaceus pep mRNA for pepsinogen, complete cds Length = 1307 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||||||||||||||||||||| Sbjct: 1104 atgaagacgtctcccaggatccagag 1079
>emb|X81984.1|CCCYPRSN C.cardunculus mRNA for cyprosin Length = 1757 Score = 50.1 bits (25), Expect = 0.010 Identities = 73/89 (82%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggaggcggg 385 |||||||| ||||||| || || ||||||| |||||| ||||| || |||||||| | Sbjct: 1531 gtgtggtatcggcccataaaaacatctcccaagatccatagaggtccacgaggaggggcc 1472 Query: 386 atgtccatggctgtgaatccactgatgca 414 | ||||| || ||||||||||||||||| Sbjct: 1471 acatccatagcagtgaatccactgatgca 1443
>gb|AY103665.1| Zea mays PCO108960 mRNA sequence Length = 1413 Score = 50.1 bits (25), Expect = 0.010 Identities = 55/65 (84%) Strand = Plus / Minus Query: 308 ttgccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagaga 367 |||||| |||| || || |||||||| | |||||||||||||| || || ||||||||| Sbjct: 1092 ttgccgaagtcgaacaccgtgtggtaagctcccatgaagacgtccccaagaatccagaga 1033 Query: 368 ggacc 372 ||||| Sbjct: 1032 ggacc 1028 Score = 40.1 bits (20), Expect = 9.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 566 cacagctggttaacgtaatctagtatgagatcctgggtcttgtt 609 |||||||||||| |||| | |||||||| |||| ||||||||| Sbjct: 834 cacagctggttagcgtactgcagtatgagctccttggtcttgtt 791
>gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, complete cds Length = 1900 Score = 48.1 bits (24), Expect = 0.039 Identities = 48/56 (85%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgaggagg 381 ||||||||| | |||||||||| ||| |||| |||||||||||||| || ||||| Sbjct: 1609 gtgtggtactgacccatgaagatgtcgcccaatatccagagaggaccacgtggagg 1554
>emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase Length = 1603 Score = 48.1 bits (24), Expect = 0.039 Identities = 54/64 (84%) Strand = Plus / Minus Query: 389 tccatggctgtgaatccactgatgcactgggcagcagctccttcaccaaccttcaggata 448 |||||||| ||||||||||| ||||| || || | |||||||| ||||| ||||||| | Sbjct: 1315 tccatggcggtgaatccacttatgcattgtgctgttgctccttccccaactttcaggaca 1256 Query: 449 tact 452 |||| Sbjct: 1255 tact 1252
>dbj|AB091762.1| Glycine max soyAP4 mRNA for aspartic proteinase 4, partial cds Length = 664 Score = 48.1 bits (24), Expect = 0.039 Identities = 39/44 (88%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcgaggagg 381 ||||||||||| ||||| |||||||| ||||| || |||||||| Sbjct: 450 cccatgaagacatctccaaggatccatagagggccacgaggagg 407
>emb|AJ550951.1|TBE550951 Trematomus bernacchii mRNA for pepsin A3 Length = 1298 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatcca 363 ||||||||||||||||||||||| Sbjct: 1098 atgaagacgtctcccaggatcca 1076
>emb|AJ131678.1|CDR131678 Camelus dromedarius mRNA for pepsin Length = 1221 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1155 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1109
>dbj|AB089792.1| Oryctolagus cuniculus mRNA for pepsinogen III, complete cds Length = 1364 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1145 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1099
>dbj|AB089791.1| Oryctolagus cuniculus mRNA for pepsinogen II-4, complete cds Length = 1268 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1155 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1109
>dbj|AB089790.1| Oryctolagus cuniculus mRNA for pepsinogen II-1, complete cds Length = 1454 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1246 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1200
>gb|M59237.1|RABPEPIII Rabbit pepsinogen III mRNA, complete cds Length = 1371 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1150 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1104
>gb|M59235.1|RABPEPII23 Rabbit pepsinogen 11-2/3 mRNA, complete cds Length = 1266 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1153 aagacggtgaagtactggcggatgaagacgtcacccaggatccagag 1107
>dbj|AB047245.1| Rhinolophus ferrumequinum pgnA mRNA for pepsinogen A, complete cds Length = 1161 Score = 46.1 bits (23), Expect = 0.15 Identities = 44/51 (86%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||||||| |||| | | ||||||||||| |||||||||||||| Sbjct: 1122 gtcaaagacggtgaagtactgacgaatgaagacgtcgcccaggatccagag 1072
>dbj|AB047244.1| Sorex unguiculatus pgnA mRNA for pepsinogen A, complete cds Length = 1381 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatccagag 366 ||||||||| |||| ||| ||||||||||| |||||||||||||| Sbjct: 1143 aagacggtgaagtactggcggatgaagacgtcgcccaggatccagag 1097
>ref|XM_475576.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1491 Score = 44.1 bits (22), Expect = 0.61 Identities = 34/38 (89%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcg 375 ||||||||||| ||||| || ||||| ||||||||||| Sbjct: 1430 cccatgaagacatctccaagaatccaaagaggaccgcg 1393
>gb|BT018637.1| Zea mays clone EL01N0504C03.d mRNA sequence Length = 1568 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 359 atccagagaggaccgcgaggaggcgg 384 |||||||||||||| ||||||||||| Sbjct: 1198 atccagagaggaccacgaggaggcgg 1173
>ref|XM_545694.2| PREDICTED: Canis familiaris similar to cathepsin E isoform a preproprotein (LOC488577), mRNA Length = 1287 Score = 44.1 bits (22), Expect = 0.61 Identities = 43/50 (86%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtc 390 |||||||| || ||||||||||||||||| ||| |||||| ||||||| Sbjct: 1220 atgaagacatcgcccaggatccagagaggcccggctggaggctggatgtc 1171
>gb|AC161241.18| Medicago truncatula clone mth2-193c3, complete sequence Length = 125129 Score = 44.1 bits (22), Expect = 0.61 Identities = 22/22 (100%) Strand = Plus / Minus Query: 482 ccaatggtgaactcaatgtcag 503 |||||||||||||||||||||| Sbjct: 96054 ccaatggtgaactcaatgtcag 96033
>emb|AL450337.24| Human DNA sequence from clone RP11-51B10 on chromosome 10 Contains the 5' end of the PARD3 gene for par-3 partitioning defective 3 homolog (C.elegans), a novel gene, a pseudogene similar to part of synovial sarcoma translocation, chromosome 18 protein (SS18), a peroxiredoxin 2 (PRDX2) pseudogene and a CpG island, complete sequence Length = 173987 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 389 tccatggctgtgaatccactgatgca 414 ||||||| |||||||||||||||||| Sbjct: 124262 tccatggatgtgaatccactgatgca 124237
>emb|AJ579366.1|CRE579366 Chlamydomonas reinhardtii mRNA for aspartic proteinase (chlapsin gene) Length = 2443 Score = 44.1 bits (22), Expect = 0.61 Identities = 46/54 (85%) Strand = Plus / Minus Query: 310 gccgtagtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 ||||||||| || |||||||| || | ||||| ||| | ||||||||||||||| Sbjct: 1847 gccgtagtcgaacacggtgtgataggcgcccaggaatatgtctcccaggatcca 1794
>gb|AC169788.4| Medicago truncatula clone mth2-28c18, complete sequence Length = 122876 Score = 44.1 bits (22), Expect = 0.61 Identities = 40/46 (86%) Strand = Plus / Plus Query: 317 tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||||||| |||||||| |||||||||||| ||||| ||||||| Sbjct: 115443 tcaaagactgtgtggtaacggcccatgaagatatctccaaggatcc 115488
>gb|AC134967.20| Medicago truncatula clone mth2-26b8, complete sequence Length = 133030 Score = 44.1 bits (22), Expect = 0.61 Identities = 40/46 (86%) Strand = Plus / Minus Query: 317 tcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 |||||||| |||||||| |||||||||||| ||||| ||||||| Sbjct: 6263 tcaaagactgtgtggtaacggcccatgaagatatctccaaggatcc 6218
>emb|AJ550949.2|TBE550949 Trematomus bernacchii mRNA for pepsin A1 Length = 1270 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||| ||||||||||||||||| Sbjct: 1066 atgaagacatctcccaggatccagag 1041
>emb|AJ550950.1|TBE550950 Trematomus bernacchii partial mRNA for pepsin A2 Length = 1259 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||| ||||||||||||||||| Sbjct: 1059 atgaagacatctcccaggatccagag 1034
>ref|NM_205054.1| Gallus gallus pepsinogen (LOC395926), mRNA Length = 1276 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||||||||||| ||||||||| Sbjct: 1104 atgaagacgtctcccaagatccagag 1079
>gb|AF164143.1|AF164143 Ovis aries cathepsin D (CTSD) mRNA, partial cds Length = 1095 Score = 44.1 bits (22), Expect = 0.61 Identities = 46/54 (85%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagaggaccgcgaggaggcgggatgtccatg 394 ||||| ||||| |||||||||||||| || |||| || || |||||||||||| Sbjct: 1088 atgaacacgtcgcccaggatccagagcggcccgccgggcggggggatgtccatg 1035
>dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F13, full insert sequence Length = 1900 Score = 44.1 bits (22), Expect = 0.61 Identities = 34/38 (89%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcg 375 ||||||||||| ||||| || ||||| ||||||||||| Sbjct: 1582 cccatgaagacatctccaagaatccaaagaggaccgcg 1545
>gb|AY103982.1| Zea mays PCO140262 mRNA sequence Length = 1929 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 359 atccagagaggaccgcgaggaggcgg 384 |||||||||||||| ||||||||||| Sbjct: 1573 atccagagaggaccacgaggaggcgg 1548
>dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mRNA for aspartic proteinase, complete cds Length = 1774 Score = 44.1 bits (22), Expect = 0.61 Identities = 34/38 (89%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcg 375 ||||||||||| ||||| || ||||| ||||||||||| Sbjct: 1511 cccatgaagacatctccaagaatccaaagaggaccgcg 1474
>dbj|D00215.1|CHKPSN Gallus gallus mRNA for pepsinogen, complete cds Length = 1276 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 |||||||||||||||| ||||||||| Sbjct: 1104 atgaagacgtctcccaagatccagag 1079
>dbj|AB028888.1| Oryza sativa RAP mRNA for aspartic proteinase, partial cds Length = 492 Score = 44.1 bits (22), Expect = 0.61 Identities = 34/38 (89%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagaggaccgcg 375 ||||||||||| ||||| || ||||| ||||||||||| Sbjct: 218 cccatgaagacatctccaagaatccaaagaggaccgcg 181
>dbj|AB047243.1| Suncus murinus pgnA mRNA for pepsinogen A, complete cds Length = 1362 Score = 44.1 bits (22), Expect = 0.61 Identities = 25/26 (96%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagag 366 ||||||||||| |||||||||||||| Sbjct: 1169 atgaagacgtcacccaggatccagag 1144
>ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT4G04460 mRNA, complete cds Length = 1712 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 |||||||| || |||||||||| || |||| |||||||||||| || ||||| Sbjct: 1535 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1483
>ref|XM_657624.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5112.2), mRNA Length = 2349 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 365 agaggaccgcgaggaggcggg 385 ||||||||||||||||||||| Sbjct: 2247 agaggaccgcgaggaggcggg 2267
>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete sequence Length = 186859 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 catgtcaggcagggtctttga 157 ||||||||||||||||||||| Sbjct: 45832 catgtcaggcagggtctttga 45812
>emb|AL603831.23| Human DNA sequence from clone RP11-486H9 on chromosome 10 Contains the 3' end of the gene for adenovirus 5 E1A binding protein (BS69), the gene for a novel protein (KIAA0934) and four CpG islands, complete sequence Length = 179755 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 cagcatatatacacaacacac 189 ||||||||||||||||||||| Sbjct: 54099 cagcatatatacacaacacac 54119
>emb|AL365502.57| Human DNA sequence from clone RP11-48C7 on chromosome 9q34.2-34.3 Contains the gene for nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624), a novel gene (FLJ31318), the MRPL41 gene for mitochondrial ribosomal protein L41 (RPML27, MRP-L270), a novel gene (LOC9271), the gene for melanin-concentrating hormone receptor 1 interacting zinc-finger protein (ZMYND17) (MIZIP), a novel gene (MGC40555), a novel protein and eleven CpG islands, complete sequence Length = 174995 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 339 ccatgaagacgtctcccagga 359 ||||||||||||||||||||| Sbjct: 15785 ccatgaagacgtctcccagga 15805
>emb|AL118509.9|HSJ770C23 Human DNA sequence from clone RP4-770C23 on chromosome 20 Contains part of the C20orf23 gene for a novel protein similar to KIF1 type and other kinesin-like proteins, complete sequence Length = 81487 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 589 tatgagatcctgggtcttgtt 609 ||||||||||||||||||||| Sbjct: 13775 tatgagatcctgggtcttgtt 13755
>emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D Length = 1442 Score = 42.1 bits (21), Expect = 2.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 341 atgaagacgtctcccaggatccagagagg 369 |||||||| |||||||||||||| ||||| Sbjct: 1268 atgaagacatctcccaggatccaaagagg 1240
>emb|AL832856.1|HSM804167 Homo sapiens mRNA; cDNA DKFZp667P1625 (from clone DKFZp667P1625) Length = 5327 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 339 ccatgaagacgtctcccagga 359 ||||||||||||||||||||| Sbjct: 4335 ccatgaagacgtctcccagga 4315
>dbj|AK221179.1| Arabidopsis thaliana mRNA for putative aspartic protease, complete cds, clone: RAFL22-98-B11 Length = 536 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 |||||||| || |||||||||| || |||| |||||||||||| || ||||| Sbjct: 355 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 303
>gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mRNA, complete cds Length = 1677 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 |||||||| || |||||||||| || |||| |||||||||||| || ||||| Sbjct: 1519 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1467
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 atatatacacaacacacatca 193 ||||||||||||||||||||| Sbjct: 2859077 atatatacacaacacacatca 2859097
>emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS1ZB10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1688 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 |||||||| || |||||||||| || |||| |||||||||||| || ||||| Sbjct: 1535 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1483
>emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL89ZE03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1593 Score = 42.1 bits (21), Expect = 2.4 Identities = 45/53 (84%) Strand = Plus / Minus Query: 326 gtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcgagg 378 |||||||| || |||||||||| || |||| |||||||||||| || ||||| Sbjct: 1486 gtgtggtatggtcccatgaagatatcacccaagatccagagaggtccacgagg 1434
>dbj|AP005632.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0050B07 Length = 142134 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 atatatacacaacacacatca 193 ||||||||||||||||||||| Sbjct: 29364 atatatacacaacacacatca 29384
>dbj|AK024443.1| Homo sapiens mRNA for FLJ00033 protein, partial cds Length = 4150 Score = 42.1 bits (21), Expect = 2.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 339 ccatgaagacgtctcccagga 359 ||||||||||||||||||||| Sbjct: 3176 ccatgaagacgtctcccagga 3156
>gb|AY961419.1| Phytophthora infestans clone PB005D3 aspartic protease mRNA, complete cds Length = 1312 Score = 42.1 bits (21), Expect = 2.4 Identities = 42/49 (85%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 |||||||||| |||| || | || |||||||||||| ||||||||||| Sbjct: 1151 agtcaaagactgtgtagtgcttgcgcatgaagacgtcgcccaggatcca 1103
>gb|AF036319.1|AF036319 Sparus aurata cathepsin D mRNA, complete cds Length = 1837 Score = 42.1 bits (21), Expect = 2.4 Identities = 66/81 (81%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatccagagaggaccgcg 375 ||||||||| |||| |||| || ||||| || |||||||||||||| || || || Sbjct: 1236 gtcaaagacagtgtagtacttcccgatgaatacatctcccaggatccacagggggcctgc 1177 Query: 376 aggaggcgggatgtccatggc 396 |||||| |||||||||||||| Sbjct: 1176 aggaggagggatgtccatggc 1156
>gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 section 13 of 16 of the complete genome Length = 294253 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tatacacaacacacatcacc 195 |||||||||||||||||||| Sbjct: 284374 tatacacaacacacatcacc 284355
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 cgcctccacgatggggcgct 262 |||||||||||||||||||| Sbjct: 288303 cgcctccacgatggggcgct 288284
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tatacacaacacacatcacc 195 |||||||||||||||||||| Sbjct: 4255647 tatacacaacacacatcacc 4255666
>gb|AY168570.1| Leishmania tarentolae 6-phosphogluconate dehydrogenase gene, partial cds Length = 822 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 ccgcctccacgatggggcgc 261 |||||||||||||||||||| Sbjct: 193 ccgcctccacgatggggcgc 174
>gb|AC005105.3| Homo sapiens BAC clone CTA-491N20 from 7, complete sequence Length = 177206 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 409 gatgcactgggcagcagctc 428 |||||||||||||||||||| Sbjct: 119877 gatgcactgggcagcagctc 119896
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds Length = 590284 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 caacatcttaggggcaaacg 96 |||||||||||||||||||| Sbjct: 393555 caacatcttaggggcaaacg 393574
>gb|AC123938.3| Mus musculus BAC clone RP23-412I12 from chromosome 8, complete sequence Length = 193352 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 catatatacacaacacacat 191 |||||||||||||||||||| Sbjct: 5837 catatatacacaacacacat 5818
>gb|AC122434.2| Mus musculus BAC clone RP24-198G2 from chromosome 8, complete sequence Length = 168940 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 catatatacacaacacacat 191 |||||||||||||||||||| Sbjct: 8973 catatatacacaacacacat 8992
>emb|AL389888.8| Human DNA sequence from clone RP11-389K14 on chromosome 9 Contains two olfactory receptor pseudogenes and the 3' end of a novel gene, complete sequence Length = 202874 Score = 40.1 bits (20), Expect = 9.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 agcagcatgcagcatatatacaca 183 ||||| |||||||||||||||||| Sbjct: 168294 agcaggatgcagcatatatacaca 168271
>gb|AC102705.10| Mus musculus, clone RP24-400C16, complete sequence Length = 135473 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 agggtctttgaaaagcagca 166 |||||||||||||||||||| Sbjct: 24515 agggtctttgaaaagcagca 24534
>emb|AL110503.2|HSJ1100I6 Human DNA sequence from clone RP5-1100I6 on chromosome 20 Contains a novel gene, a novel gene (FLJ33581) and a CpG island, complete sequence Length = 161525 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 625 ctgcatccatacaacagcca 644 |||||||||||||||||||| Sbjct: 24289 ctgcatccatacaacagcca 24270
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tatacacaacacacatcacc 195 |||||||||||||||||||| Sbjct: 4589305 tatacacaacacacatcacc 4589286
>emb|AJ414160.1| Yersinia pestis strain CO92 complete genome; segment 20/20 Length = 203728 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tatacacaacacacatcacc 195 |||||||||||||||||||| Sbjct: 63478 tatacacaacacacatcacc 63459
>gb|AC092211.7| Oryza sativa chromosome 10 P0031G09 genomic sequence, complete sequence Length = 17072 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 395 gctgtgaatccactgatgca 414 |||||||||||||||||||| Sbjct: 12155 gctgtgaatccactgatgca 12136
>gb|AC153567.6| Mus musculus 10 BAC RP23-187C5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 226945 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 ggtctttgaaaagcagcatg 168 |||||||||||||||||||| Sbjct: 222625 ggtctttgaaaagcagcatg 222644
>gb|AF149806.1| Oryza sativa hypothetical protein, fertilin alpha subunit, membrane protein homolog, and Myb-related protein genes, complete cds; and unknown gene Length = 33178 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tctttgaaaagcagcatgca 170 |||||||||||||||||||| Sbjct: 5386 tctttgaaaagcagcatgca 5367
>gb|AC096635.2| Homo sapiens chromosome 1 clone RP11-75H16, complete sequence Length = 173256 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 caacatcttaggggcaaacg 96 |||||||||||||||||||| Sbjct: 51055 caacatcttaggggcaaacg 51036
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 gcatgcagcatatatacaca 183 |||||||||||||||||||| Sbjct: 19532023 gcatgcagcatatatacaca 19532004
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tctttgaaaagcagcatgca 170 |||||||||||||||||||| Sbjct: 379557 tctttgaaaagcagcatgca 379538
>emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039F02, complete sequence Length = 122499 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 gcatgcagcatatatacaca 183 |||||||||||||||||||| Sbjct: 52670 gcatgcagcatatatacaca 52651
>gb|AC159380.8| Mus musculus 10 BAC RP24-460M18 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 196877 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 149 ggtctttgaaaagcagcatg 168 |||||||||||||||||||| Sbjct: 7462 ggtctttgaaaagcagcatg 7481
>dbj|AB080684.1| Xenopus laevis CE1 mRNA for cathepsin E1, complete cd Length = 1604 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 350 tctcccaggatccagagagg 369 |||||||||||||||||||| Sbjct: 1124 tctcccaggatccagagagg 1105
>dbj|AB179551.1| Takifugu rubripes NTS mRNA for nothepsin, complete cds Length = 1245 Score = 40.1 bits (20), Expect = 9.5 Identities = 41/48 (85%) Strand = Plus / Minus Query: 316 gtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 |||||||||| ||| |||| || || ||| ||||||||||||||||| Sbjct: 1191 gtcaaagacgctgtagtactgggtcaggaacacgtctcccaggatcca 1144
>dbj|AB179548.1| Takifugu rubripes CTSD1 mRNA for cathepsin D1, complete cds Length = 1191 Score = 40.1 bits (20), Expect = 9.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 320 aagacggtgtggtacgggcccatgaagacgtctcccaggatcca 363 |||||||||| |||| | || || ||||||||||| |||||||| Sbjct: 1148 aagacggtgtagtactgaccaataaagacgtctccaaggatcca 1105
>gb|AC154228.1| Mus musculus BAC clone RP24-143I4 from chromosome 14, complete sequence Length = 164697 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 catatatacacaacacacat 191 |||||||||||||||||||| Sbjct: 55258 catatatacacaacacacat 55277
>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644B06 Length = 194509 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tctttgaaaagcagcatgca 170 |||||||||||||||||||| Sbjct: 89510 tctttgaaaagcagcatgca 89491
>dbj|AB091763.1| Glycine max soyAP5 mRNA for aspartic proteinase 5, partial cds Length = 636 Score = 40.1 bits (20), Expect = 9.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 287 ttggcaaagccaatacgcagcttgccgtagtcaaagacggtgtg 330 |||||||| |||| || || ||||| ||||||||||||||||| Sbjct: 518 ttggcaaaaccaactcggagattgccatagtcaaagacggtgtg 475
>dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase 1, complete cds Length = 1719 Score = 40.1 bits (20), Expect = 9.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 338 cccatgaagacgtctcccaggatccagagagg 369 ||||||||||| || || |||||||||||||| Sbjct: 1484 cccatgaagacatcaccaaggatccagagagg 1453
>dbj|AB028607.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K13N2 Length = 77483 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 gcatgcagcatatatacaca 183 |||||||||||||||||||| Sbjct: 56273 gcatgcagcatatatacaca 56292
>gb|AC102466.11| Mus musculus chromosome 3, clone RP24-337A2, complete sequence Length = 164455 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 cttgccatcttaggaaccaa 128 |||||||||||||||||||| Sbjct: 21809 cttgccatcttaggaaccaa 21790
>gb|AC107453.14| Mus musculus chromosome 15, clone RP23-315F3, complete sequence Length = 193381 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 catatatacacaacacacat 191 |||||||||||||||||||| Sbjct: 38488 catatatacacaacacacat 38469
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome Length = 5411809 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 602 gtcttgttctgtgcaagttg 621 |||||||||||||||||||| Sbjct: 2791025 gtcttgttctgtgcaagttg 2791044
>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete sequence Length = 123386 Score = 40.1 bits (20), Expect = 9.5 Identities = 41/48 (85%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 ||||||| ||||||||||| ||||||||| || ||||||| ||||| Sbjct: 97468 agtcaaatacggtgtggtatttgcccatgaacacatctcccaagatcc 97421
>gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, complete cds Length = 5381 Score = 40.1 bits (20), Expect = 9.5 Identities = 41/48 (85%) Strand = Plus / Minus Query: 315 agtcaaagacggtgtggtacgggcccatgaagacgtctcccaggatcc 362 ||||||| ||||||||||| ||||||||| || ||||| ||||||| Sbjct: 4813 agtcaaacacggtgtggtatttgcccatgaacacatctccaaggatcc 4766
>emb|AL844486.12| Mouse DNA sequence from clone RP23-249P4 on chromosome 2, complete sequence Length = 118787 Score = 40.1 bits (20), Expect = 9.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 147 agggtctttgaaaagcagca 166 |||||||||||||||||||| Sbjct: 75067 agggtctttgaaaagcagca 75086
>dbj|AB025359.2| Helianthus annuus mRNA for aspartic proteinase, complete cds Length = 1722 Score = 40.1 bits (20), Expect = 9.5 Identities = 25/27 (92%) Strand = Plus / Minus Query: 626 tgcatccatacaacagccatctnacag 652 |||||||| ||||||||||||| |||| Sbjct: 1197 tgcatccaaacaacagccatctcacag 1171 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,108,386 Number of Sequences: 3902068 Number of extensions: 5108386 Number of successful extensions: 94836 Number of sequences better than 10.0: 178 Number of HSP's better than 10.0 without gapping: 176 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 94346 Number of HSP's gapped (non-prelim): 488 length of query: 694 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 671 effective length of database: 17,143,297,704 effective search space: 11503152759384 effective search space used: 11503152759384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)